Recombinant III-type humanized collagen as well as coding gene and application thereof

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to recombinant III-type humanized collagen as well as a coding gene and application thereof. According to the invention, a novel III-type humanized collagen sequence is designed by adopting an advanced AI technology and molecular dynamics simulation, so that the recombinant III-type humanized collagen product is ensured to have high stability and degradation resistance. According to the invention, the screened new III-type humanized collagen sequence is transferred to the pichia pastoris strain for recombinant expression, and the prepared recombinant III-type humanized collagen has the advantages of strong stability, high expression quantity and good hydrophilicity, and meanwhile, the recombinant III-type humanized collagen also has obvious effects of promoting cell proliferation and cell adhesion.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular relates to a recombinant type III humanized collagen protein and a coding gene and application thereof. Background Art

[0002] Collagen is the most abundant protein in mammals, and is found in many tissues such as skin, bones, tendons, cartilage and blood vessels. Common collagens include type I, type III, type XVII, etc. Type III collagen is a triple helix structure formed by three identical polypeptide α chains spirally wound together, with a highly conserved amino acid sequence. Glycine, proline and hydroxyproline are repeated at specific positions, forming a unique three-dimensional structure. Together with type I collagen, it forms the basement membrane of the skin, providing it with strength and elastic support. Collagen has inherent biocompatibility, biodegradability and absorbability, and functions such as promoting the formation of new cells and epithelial cells. It has great application prospects in the medical field, beauty, cosmetics, and health care products industries.

[0003] The development of recombinant technology has enabled the production of type III collagen with high purity and specificity without the use of animal sources. Recombinant type III collagen is obtained by optimizing and recombinantly expressing the original gene sequence of human type III collagen using genetic engineering technology, overcoming a series of problems such as low biological activity, poor solubility, low bioavailability, and easy to cause immune response and allergies when collagen is extracted using traditional methods.

[0004] Patent document CN114085284A discloses a recombinant type III humanized collagen, nucleic acid, carrier and implant. The recombinant type III humanized collagen is a peptide sequence 549-560aa, 597-613aa, 881-902aa, 648-662aa obtained through long-term screening from the α1 chain of natural human type III collagen, and the four peptide chains are spliced ​​in sequence to form monomers, and then the monomers are expressed in series. After fermentation and purification, the obtained recombinant type III humanized collagen has high stability, which effectively solves the problem of degradation of recombinant type III humanized collagen during clinical use, and can be prepared into a liquid preparation for storage and use.

[0005] Patent document CN116987176A discloses a recombinant type III humanized collagen and its application. The recombinant type III humanized collagen is a target sequence of a sequence with good water solubility, cell adhesion fragments, a non-hydroxyproline-dependent triple helical segment, and a cysteine ​​stability segment, and the target sequence is repeated 1 to 10 times. The recombinant type III humanized collagen is 100% identical in structure to the corresponding segment of the human type III collagen sequence, and will not cause immune rejection when applied to the human body.

[0006] Patent document CN118773255A discloses a preparation method and application of recombinant full-length type III humanized collagen. The recombinant full-length type III humanized collagen is synthesized by optimizing the amino acid sequence of the mature peptide of the α1 chain of human type III collagen through genetic engineering codon sequence and expression vector, and then transferred into HEK293F host cells for recombinant expression to obtain a secretory high-expression strain or cell line, and the product is purified to obtain recombinant full-length type III humanized collagen. The obtained recombinant collagen has wide application potential in repair and regenerative medicine, medical cosmetic filling materials and functional cosmetic materials.

[0007] However, the recombinant collagen currently prepared by genetic engineering methods still has problems such as low expression, low solubility, low activity or easy degradation of recombinant collagen. Therefore, researching and developing a type III collagen with stable collagen structure, high resistance to degradation, good hydrophilicity and high biological activity is still a difficulty that needs to be solved urgently. Summary of the invention

[0008] In order to solve the defects of the prior art, the present invention provides a new recombinant type III humanized collagen. The present invention adopts advanced AI technology and molecular dynamics simulation to design a new type III humanized collagen sequence, ensuring that the recombinant type III humanized collagen product has high stability and anti-degradation properties. The present invention transfers the screened new type III humanized collagen sequence to the Pichia yeast strain for recombinant expression. The obtained recombinant type III humanized collagen has the advantages of strong stability, high expression level and good hydrophilicity. At the same time, the recombinant type III humanized collagen also has a significant effect of promoting cell proliferation and cell adhesion.

[0009] To achieve the above purpose, the technical solution adopted by the present invention is:

[0010] The present invention provides a recombinant type III humanized collagen, which consists of tandemly repeated monomers and an amino acid peptide with a tail-spliced ​​amino acid sequence as shown in SEQ ID NO:4. The monomer is formed by sequentially splicing the amino acid peptide shown in SEQ ID NO:1 and the amino acid peptide shown in SEQ ID NO:2, and the number of tandemly repeated monomers is 10.

[0011] Furthermore, the amino acid sequence of the monomer is shown in SEQ ID NO:3.

[0012] Furthermore, the amino acid sequence of the recombinant humanized type III collagen is shown in SEQ ID NO:5.

[0013] Furthermore, the present invention provides a gene encoding a recombinant humanized type III collagen, and the nucleotide sequence of the gene encoding the recombinant humanized type III collagen is shown in SEQ ID NO:6.

[0014] Furthermore, the present invention provides a recombinant humanized type III collagen recombinant vector, wherein the recombinant vector comprises a gene encoding the above-mentioned recombinant humanized type III collagen.

[0015] Furthermore, the present invention also provides an engineered strain, which comprises the coding gene of the above-mentioned recombinant humanized type III collagen or the above-mentioned recombinant vector of recombinant humanized type III collagen.

[0016] In addition, the present invention also provides the use of the recombinant type III humanized collagen in the preparation of cosmetics or medical device products.

[0017] Furthermore, the recombinant humanized type III collagen is used in the preparation of anti-aging cosmetics, repair cosmetics or antioxidant cosmetics.

[0018] Furthermore, the recombinant humanized type III collagen is used in the preparation of a collagen dressing that promotes cell proliferation, adhesion and migration.

[0019] In addition, the present invention also provides a composition, which comprises the above-mentioned recombinant humanized type III collagen and an acceptable excipient.

[0020] The new recombinant type III humanized collagen provided by the present invention is based on the α1 chain of human type III collagen, slides a 10-triplet-long window along the triple helix region, and calculates the stability score of each window according to the scoring function; selects sequence fragments with GPP at both ends from the high-scoring sequence fragments, splices them in order to obtain the target sequence fragments, then takes the target sequence fragments as units, repeats them 10 times in series, and finally adds GPPGPCCGGG at the tail to obtain the recombinant type III humanized collagen of the present invention. The recombinant type III humanized collagen prepared by the present invention has the advantages of strong stability, high expression level and good solubility, and the recombinant type III humanized collagen has significant effects of promoting cell proliferation and promoting cell adhesion.

[0021] In summary, compared with the prior art, the recombinant humanized type III collagen provided by the present invention has the following advantages:

[0022] (1) The present invention adopts advanced AI technology and molecular dynamics simulation to design a new type III collagen sequence, which comprehensively improves the structural stability and degradation resistance of type III collagen and solves the problems of poor stability and easy degradation of type III collagen.

[0023] (2) The new recombinant type III humanized collagen amino acid sequence provided by the present invention can be expressed and secreted in a yeast expression system, and the expression level is relatively high. When the fermentation supernatant is diluted 10 times, the brightness of the electrophoresis band is 4 times that of the 66.2KD standard. Moreover, during the shaking flask, fermentation and purification process, the recombinant type III humanized collagen has a single band and high stability, and no degradation bands appear.

[0024] (3) The recombinant humanized type III collagen provided by the present invention has strong solubility, and its solubility in saline solution can reach 100 g / L.

[0025] (4) The recombinant humanized type III collagen provided by the present invention has a significant effect on promoting the proliferation of human embryonic skin fibroblasts (ESF). The cell proliferation rate at 0.03125 mg / mL of recombinant humanized type III collagen is 132.13%, which is 1.24 times that of the 1 mg / mL bovine type I collagen standard.

[0026] (5) The recombinant humanized type III collagen provided by the present invention has a significant effect on promoting the adhesion of L929 cells. The cell adhesion rate of the recombinant humanized type III collagen at a concentration of 1 mg / mL is 78.66%, which is 2.69 times that of the 2 mg / ml bovine type I collagen standard. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1Schematic diagram of the construction of recombinant type III humanized collagen plasmid pPICZαA-hcc6.

[0028] Figure 2 This is the SDS-PAGE electrophoresis diagram of recombinant type III humanized collagen expression in shake flasks (M: Marker; 1: negative control, 2-7: verification of recombinant type III humanized collagen expression in Pichia pastoris genetically engineered bacteria shake flasks).

[0029] Figure 3 This is the SDS-PAGE electrophoresis of the fermentation supernatant of recombinant type III humanized collagen (M: Marker; 1-5: SDS-PAGE electrophoresis of the samples after 10-fold dilution at 0h, 24h, 48h, 72h, and 88h of induction, respectively).

[0030] Figure 4 The figure is the SDS-PAGE electrophoresis result of the purified recombinant type III humanized collagen, (1: recombinant type III humanized collagen; M: Marker).

[0031] Figure 5 This is a graph showing the HPLC detection results of the purified recombinant humanized type III collagen.

[0032] Figure 6 This is the result graph of ESF cell proliferation rate of recombinant humanized type III collagen (NC is blank control, PC is bovine type I collagen standard).

[0033] Figure 7 This is a graph showing the effect of recombinant humanized type III collagen on the proliferation rate of ESF cells and the results of observing the cell status.

[0034] Figure 8 This is a graph showing the adhesion rate of recombinant humanized type III collagen to L929 cells (NC is a blank control, and the reference product is a bovine type I collagen standard product).

[0035] Fig. 9 This is a graph showing the relative adhesion of recombinant humanized type III collagen to L929 cells (NC is a blank control, and the reference product is a bovine type I collagen standard product).

[0036] Fig.10 The figure is the result of cell adhesion of recombinant humanized type III collagen to L929 cells (NC is blank control, reference product is bovine type I collagen standard, PC is 0.1% gelatin). DETAILED DESCRIPTION

[0037] The present invention is further described below by describing specific embodiments, but this is not a limitation of the present invention. Those skilled in the art can make various modifications or improvements based on the basic idea of ​​the present invention, but as long as they do not deviate from the basic idea of ​​the present invention, they are all within the scope of the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified; the materials, reagents, etc. used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0038] Example 1. Design and synthesis of recombinant humanized type III collagen gene

[0039] 1. Amino acid sequence of recombinant humanized type III collagen:

[0040] The present invention is based on human type III collagen α1 chain, slides a window of 10 triplets along the triple helix region, and calculates the stability score of each window according to a scoring function; selects sequence fragments SEQ ID NO.1 and SEQ ID NO.2 with GPP at both ends from the sequence fragments with high scores, splices them in order to obtain a target sequence fragment SEQ ID NO.3 monomer, takes the target sequence fragment SEQ ID NO.3 monomer as a unit, repeats 10 times in series, and finally splices an amino acid peptide shown in SEQ ID NO.4 at the tail to obtain a recombinant type III humanized collagen amino acid sequence shown in SEQ ID NO.5.

[0041] (1) The amino acid sequence of the amino acid peptide with GPP at both ends is (SEQ ID NO: 1):

[0042] GPPGKNGETGPQGPPGPTGPGGDKGDTGPP.

[0043] (2) The amino acid sequence of the amino acid peptide with GPP at both ends is (SEQ ID NO: 2):

[0044] GPPGPRGNRGERGSEGSPGHPGQPGPPGPP.

[0045] (3) The amino acid of the monomer is (SEQ ID NO: 3):

[0046] GPPGKNGETGPQGPPGPTGPGGDKGDTGPPGPRGNRGERGSEGSPGHPGQPGPP.

[0047] (4) The amino acid sequence of the tail-spliced ​​amino acid peptide is (SEQ ID NO: 4):

[0048] GPPGPCCGGG.

[0049] (5) The amino acid sequence of the recombinant humanized type III collagen is (SEQ ID NO: 5):

[0050] .

[0051] 2. Nucleotide sequence of recombinant humanized type III collagen:

[0052] The amino acid sequence of the above-mentioned recombinant type III humanized collagen was designed to correspond to the nucleotide sequence according to the codon preference of Pichia pastoris, and the nucleotide sequence of the recombinant type III humanized collagen was optimized according to the codon preference of Pichia pastoris to obtain the nucleotide sequence of the recombinant type III humanized collagen as shown in SEQ ID NO. 6. Nanjing GenScript Biotechnology Co., Ltd. was commissioned to synthesize it.

[0053] The nucleotide sequence of the recombinant humanized type III collagen is (SEQ ID NO: 6):

[0054] ggaccacccggcaaaaatggagagaccggtccacaaggtcctccgggcccgactggcccgggtggggacaagggagatactggcc

[0055] caccggggcctagagggaaccgtggggaacggggttcggagggatctcccggacatcctggccagccgggtccccccggaccgcccg

[0056] gtaagaatggcgaaacgggacctcaagggcccccaggtccgactggtcccggcggcgataaaggtgacacaggtccgcccggtccacg

[0057] gggaaaccgcggcgagcgcggctcggaaggttctcctggtcatcctgggcaaccaggcccaccgggcccgcccggaaagaatggtgag

[0058] acaggtccgcagggccctccagggcccacggggcctggtggggacaagggggacacaggacctcctggtccccgtggaaaccggggt

[0059] gaaagaggatccgagggttctcccgggcacccaggtcaaccgggtccccctgggcccccaggaaagaatggcgagaccggacctcaag

[0060] gtcccccgggacccactggtcctggcggggataagggggatacaggacccccgggtcctaggggaaaccgaggtgagaggggatccg

[0061] aagggtcgcccggccatccaggccagcctgggccgcccggcccaccgggcaagaatggagaaactgggcctcaaggcccaccgggac

[0062] caaccgggcctggtggcgacaaaggtgatactggaccgccgggtccaaggggtaatcgcggtgaacgaggaagtgagggaagtccagg

[0063] ccacccagggcagcccggaccccctggccctcctgggaagaatggggagacgggtccccaagggccaccaggtccaaccggccctgg

[0064] aggtgacaaaggggatacgggcccaccagggccccgaggcaaccgaggcgagagaggttccgaggggagccccgggcaccctggac

[0065] aacccgggcctcccggaccccctgggaaaaatggggaaacaggcccgcagggcccccctggaccgacgggtccagggggcgacaag

[0066] ggtgacacagggccccccggcccaagaggaaaccgcggggaaagaggatcagaaggtagcccggggcatccaggacagccgggacc

[0067] accaggacctcccggtaaaaacggggaaacgggcccacaggggcccccgggccctaccgggccaggcggcgacaaaggtgatacag

[0068] gtcccccaggcccgagggggaacagaggagagcggggcagcgaagggtcccctggtcacccagggcaacctggtccgcctggaccac

[0069] cagggaaaaatggggaaactgggccgcaaggcccaccggggcctaccggacccgggggagataaaggtgacaccggccctcctgggc

[0070] cgcgtggcaatcgtggagaacgtggaagtgagggctcaccgggccacccgggacagcctggtcccccgggaccacccggaaagaacg

[0071] gtgaaactggcccacagggccccccgggtccgacgggcccggggggggataaaggagatacgggacctccaggacgcggggcaaccgcggagagaggggatctgagggatcaccgggccatcctggccagcccggacctccggggccacccggtccttgttgcggtggcggt.

[0072] 3. Construction of recombinant plasmid:

[0073] The nucleotide sequence of the above-synthesized recombinant type III humanized collagen was constructed into the pPICZαA vector to obtain a recombinant type III humanized collagen plasmid named pPICZαA-hcc6. The schematic diagram of the recombinant type III humanized collagen plasmid pPICZαA-hcc6 constructed by the present invention is shown in FIG. Figure 1 shown.

[0074] Example 2: Preparation of genetically engineered strains producing recombinant humanized type III collagen

[0075] 1. Preparation of linearized plasmid:

[0076] The plasmid was linearized by a single enzyme digestion method, and the recombinant type III humanized collagen plasmid pPICZαA-hcc6 prepared in Example 1 was extracted, digested with SacI enzyme, and then recovered by ethanol precipitation to obtain the recombinant type III humanized collagen linearized plasmid.

[0077] 2. Preparation of competent yeast:

[0078] Inoculate Pichia pastoris strain X-33 into YPD liquid medium, culture overnight at 28°C and 220rpm, and measure the OD600 value of the bacterial solution. Inoculate into 50mL YPD liquid medium according to the initial OD600=0.5 and culture until the OD600 is 1.3-1.5. Centrifuge at 4°C and 3000g for 5min and discard the medium. Add 50mL sterile water to resuspend the yeast cells, centrifuge at 4°C and 3000g for 5min and discard the supernatant. Add 25mL sterile water to resuspend the yeast cells, centrifuge at 4°C and 3000g for 5min and discard the supernatant. Add 1mL pre-cooled sorbitol to resuspend the yeast cells, centrifuge at 4°C and 3000g for 5min and discard the supernatant. Add 100μL pre-cooled sorbitol to resuspend the yeast cells, and dispense the bacterial solution into 80μL / tubes.

[0079] 3. Pichia pastoris transformation:

[0080] Take 10 μL of the prepared recombinant type III humanized collagen linearized plasmid and add it to the Pichia competent medium, mix well, and transfer it to the pre-cooled electroporation cup on ice, and place it on ice for more than 5 minutes. Wipe the outer wall of the electroporation cup dry, put it into the electroporator, add 1 mL of sorbitol to suspend the bacteria, and then transfer the liquid to a 1.5 mL centrifuge tube, incubate it at 28°C for 3 to 12 hours, then spread it on a YPD plate containing 0.1 mg / mL bleomycin, and incubate it at 28°C until colonies grow.

[0081] 4. Expression verification of recombinant humanized type III collagen gene engineering strain:

[0082] Pick a single colony in 10 mL of BMGY medium and culture at 28°C and 220 rpm until OD600 = 2-6. Centrifuge at 3000g for 5 min, resuspend the yeast cells in 10 mL of BMMY medium until OD600 = 1, continue to culture at 28°C and 220 rpm, and add methanol every 24 hours to a final concentration of 0.5%. After 72 hours of induction, centrifuge and take the supernatant, and send it to SDS-PAGE for electrophoresis detection.

[0083] The results of SDS-PAGE electrophoresis of the recombinant type III humanized collagen prepared by the present invention are as follows: Figure 2 shown. Figure 2 This is the SDS-PAGE electrophoresis diagram of recombinant type III humanized collagen shake flask expression, (M: Marker; 1: negative control, 2-7: recombinant type III humanized collagen Pichia pastoris genetic engineering bacteria shake flask expression verification), from Figure 2 It can be seen that the novel recombinant type III humanized collagen amino acid sequence provided by the present invention is successfully expressed and secreted in the Pichia pastoris expression system.

[0084] Example 3: Preparation of recombinant humanized type III collagen

[0085] 1. Fermentation of recombinant humanized type III collagen:

[0086] The recombinant type III humanized collagen expression strain prepared in Example 2 was inoculated into YPD medium and cultured at 28°C and 220rpm until the seed solution concentration OD600 was 15-25, and no foreign bacteria were found under microscopic examination. The seed solution was inoculated into a 20L fermenter (containing 8LBSM medium) at an inoculum of 5%, and the initial culture conditions were: a rotation speed of 100rpm, a tank pressure of 0.05MPa, a pH of 5.2, and a temperature of 30°C. The dissolved oxygen was controlled to be above 30% by adjusting the air flow and stirring speed.

[0087] When the carbon source in the initial fermentation medium is exhausted, the dissolved oxygen rises suddenly, and 50% glycerol is added to supplement the carbon source. When the carbon source (50% glycerol) is exhausted, the glycerol feeding is stopped, and methanol is added to start induction, and the dissolved oxygen (DO) is maintained above 5% by adjusting the rotation speed, air flow rate and methanol flow rate. The fermentation supernatant is taken at 0h, 24h, 48h, 72h, and 88h of induction, and SDS-PAGE electrophoresis is performed.

[0088] The SDS-PAGE electrophoresis diagram of the fermentation supernatant of the recombinant type III humanized collagen prepared by the present invention is as follows: Figure 3 shown. Figure 3 The SDS-PAGE electrophoresis diagram of the fermentation supernatant of recombinant type III humanized collagen (M: Marker; 1-5: SDS-PAGE electrophoresis diagrams of the samples diluted 10 times after induction at 0h, 24h, 48h, 72h, and 88h, respectively). Figure 3 It can be seen that at 88h of induction, the fermentation supernatant was diluted 10 times, the brightness of the electrophoresis band was 4 times that of the 66.2KD standard, and the electrophoretic purity was 95.2%.

[0089] 2. Purification of recombinant humanized type III collagen:

[0090] The fermentation was terminated after 88 hours of induction to obtain a fermentation product, which was centrifuged at 10°C and 9000 rpm for 20 minutes to obtain a fermentation filtrate. The fermentation filtrate was used to capture the protein using a cation exchange medium, and the recombinant type III humanized collagen was eluted with an eluent (10 mmol / LPB buffer, pH 8.0). The purified recombinant type III humanized collagen was subjected to SDS-PAGE electrophoresis and HPLC detection.

[0091] The results of SDS-PAGE electrophoresis and HPLC detection of the purified recombinant type III humanized collagen of the present invention are as follows: Figure 4 and Figure 5 shown. Figure 4 The figure is the SDS-PAGE electrophoresis result of the purified recombinant type III humanized collagen, (1: recombinant type III humanized collagen; M: Marker). Figure 5 This is a graph showing the HPLC detection results of the purified recombinant humanized type III collagen.

[0092] from Figure 4 It can be seen that the electrophoretic purity of the recombinant type III humanized collagen prepared by the present invention is 97.3%. Figure 5 It can be seen that the purity of the recombinant type III humanized collagen prepared by the present invention is 92.49% as detected by HPLC.

[0093] Example 4: Solubility test of recombinant humanized type III collagen

[0094] 1. Experimental methods:

[0095] The recombinant humanized type III collagen prepared in Example 3 was dissolved in 15 mL of PBS (pH 7.4) solvent to prepare recombinant humanized type III collagen solutions with concentrations of 10 g / L, 15 g / L, 25 g / L, 50 g / L, and 100 g / L. The time required for complete dissolution of the recombinant humanized type III collagen was recorded, and no precipitation occurred after standing for 30 min.

[0096] 2. Experimental results:

[0097] The experimental results are shown in Table 1.

[0098] Table 1 Solubility test results of recombinant type III humanized collagen

[0099]

[0100]

[0101] As can be seen from Table 1, the recombinant type III humanized collagen prepared in the present invention has strong solubility, and its solubility in saline solution can reach 100 g / L.

[0102] Example 5: Evaluation of cell proliferation activity of recombinant humanized type III collagen

[0103] 1. Experimental methods:

[0104] 1.1. Grouping:

[0105] The positive control group (PC) was the bovine type I collagen standard of the China Food and Drug Administration, and the detection concentration was 1 mg / mL. The experimental sample group was the recombinant type III humanized collagen prepared in Example 3 of the present invention, and the detection concentrations included 2 mg / mL, 1 mg / mL, 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, 0.0625 mg / mL, 0.03125 mg / mL, and 0.015625 mg / mL.

[0106] 1.2. Cell proliferation rate detection:

[0107] Each group of samples was prepared with DMEM culture medium, added to a 96-well plate, and refrigerated for 24 hours; the culture medium in the wells was discarded, and human embryonic skin fibroblast (ESF) cells in good growth state were taken, digested and counted, and inoculated into a 96-well plate after adjusting the cell density, and cultured for 24 hours; the cells were observed under a microscope (100 μm) and photographed; 76 μL of CCK-8 working solution was added, cultured in the dark for 1 hour, and shaken for 30 minutes; the absorbance value of each well at a wavelength of 450 nm was measured in an ELISA instrument, and the cell proliferation rate was calculated.

[0108] The cell proliferation rate was calculated as follows:

[0109] Cell proliferation rate = OD 450e / OD 450b (OD 450e is the absorbance of the experimental sample group and the positive control group; OD 450b is the absorbance of the blank control group).

[0110] 2. Experimental results:

[0111] The experimental results are shown in Table 2 and Figure 6-7 shown.

[0112] 2.1. The results of the test on the proliferation rate of ESF cells by recombinant humanized type III collagen are shown in Table 2:

[0113] Table 2 Results of the test on the proliferation rate of ESF cells by recombinant humanized type III collagen

[0114]

[0115]

[0116] 2.2. Effect of recombinant humanized type III collagen on the proliferation rate of ESF cells Figure 6 As shown:

[0117] Figure 6 This is the result graph of ESF cell proliferation rate of recombinant humanized type III collagen (NC is blank control, PC is bovine type I collagen standard).

[0118] 2.3. Effect of recombinant humanized type III collagen on the proliferation rate of ESF cells and observation of cell status Figure 7 As shown:

[0119] Figure 7 This is a graph showing the effect of recombinant humanized type III collagen on the proliferation rate of ESF cells and the results of observing the cell status.

[0120] From Table 2 and Figure 6 It can be seen that the cell proliferation rate of ESF cells of the recombinant humanized type III collagen prepared by the present invention at concentrations of 2 mg / mL, 1 mg / mL, 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, 0.0625 mg / mL, 0.03125 mg / mL and 0.015625 mg / mL is higher than that of the blank control group (NC) and the positive control group (PC), and the cell proliferation rate of 0.03125 mg / mL recombinant humanized type III collagen is 1.24 times that of 1 mg / mL bovine type I collagen standard.

[0121] from Figure 7 It can be seen that from the cell number, it can be judged that the recombinant type III humanized collagen prepared by the present invention has a significant effect on promoting the proliferation of ESF cells at concentrations of 2 mg / mL, 1 mg / mL, 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, 0.0625 mg / mL, 0.03125 mg / mL and 0.015625 mg / mL.

[0122] Example 6 Evaluation of cell adhesion activity of recombinant humanized type III collagen

[0123] 1. Experimental methods:

[0124] 1.1. Grouping:

[0125] The reference product was bovine type I collagen standard product of China Food and Drug Administration, with a sample concentration of 2 mg / mL; the positive control group was sigma gelatin, with a sample concentration of 0.1%; the experimental sample group was the recombinant type III humanized collagen prepared in Example 3 of the present invention, with sample concentrations of 0.25 mg / mL, 1 mg / mL, and 4 mg / mL.

[0126] 1.2. Cell adhesion rate detection:

[0127] Sample coating: Add sample solution to 96-well plate, incubate at 37℃ for 1h. Wash once with PBS. Block with 1% BSA at 37℃ for 1h, and wash twice with PBS.

[0128] Cell plating, centrifugation and photography: Mouse skin fibroblasts (L929) were digested; resuspended and counted, and the cell density was adjusted to 1×10 5 cells / mL, and add Hoechst 33342, immediately add to 96-well plate, add 100μL to each well. Incubate cells at 37℃ for 1h. After filling with culture medium, seal with sealing film, turn the culture plate upside down and centrifuge at 350g for 5min. Wash with PBS.

[0129] The calculation formula of cell adhesion rate V is as follows:

[0130] Cell adhesion rate V: V = number of cells after centrifugation / number of cells before centrifugation × 100%

[0131] The relative cell adhesion P was calculated as follows:

[0132] Relative cell adhesion P: P = average adhesion rate of each replicate well of the experimental group sample / average adhesion rate of each replicate well of the negative control × 100%

[0133] 2. Experimental results:

[0134] The experimental results are shown in Table 3 and Figure 8 to Figure 10 shown.

[0135] 2.1. The results of the adhesion rate test of recombinant type III humanized collagen to L929 cells are shown in Table 3:

[0136] Table 3 Results of adhesion rate and relative adhesion of recombinant humanized type III collagen to L929 cells

[0137]

[0138] 2.2. The results of the adhesion rate and relative cell adhesion of recombinant humanized type III collagen to L929 cells are as follows Figure 8-Figure 9 As shown:

[0139] Figure 8 This is a graph showing the adhesion rate of recombinant humanized type III collagen to L929 cells (NC is a blank control, and the reference product is a bovine type I collagen standard product). Fig. 9 This is a graph showing the relative adhesion of recombinant humanized type III collagen to L929 cells (NC is a blank control, and the reference product is a bovine type I collagen standard product).

[0140] 2.3. The results of cell adhesion of recombinant humanized type III collagen to L929 cells are as follows Fig.10 As shown:

[0141] Fig.10 The figure is the result of cell adhesion of recombinant humanized type III collagen to L929 cells (NC is blank control, reference product is bovine type I collagen standard, PC is 0.1% gelatin).

[0142] From Table 3 and Figure 8-Figure 9 It can be seen that the adhesion rates of the recombinant type III humanized collagen prepared by the present invention to L929 cells at concentrations of 4 mg / mL, 1 mg / mL and 0.25 mg / mL are significantly different from those of the blank group, and the cell adhesion rate of 1 mg / mL recombinant type III humanized collagen is 2.69 times that of the 2 mg / mL bovine type I collagen standard.

[0143] from Fig.10 It can be seen that some L929 cells in the blank control group adhered to the wall and stretched; cells in the 1 mg / mL reference product (bovine type I collagen standard) sample group did not adhere to the wall or stretch; cells in the 4 mg / mL, 1 mg / mL and 0.25 mg / mL recombinant type III humanized collagen sample groups all showed obvious adhesion and stretching.

[0144] The above are only further embodiments of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical solutions and concepts of the present invention within the scope disclosed by the present invention, which belong to the protection scope of the present invention.

Claims

1. A recombinant humanized type III collagen, characterized in that: The recombinant humanized type III collagen consists of tandemly repeated monomers and an amino acid peptide with a tail-spliced ​​amino acid sequence such as that shown in SEQ ID NO:

4. The monomer is formed by sequentially splicing the amino acid peptide shown in SEQ ID NO:1 and the amino acid peptide shown in SEQ ID NO:

2. The number of tandemly repeated monomers is 10.

2. The recombinant humanized type III collagen according to claim 1, characterized in that: The amino acid sequence of the monomer is shown in SEQ ID NO:

3.

3. The recombinant humanized type III collagen according to claim 1 or 2, characterized in that: The amino acid sequence of the recombinant humanized type III collagen is shown in SEQ ID NO:

5.

4. A gene encoding recombinant type III humanized collagen, characterized in that: The nucleotide sequence of the gene encoding the recombinant humanized type III collagen is shown in SEQ ID NO:

6.

5. A recombinant humanized type III collagen recombinant vector, characterized in that: The recombinant vector comprises the gene encoding the recombinant humanized type III collagen according to claim 4.

6. An engineered strain, characterized in that: The engineered strain comprises the gene encoding the recombinant humanized type III collagen according to claim 4 or the recombinant vector of the recombinant humanized type III collagen according to claim 5.

7. Use of the recombinant humanized type III collagen as claimed in claim 1 in the preparation of cosmetics or medical device products.

8. The use according to claim 7, characterized in that The recombinant humanized type III collagen is used in the preparation of anti-aging cosmetics, repair cosmetics or antioxidant cosmetics.

9. The use according to claim 7, characterized in that The recombinant type III humanized collagen is used in the preparation of a collagen dressing capable of promoting cell proliferation, adhesion and migration.

10. A composition, characterized in that The composition comprises the recombinant humanized type III collagen according to any one of claims 1 to 3 and an acceptable excipient.

Images