Genetically engineered bacterium for producing R-2-(4-hydroxyphenoxy) propionic acid at high yield as well as construction method and application of genetically engineered bacterium

Abstract

The invention provides a genetically engineered bacterium for producing R-2-(4-hydroxyphenoxy) propionic acid at high yield as well as a construction method and application of the genetically engineered bacterium. Based on metabolic engineering and efflux transport engineering strategies, transmembrane transport protein coding genes selected from an NPF protein family and an SWEET protein family are constructed into beauveria bassiana capable of producing R-2-(4-hydroxyphenoxy) propionic acid, and genetic engineering bacteria capable of stably and highly producing R-2-(4-hydroxyphenoxy) propionic acid are constructed. Compared with a control strain, an experimental group has the advantages that the yield of R-2-(4-hydroxyphenoxy) propionic acid subjected to liquid fermentation is remarkably increased, and the fermentation period is shortened. The method for constructing the high-yield R-2-(4-hydroxyphenoxy) propionic acid gene engineering strain by transforming the beauveria bassiana on the basis of efflux transport engineering provides an important target for efficiently producing the R-2-(4-hydroxyphenoxy) propionic acid by transforming the beauveria bassiana, and has an industrial application prospect.

Description

Technical Field

[0001] The invention belongs to the field of bioengineering, and specifically relates to a genetic engineering bacterium with high production of R-2-(4-hydroxyphenoxy) propionic acid, a construction method and application thereof. Background Art

[0002] R-2-(4-hydroxyphenoxy) propionic acid is an important intermediate for synthesizing optically pure aryloxyphenoxypropionic acid herbicides. At present, the active ingredients of many herbicides on the market exist in the form of racemates. Among them, aryloxyphenoxypropionic acid herbicides are a typical class of herbicides with racemic structure developed in the past forty years. The main characteristics of this class of herbicides are good weed control effect, long shelf life, non-toxicity to crops and easy degradation in the soil. Excessive use of aryloxyphenoxypropionic acid herbicides will not cause pollution to the environment. It is still one of the best herbicides with weed control performance.

[0003] At present, the methods for obtaining R-2-(4-hydroxyphenoxy) propionic acid at home and abroad mainly adopt chemical synthesis and microbial fermentation methods that have appeared in recent years. Among them, the chemical synthesis method cannot guarantee its safety, has high raw material costs, many steps, long cycles, and produces byproducts that pollute the environment, weak optical activity, and low yield. Microbial fermentation has the advantages of easy acquisition of raw materials, low production costs, and easy expansion of production capacity, and is the development direction of R-2-(4-hydroxyphenoxy) propionic acid industrialization. However, at present, the method for increasing the output of R-2-(4-hydroxyphenoxy) propionic acid is mainly to screen excellent strains and optimize its fermentation conditions, and rarely uses molecular biological methods to improve strains to increase the output of R-2-(4-hydroxyphenoxy) propionic acid. The production of R-2-(4-hydroxyphenoxy)propionic acid by biofilm fermentation of Beauveria bassiana is still in the process optimization stage. A large amount of carbon and nitrogen sources need to be added during the production and fermentation process. In addition, its long fermentation cycle and the inability to perform deep liquid fermentation also make it impossible to apply it to industrial scale-up production, which seriously limits the various applications of R-2-(4-hydroxyphenoxy)propionic acid. Therefore, it is an important research direction for the synthesis and development of R-2-(4-hydroxyphenoxy)propionic acid to genetically modify the original strain by using molecular biology technology to transform its catalytic synthesis product, thereby improving its own catalytic ability and producing R-2-(4-hydroxyphenoxy)propionic acid using a more economical and efficient method. Summary of the invention

[0004] In order to solve the problem of weak biosynthesis and low yield of R-2-(4-hydroxyphenoxy)propionic acid in the prior art by microbial fermentation, the present invention provides a genetically engineered bacterium with high yield of R-2-(4-hydroxyphenoxy)propionic acid and a construction method and application thereof. The construction method is based on an efflux transport engineering strategy, and the Beauveria bassiana is modified to promote the efflux of intracellular products, thereby increasing the flux of the biosynthetic pathway, so as to achieve efficient production of the target metabolite R-2-(4-hydroxyphenoxy)propionic acid.

[0005] The technical solution adopted by the present invention is: a method for constructing a genetically engineered bacterium with high production of R-2-(4-hydroxyphenoxy)propionic acid, comprising: constructing a coding gene of a transmembrane transport protein into Beauveria bassiana that produces R-2-(4-hydroxyphenoxy)propionic acid through genetic engineering technology to obtain a genetically engineered bacterium with high production of R-2-(4-hydroxyphenoxy)propionic acid; wherein the transmembrane transport protein is selected from at least one protein of the NPF protein family and the SWEET protein family.

[0006] Beauveria bassiana is the main producer of R-2-(4-hydroxyphenoxy) propionic acid, but the excessive intracellular product concentration will cause feedback inhibition and produce certain cytotoxicity, reduce the catalytic activity of upstream pathway metabolic enzymes, and then limit the fermentation yield of target metabolites. To solve this problem, the present invention provides another high-yield R-2-(4-hydroxyphenoxy) propionic acid strategy based on transmembrane transporter transport engineering, specifically by strengthening the transmembrane transfer of metabolites in microbial cells, timely reducing the intracellular target metabolite concentration, thereby weakening the feedback inhibition and cytotoxicity caused by it to increase product yield. Specifically, by genetic engineering means, transmembrane transporters from the NPF protein family or the SWEET protein family are constructed into R-2-(4-hydroxyphenoxy) propionic acid production bacteria and expressed, thereby achieving the purpose of increasing the yield of R-2-(4-hydroxyphenoxy) propionic acid, and then promoting the application of R-2-(4-hydroxyphenoxy) propionic acid in the field of pesticides, meeting many aspects of market demand.

[0007] Nucleobase Ascorbate Transporter ProtonSymporter (NPF), a transmembrane transporter protein in Arabidopsis, belongs to the Peptide Transporter (PTR) family and is responsible for mediating the transmembrane transport of nucleotides and ascorbic acid, playing an important regulatory role in cell metabolism, growth and immunity. Sugars Will Eventually be Exported Transporters (SWEET), a transmembrane transporter protein also present in Arabidopsis, is a class of proteins that are widely present in plants and are closely related to the transmembrane transport of sugars, responsible for the transmembrane transport of sugars such as glucose, fructose and sucrose.

[0008] Specifically, the transmembrane transporter is selected from at least one of NPF1.2, NPF2.5, NPF5.5, and NPF8.1, preferably NPF1.2. The amino acid sequence of NPF1.2 is shown in SEQ ID NO.1, the amino acid sequence of NPF2.5 is shown in SEQ ID NO.2, the amino acid sequence of NPF5.5 is shown in SEQ ID NO.3, and the amino acid sequence of NPF8.1 is shown in SEQ ID NO.4.

[0009] Specifically, the transmembrane transporter is selected from at least one of SWEET1 and SWEET5, preferably SWEET5. The amino acid sequence of SWEET1 is shown in SEQ ID NO.5, and the amino acid sequence of SWEET5 is shown in SEQ ID NO.6.

[0010] Specifically, the R-2-(4-hydroxyphenoxy)propionic acid-producing Beauveria bassiana ZJB23323. Beauveria bassiana ZJB23323 has been disclosed in patent CN116590153A, and is deposited in the China Center for Type Culture Collection, with a deposit number of CCTCC NO: M 2023584, a deposit date of April 21, 2023, and an address of Wuhan University, Wuhan, China, 430072.

[0011] Specifically, the method for constructing the genetically engineered bacteria with high production of R-2-(4-hydroxyphenoxy)propionic acid includes: using the LiAc / ssDNA / PEG high-efficiency transformation method to introduce the recombinant vector of the transmembrane transport protein encoding gene into the Beauveria bassiana that produces R-2-(4-hydroxyphenoxy)propionic acid, and screening through CDA culture medium to obtain the genetically engineered bacteria with high production of R-2-(4-hydroxyphenoxy)propionic acid.

[0012] The recombinant vector is constructed by inserting one or more transmembrane transporter encoding genes into an expression vector, and preferably the expression vector is pBARGPE1.

[0013] The CDA culture medium includes: 2g salmon sperm, 2g peg, 2g lithium acetate; add deionized water to 1L, sterilize at 115℃ for 20min, and store at room temperature. 2-3% agar powder should be added to the solid culture medium.

[0014] The present invention also provides a genetically engineered bacterium with high R-2-(4-hydroxyphenoxy)propionic acid production obtained by the method. The Beauveria bassiana transformants obtained by the method are subjected to bacterial liquid PCR, and after sequencing verification, successfully transformed Beauveria bassiana engineered bacteria BbZJB23323-NPF* and BbZJB23323-SWEET* are obtained.

[0015] The present invention also provides the use of the genetically engineered bacteria in the fermentation preparation of R-2-(4-hydroxyphenoxy) propionic acid. The genetically engineered bacteria are subjected to liquid fermentation and sampling, and the content of R-2-(4-hydroxyphenoxy) propionic acid in the fermentation broth is detected by HPLC. After multiple subcultures and liquid fermentation verification, a recombinant strain of Beauveria bassiana with high yield of R-2-(4-hydroxyphenoxy) propionic acid and stable inheritance is finally obtained.

[0016] Specifically, the application includes: inoculating the genetically engineered bacteria into a fermentation medium, culturing at 200-300 rpm and 25-30° C. for 6-12 days, and then collecting the bacterial liquid to obtain R-2-(4-hydroxyphenoxy) propionic acid.

[0017] Specifically, the fermentation medium comprises: 30-50 g / L of R-2-phenoxypropionic acid, 20-40 g / L of glucose, 5-10 g / L of yeast extract, 0.5-1 g / L of MgSO4, 0.5-1 g / L of CaCl2, 1-2 g / L of K2HPO4, 0.5-1 g / L of KH2PO4, 30-50 mL / L of trace element solution, the solvent is water, pH 6-7; the trace element solution comprises: 1-2 g / L of EDTA-2Na·2H2O, 0.5-1 g / L of FeSO4, 0.5-1 g / L of K2HPO4, 0.5-1 g / L of KH2PO4, 0.5-1 g / L of trace element solution. 4· 7H2O 0.5~0.6g / L, ZnSO4·7H2O 0.1~0.2g / L, MnSO4·H2O 0.1~0.2g / L, NiC12·6H2O0.01~0.04g / L, CoC120.01~0.02g / L, H3BO30.01~0.03g / L, Na2MoO4 H2O0.001~0.01g / L, the solvent is water, pH 6~8.

[0018] Beneficial effects of the present invention: Based on metabolic engineering and efflux transport engineering strategies, the present invention constructs a genetically engineered bacterium capable of stably and highly producing R-2-(4-hydroxyphenoxy) propionic acid. Compared with the control strain, the experimental group has significantly increased the yield of R-2-(4-hydroxyphenoxy) propionic acid through liquid fermentation. At the 216th hour of fermentation, the fermentation yields of R-2-(4-hydroxyphenoxy) propionic acid of BbZJB23323-NPF1.2 and BbZJB23323-SWEET5 increased by 46.64% and 45.23% respectively compared with the control group, and the fermentation cycle was shortened. The construction method based on efflux transport engineering proposed by the present invention provides an important target for efficiently producing R-2-(4-hydroxyphenoxy) propionic acid by genetically engineering Beauveria bassiana, and has prospects for industrial application. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the plasmid map of the expression vector pUC19-NPF of Example 1 of the present invention.

[0020] Figure 2 This is the plasmid map of the expression vector pUC19-SWEET in Example 1 of the present invention.

[0021] Figure 3 This is the gel image for verifying the NPF1.2 and SWEET5 fragments in Example 1 of the present invention.

[0022] Figure 4 This is a line graph of the production of R-2-(4-hydroxyphenoxy)propionic acid by fermentation of strains BbZJB23323-NPF1.2 and IBbZJB23323-SWEET5 in Example 2 of the present invention. DETAILED DESCRIPTION

[0023] The following is an explanation of the embodiments of the present invention by specific specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied by other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, in the absence of conflict, the features in the following embodiments and embodiments can be combined with each other. In the embodiments of the present invention, the methods used are all conventional methods unless otherwise specified, and the reagents used can be obtained from commercial sources.

[0024] Example 1: Construction of genetically engineered bacteria containing transmembrane transporter encoding genes

[0025] The following examples use strain BeauveriabassianaZJB23323 as the base strain (this strain has been disclosed in patent CN116590153A), and subsequent steps are carried out on this basis.

[0026] In order to verify the biological function of transmembrane transporters, plasmid pUC-fFuCas9-HTB was obtained from the laboratory. NLS -hph-NPF1.2, pUC-fFuCas9-HTB NLS -hph-SWEET5 was subjected to PCR using the primers shown in Table 1 to obtain the corresponding fragments of the target transmembrane transporter NPF1.2 and SWEET5 ( Figure 3 ). Then, the transmembrane transporter encoding gene was connected to the linearized plasmid pUC19 by one-step cloning, and the recombinant plasmids pUC19-NPF1.2 and pUC19-SWEET5 containing the transmembrane transporter encoding gene were obtained by colony PCR verification and screening. The recombinant plasmids include DNA elements such as the target transporter, the lactose operon element and the ampicillin resistance screening tag ( Figure 1 The constructed recombinant plasmids were transformed into Beauveria bassiana ZJB23323 to obtain genetically engineered bacteria BbZJB23323-NPF1.2 and IBbZJB23323-SWEET5 that produce high R-2-(4-hydroxyphenoxy)propionic acid.

[0027] Among them, plasmid pUC-fFuCas9-HTB NLS The construction process of -hph-NPF1.2 is as follows: take tissue samples such as roots, stems, young leaves, and flower buds of fresh Arabidopsis plants, immediately freeze them in liquid nitrogen, grind the tissues thoroughly with a pestle, extract total RNA from the treated tissues according to the instructions of the Novagen RC101-01 kit, determine the concentration of the extracted RNA, and perform a reverse transcription experiment on the RNA sample according to the instructions of the Novagen R223-01 kit. Run a nucleic acid gel to verify the reverse transcription product, and the cDNA fragment of the target transport protein NPF1.2 can be obtained ( Figure 2 ), the reverse transcription sample can be frozen at -80℃ for long-term storage. Amplify the cDNA fragment of NPF1.2 to obtain the gene fragment of NPF1.2. Design primers to vector pUC-fFuCas9-HTB NLS -hph linearization. One-step cloning: Connect the previously obtained NPF1.2 gene fragment to the linearized vector to obtain the expression plasmid pUC-fFuCas9-HTB NLS -hph-NPF1.2. The construction method of plasmid pUC-fFuCas9-HTBNLS-hph--SWEET5 is the same as above.

[0028] The PCR reaction system was 50uL in total: 2uL template, 25uL 2×Phanta Mix Buffer, 2uL upstream and downstream primers, 2uL dNTP Mix luL, Phanta Mix Super-Fidelity luL, and 50uL ddH2O (PCR reagents were purchased from Novozyme Biotech Co., Ltd.). The PCR reaction conditions were: 95°C for 10min, (95°C for 30s, 60°C for 30s, 72°C for 1min, 30 cycles) and 72°C for 10min extension.

[0029] Table 1. Primer list

[0030] Primers sequence NPF1.2-F AGAAGGAGATATACCATGGAGAACCCTCCCAATGAAAC NPF1.2-R GTGGTGGTGGGTGGTGATTGGTAACAACTGGACTTA SWEET5-F AGAAGGAGATATACCATGACCGACCCTCACACCGCTC SWEET5-R GTGGTGGTGGTGGTGAGCCTGACCGAGCTCGATGC pUC19-F TGAGATCCGGCTGCTAACAAAGC pUC19-R CATGGTATATCTCCTTCTTAAAGTTAAACAAAA

[0031] Preparation of blastospore competent cells: Fungal conidia were inoculated in PDB medium and shaken at 200rpm for 3 days at 28°C. The formed blastospores were collected by filtration through four layers of lens paper and concentrated by centrifugation at 3000rpm for 5min at 40°C. The harvested spores were washed twice with sterile ddH,0 by centrifugation at 3000rpm for 5min at 4°C, and then suspended in 0.1M LiAc (1:50). The blastospore suspension was transferred to a 1.5mL Eppendorf tube, precipitated by centrifugation at 7000rpm for 5min at 4°C, and then resuspended in 0.1M LiAc (1:50) with a final concentration of 3×10° cells / ml, and immediately frozen (liquid nitrogen) in 100uL aliquots and stored at -80°C. The PDB medium concentration composition is: potato extract powder 6g / L, glucose 20g / L, and the solvent is water.

[0032] For transformation, all operations were performed at 4°C using ice-cold solutions. Frozen fungal conidia competent cells were thawed on ice and harvested by centrifugation at 7000 rpm for 5 min. The following reagents were added in the following order: 240uL 50% PEG 4000, 35uL 1M LiAc, 50uL 2g / L denatured genomic salmon sperm DNA fragments, and 20ug of expression plasmid.

[0033] The preparation method of competent Escherichia coli BL21 is as follows: put the strain stored at -80℃ on ice, wait for it to melt, dip a small amount of bacteria, make three-zone lines on a non-antibiotic plate, and culture it at 37℃ overnight; select a single colony with correct morphology and inoculate it into a 10mL LB test tube, and culture it at 37℃, 200rpm for 12h; take 200uL of the bacterial solution in the test tube and inoculate it into a 50mL LB shake flask medium, and culture it at 37℃, 200rpm until OD=0.4-0.6; take out the shake flask and place it on ice for precooling for 1 5-30min, 4℃, 4500Xg centrifugation for 5min, collect the bacteria; discard the supernatant, add an appropriate amount of pre-cooled 0.1M CaCl2 solution, resuspend the cells on ice, let stand in an ice bath for 30min, 4℃, 4500Xg centrifugation for 6min to collect the bacteria, add 1-2mL pre-cooled 0.1M CaCl2 and 15% glycerol mixed solution, resuspend the cells on ice; dispense 100uL of the suspended competent cells into sterilized and pre-cooled EP tubes, and store them in a -80℃ refrigerator for short-term use.

[0034] Example 2: Application of genetically engineered bacteria in liquid fermentation to produce R-2-(4-hydroxyphenoxy)propionic acid

[0035] With Beauveria bassiana ZJB23323 as the control group, liquid fermentation of Beauveria bassiana engineered bacteria BbZJB23323-NPF1.2 and IBbZJB23323-SWEET5 was carried out. The engineered bacteria BbZJB23323-NPF1.2 and IBbZJB23323-SWEET5 of Beauveria bassiana were cultured on hard agar medium for 5 days, and then the transformants were picked into seed medium with a toothpick for culture. After 3 days of culture at 250rpm, they were transferred to fermentation medium with an inoculation amount of 10%. After 9 days of conditional culture at 28°C and 250rpm, the bacterial liquid was collected, diluted, and the yield of R-2-(4-hydroxyphenoxy)propionic acid was determined by high performance liquid chromatography. The results are shown in Figure 4 .

[0036] The culture media used in the experiment include:

[0037] Seed culture medium (1L): R-2-phenoxypropionic acid 50g / L, glucose 40g / L, yeast extract 10g / L, MgSO4, 1g / L, CaC121g / L, K2HPO2g / L, KH2PO 1g / L, trace element solution 50mL / L, solvent is water, pH 7; the trace element solution includes the following components: EDTA-2Na·2H2O 2g / L, FeS04 7H2O 0.6g / L, ZnSO4·7H2O0.2g / L, MnSO4·H20.2g / L, NiC12 6H2O 0.04g / L, CoC120.02g / L, H3BO30.03g / L, Na2MoO4-H2O0.01g / L, solvent is water, pH 8.

[0038] Fermentation medium: R-2-phenoxypropionic acid 50g / L, glucose 40g / L, yeast extract 10g / L, MgSO41g / L, CaC121g / L, K2HPO2g / L, KH2PO 1g / L, trace element solution 50mL / L, solvent is water, pH 7; the trace element solution comprises the following components: EDTA-2Na·2H2O 2g / L, FeS04 7H2O 0.6g / L, ZnSO4·7H2O 0.2g / L, MnSO4·H20.2g / L, NiC12 6H2O 0.04g / L, CoC120.02g / L, H3BO30.03g / L, Na2MoO4-H2O0.01g / L, agar 2g / L, pH 8, solvent is water.

[0039] The content of R-2-(4-hydroxyphenoxy)propionic acid in the fermentation broth was detected by high performance liquid chromatography. The high performance liquid chromatography conditions are as follows: a phosphoric acid solution with a pH of 2.0 is prepared with ultrapure water and mixed with chromatographic grade acetonitrile in a ratio of 6:4 (V:V). The prepared mobile phase is filtered with a 0.22μm organic filter membrane and ultrasonically degassed before use. The chromatographic column is an Elite C18 column Hypersil ODS 25μm (4.6mm×250mm); the mobile phase is a phosphoric acid aqueous solution (pH=2): acetonitrile=6:4 (V:V); the flow rate is 1mL / min; the detector is DAD; the detection wavelength is 220nm; the injection volume is 5μL; the column temperature is 30℃. Sample processing and detection: 1.0mL of fermentation broth is taken and centrifuged at 12000rpm for 8min. The supernatant is appropriately diluted with ultrapure water, filtered through a 0.22μm microporous filter membrane, and detected by the above method.

[0040] The invention constructs a genetic engineering bacterium capable of stably and highly producing R-2-(4-hydroxyphenoxy) propionic acid based on metabolic engineering and efflux transport engineering strategies. Compared with the control strain, the experimental group has significantly increased the yield of R-2-(4-hydroxyphenoxy) propionic acid through liquid fermentation. The fermentation yield of R-2-(4-hydroxyphenoxy) propionic acid of BbZJB23323-NPF1.2 and BbZJB23323-SWEET5 at 216h of fermentation is increased by 46.64% and 45.23% respectively compared with the control group. It provides an important target for efficiently producing R-2-(4-hydroxyphenoxy) propionic acid based on genetic engineering modification of Beauveria bassiana, and has industrial application prospects.

[0041] The embodiments described above are merely descriptions of preferred implementations of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope of the present invention.

Claims

1. A method for constructing a genetically engineered bacterium that produces high yield of R-2-(4-hydroxyphenoxy)propionic acid, characterized in that: include: The coding gene of the transmembrane transporter is constructed into Beauveria bassiana producing R-2-(4-hydroxyphenoxy)propionic acid by genetic engineering technology to obtain a genetically engineered bacterium with high production of R-2-(4-hydroxyphenoxy)propionic acid; Wherein, the transmembrane transporter is selected from at least one protein in the NPF protein family and the SWEET protein family.

2. The method according to claim 1, characterized in that The transmembrane transporter is selected from at least one of NPF1.2, NPF2.5, NPF5.5, and NPF8.

1.

3. The method according to claim 1, characterized in that The transmembrane transporter is selected from at least one of SWEET1 and SWEET5.

4. The method according to claim 1, characterized in that The Beauveria bassiana producing R-2-(4-hydroxyphenoxy)propionic acid is Beauveria bassiana ZJB23323.

5. The method according to claim 1, characterized in that include: The recombinant vector overexpressing the transmembrane transport protein encoding gene was introduced into the Beauveria bassiana producing R-2-(4-hydroxyphenoxy)propionic acid by using the LiAc / ssDNA / PEG efficient transformation method, and the genetically engineered bacteria with high production of R-2-(4-hydroxyphenoxy)propionic acid were obtained by screening with CDA culture medium.

6. A genetically engineered bacterium with high production of R-2-(4-hydroxyphenoxy)propionic acid obtained by the method according to any one of claims 1 to 5.

7. Use of the genetically engineered bacteria as claimed in claim 6 in the fermentation preparation of R-2-(4-hydroxyphenoxy)propionic acid.

8. The use according to claim 7, characterized in that include: The genetically engineered bacteria are inoculated into a fermentation medium, cultured at 200-300 rpm and 25-30° C. for 6-12 days, and then the bacterial liquid is collected to obtain R-2-(4-hydroxyphenoxy) propionic acid.

9. The use according to claim 8, characterized in that The fermentation medium comprises: 30-50 g / L of R-2-phenoxy propionic acid, 20-40 g / L of glucose, 5-10 g / L of yeast extract, 0.5-1 g / L of MgSO4, 0.5-1 g / L of CaCl2, 1-2 g / L of K2HPO4, 0.5-1 g / L of KH2PO4, and 30-50 mL / L of trace element solution, wherein the solvent is water and the pH value is 6-7; the trace element solution comprises: 1-2 g / L of EDTA-2Na·2H2O, 1-2 g / L of FeSO4, and 0.5-1 g / L of KH2PO4. 4· 7H2O 0.5~0.6g / L, ZnSO4·7H2O 0.1~0.2g / L, MnSO4·H2O 0.1~0.2g / L, NiC12·6H2O0.01~0.04g / L, CoC120.01~0.02g / L, H3BO30.01~0.03g / L, Na2MoO4H2O 0.001~0.01g / L, the solvent is water, pH 6~8.

Images