Self-replicating mRNA vaccine as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of mRNA vaccines, and particularly relates to a self-replicating mRNA vaccine as well as a preparation method and application thereof. The self-replicating mRNA is transcribed from an alphavirus skeleton vector, the alphavirus skeleton vector comprises gene sequences of alphavirus non-structural proteins nsP2, nsP3 and nsP4 and mutated nsP1, and cysteine at the 492nd position of the mutated nsP1 is mutated into serine. The self-replicating mRNA provided by the invention has higher expression quantity and longer expression time for the target gene. The self-replicating mRNA is used for expressing IMP3 and can be prepared into a vaccine with good prevention and treatment effects on IMP3 positive tumors. Therefore, the invention has a good application prospect in the development of medicines and vaccines.

Description

Technical Field

[0001] The present invention belongs to the technical field of mRNA vaccines, and specifically relates to a self-replicating mRNA vaccine and a preparation method and use thereof. Background Art

[0002] At present, a variety of mRNA vaccine platforms have been established at home and abroad, including non-replicating (nr) mRNA and self-replicating (sa) mRNA. Among them, samRNA vaccines use sequences derived from alpha viruses, which are used to encode additional proteins required for mRNA molecule replication, thereby prolonging the expression time of proteins.

[0003] samRNA is a type of mRNA that can use its own RNA sequence as a template for self-replication. Compared with linear non-replicating mRNA, samRNA has a cap structure at the 5' end, a polyA tail at the 3' end, a 5' untranslated region (5'-UTR) and a 3' untranslated region (3'-UTR), and also introduces self-replicating elements upstream or downstream of the target gene. The main components of these self-replicating elements include RNA-dependent RNA polymerases derived from viruses, functional proteins related to viral RNA replication, and subgenomic promoters located upstream of the target gene.

[0004] Its working mechanism imitates the replication characteristics of positive-sense single-stranded RNA viruses. By replacing the structural genes of the virus with the antigen gene of interest (GOI), after being delivered to the cytoplasm of the target cell, it can significantly prolong the time of antigen expression, increase the expression amount of antigen, and increase the effectiveness of the related immune response.

[0005] At present, the self-replicating elements used to prepare self-replicating mRNA are mostly derived from alphaviruses, including Sindbisvirus (SIN), Semliki Forest virus (SFV) and Venezuelan equine encephalitis virus (VEEV). Some studies have also used the Kunjin virus genome elements of the Flavivirus genus as self-replicating elements of self-replicating mRNA. However, these unmodified viral genome elements have varying degrees of cytotoxicity when transfected into cultured cells in vitro, and can induce natural immune responses in vivo, resulting in reduced expression of target gene mRNA, thereby affecting the efficacy of vaccine and drug treatment. Therefore, it is urgent to find a self-replicating element that can easily increase the expression of target gene mRNA in vivo.

[0006] The IMP3 gene, or insulin-like growth factor II mRNA-binding protein 3, is a messenger RNA binding protein that belongs to the IGF2BP family, whose members include IMP1, IMP2, and IMP3. As an oncofetal protein, IMP3 is expressed at a low level in normal adults, but shows significantly high expression during embryonic development and a variety of malignant tumors. Its positive expression may be associated with a variety of cancers, such as prostate cancer, bladder cancer, and breast cancer. Therefore, the IMP3 gene not only has potential value in the early diagnosis, prognosis assessment, and therapeutic targets of tumors, but is also a potential oncofetal antigen that can be developed into a tumor vaccine.

[0007] At present, there are no reports on the use of IMP3-expressing mRNA to make samRNA tumor vaccines. How to design the sequence of samRNA so that samRNA is expressed efficiently and persistently will be a key issue in the development of samRNA tumor vaccines expressing IMP3. Summary of the invention

[0008] In view of the problems of the prior art, the present invention provides a self-replicating mRNA vaccine and a preparation method and use thereof.

[0009] A self-replicating mRNA is transcribed from an alphavirus backbone vector, wherein the alphavirus backbone vector comprises the gene sequences of alphavirus non-structural proteins nsP2, nsP3, nsP4 and a mutant nsP1, wherein the 492nd cysteine ​​of the mutant nsP1 is mutated to serine.

[0010] Preferably, the gene sequence of the mutated nsP1 is as shown in SEQ ID NO.6.

[0011] Preferably, the alphavirus backbone vector further comprises a gene sequence of an immunogen, the immunogen is selected from IMP3, and the gene sequence of the immunogen is shown in SEQ ID NO.1.

[0012] Preferably, the alphavirus backbone vector comprises a promoter, a 5'UTR, a mutated gene sequence of nsP1, a gene sequence of nsP2, a gene sequence of nsp3, a gene sequence of nsp4, a gene sequence of an immunogen, a 3'UTR and a PolyA tail.

[0013] Preferably, the gene sequence of the nsP2 is as described in SEQ ID NO.3, the gene sequence of the nsP3 is as described in SEQ ID NO.4, and the gene sequence of the nsP4 is as described in SEQ ID NO.5;

[0014] The nucleotide sequence of the promoter is as described in SEQ ID NO.7, the nucleotide sequence of the 5'UTR is as described in SEQ ID NO.8, the nucleotide sequence of the 3'UTR is as described in SEQ ID NO.10, and the nucleotide sequence of the PolyA tail is as described in SEQ ID NO.11.

[0015] Preferably, the nucleotide sequence of the alphavirus backbone vector is shown as SEQ ID NO.12.

[0016] The present invention also provides a method for preparing the self-replicating mRNA, comprising the following steps:

[0017] Step 1, digesting the plasmid containing the DNA sequence shown in SEQ ID NO. 12 to obtain a linearized template, and purifying it;

[0018] Step 2, in vitro transcription and purification of the purified linearized template to obtain purified RNA;

[0019] Step 3, capping and purifying the purified RNA obtained in step 2 to obtain self-replicating mRNA.

[0020] The present invention also provides use of the self-replicating mRNA vaccine in preparing an immunogenic composition.

[0021] Preferably, the immunogenic composition is used for preventing and / or treating tumors.

[0022] The present invention also provides an immunogenic composition, which is prepared by using the self-replicating mRNA as an active ingredient and adding pharmaceutically acceptable excipients.

[0023] In order to construct a samRNA that efficiently and durably expresses an immunogen, the present invention mutates nsP1 in an alphavirus backbone vector, and the mutated alphavirus backbone vector has a higher target gene expression amount and a more durable expression time for a target gene (e.g., tumor antigen IMP3, luciferase Luc). Therefore, the samRNA constructed by the present invention can also more effectively exert the target gene. For example, the samRNA expressing IMP3 constructed by the present invention has a better preventive and therapeutic effect on tumors with positive IMP3 expression. Therefore, the present invention has a good application prospect in the development of drugs and vaccines.

[0024] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0025] The following is a further detailed description of the above contents of the present invention through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies implemented based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Detect Luc expression in mice for in vivo imaging;

[0027] Figure 2 To express nsP1 C492A -IMP3-samRNA vector map;

[0028] Figure 3 For the present invention nsP1 C492A -IMP3-samRNA expresses IMP3 protein level detection in cells;

[0029] Figure 4 For the present invention nsP1 C492A -Detection of tumor volume changes after IMP3-samRNA vaccine injection. DETAILED DESCRIPTION

[0030] In the following examples and experimental examples, reagents and raw materials not specifically described are all commercially available products.

[0031] Example 1: samRNA expressing luciferase Luc

[0032] In this example, the luciferase (Luc) gene fragment was cloned into the mutant alphavirus backbone plasmid to produce nsP1 C492A -Luc-samRNA recombinant plasmid. Then transcribe to obtain samRNA expressing luciferase Luc.

[0033] Specifically, the construction process of the recombinant plasmid is as follows:

[0034] The gene sequences encoding the mutated non-structural proteins nsP1, nsP2, nsP3 and nsP4 of the alphavirus are SEQ ID NO.6, SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5 respectively, and the viral gene replication complex is synthesized based on the above sequences. Among them, the mutation of nsP1 is that the cysteine ​​at position 492 of the nsP1 domain is mutated to serine (C492A).

[0035] Constructed nsP1 C492A -Luc-samRNA recombinant plasmid structure contains T7 promoter (SEQ ID NO: 7), 5'UTR (SEQ ID NO: 8), nsP1 C492A(SEQ ID NO: 6), nsP2 (SEQ ID NO: 3), nsp3 (SEQ ID NO: 4), nsp4 (SEQ ID NO: 5), Luc gene (SEQ ID NO: 9), 3'UTR (SEQ ID NO: 10) and PolyA tail (SEQ ID NO: 11), and finally gene synthesis was performed and cloned into the PUC57-kan vector.

[0036] Take the constructed plasmid and 50 μL of Escherichia coli competent cells DH5α (purchased from Qing Technology Co., Ltd.), mix them together and place them on ice for 30 minutes, heat shock them at 42°C for 90 seconds, put them back on ice immediately, place them on ice for 2 minutes, and then incubate them at 37°C for 1 hour.

[0037] Add 400 μL LB medium and culture at 30°C with slow shaking for 45 to 60 min.

[0038] Take 50-100 μL of bacterial solution and apply it on LB solid culture medium containing kanamycin antibiotic (100 μg / mL, purchased from Yisheng Biotechnology Co., Ltd.), and culture it upside down at 37°C overnight.

[0039] The obtained monoclonal colony plate was sequenced to verify its correctness, and the monoclonal colony with correct sequencing was picked and cultured in a shaker at 30°C with slow shaking overnight.

[0040] Plasmids were extracted using an endotoxin-free plasmid extraction kit (purchased from Tiangen Biochemical Technology Co., Ltd.).

[0041] The extracted plasmid is cut into a linearized plasmid using a restriction endonuclease and used as a transcription template.

[0042] The specific enzyme digestion process steps for preparing samRNA by in vitro transcription are as follows:

[0043] 1. Preparation of linearized template

[0044] Take 1 mg of the above nsP1 C492A -Luc-samRNA recombinant plasmid, 37°C, 4h enzyme digestion system (MluI enzyme, purchased from Yisheng Biotechnology Co., Ltd.) to form a linearized DNA transcription template (enzyme digestion system see Table 1);

[0045] Table 1 Components of the enzyme digestion system for generating linearized DNA templates

[0046]

[0047] Incubate at 50℃ for 2-3h.

[0048] 2. In vitro transcription

[0049] For the linearized template DNA sequence, oscillate and mix the components except T7 RNA Polymerase Mix, centrifuge briefly to collect at the bottom of the tube, store on ice for later use, and prepare the system according to the following table. Among them, Template is the purified linearized template.

[0050] Use T7 RNA polymerase to generate mRNA on the linearized plasmid (see Table 2 for transcription system of template DNA).

[0051] . Add 1 μL RNase inhibitor (purchased from Nanjing Novozyme Biotechnology Co., Ltd.) to 20 μL system.

[0052] The components were gently mixed with a pipette, collected by brief centrifugation, and incubated at 37°C for 3 h.

[0053] Add 1 μL DNaseI to the reaction system and incubate at 37°C for 15 min to digest the transcribed DNA template.

[0054] Conventional purification methods were used, such as lithium chloride precipitation method, to purify the corresponding mRNA.

[0055] Table 2 Composition of transcription system for linearized DNA template

[0056]

[0057] 3. mRNA capping and purification

[0058] mRNA was capped with 2′-O-methyltransferase using an m7G capping kit to obtain the cap1 mRNA final product. All mRNAs were analyzed by agarose gel electrophoresis and stored frozen at -20°C.

[0059] 4. Synthetic cationic liposomes (LNP)

[0060] The ratio used in the preparation of LNP of the present invention is as follows:

[0061] The four lipid components were dissolved in ethanol, and the liposome nanoparticles were prepared according to the prior art formula, using cationic lipids (including but not limited to SM-102, preferably SM-102 in this embodiment): auxiliary lipids (DSPC): cholesterol: PEG lipids (DMG-PEG 2000) = 50:10:38.5:1.5 (molar ratio) to mix to obtain a lipid mixture.

[0062] 5. Preparation of samRNA vaccine

[0063] Microfluidic mixing method: 3 mL of the above-synthesized mRNA buffer solution and 1 mL of the lipid mixture solution were mixed on a microfluidic device at a total flow rate of 12 mL / min (usually using a 1:3 ratio of organic phase to aqueous phase buffer) to obtain LNP. After mixing, the LNP was immersed in PBS (pH 7.4) and dialyzed for 2 hours, then sterile filtered using a 0.2 micron filter, concentrated to obtain a samRNA vaccine, and stored at 4°C. For subsequent application research. The product of this example is recorded as nsP1 C492A -Luc-samRNA.

[0064] Example 2 Expression of IMP3 samRNA

[0065] The construction of samRNA in this example is the same as that in Example 1, except that the Luc gene is replaced with a gene expressing IMP3 (SEQ ID NO.1), such as Figure 2 The product of this example is denoted as nsP1 C492A -IMP3-samRNA.

[0066] Comparative Example

[0067] Comparative Examples SamRNA expressing luciferase Luc was prepared according to the method of Example 1 or SamRNA expressing IMP3 was prepared according to the method of Example 2. The difference is that in the recombinant plasmid used, nsP1 was not mutated, and the nucleotide sequence of the unmutated nsP1 gene is as described in SEQ ID NO.2.

[0068] The samRNA expressing luciferase Luc prepared in this comparative example is named nsP1 wt -Luc-samRNA;

[0069] The samRNA expressing IMP3 prepared in this comparative example is named nsP1 wt -IMP3-samRNA.

[0070] The following is the nucleotide sequence involved in the present invention:

[0071] Gene sequence of IMP3 (SEQ ID NO.1):

[0072]

[0073] Gene sequence of nsP1 (SEQ ID NO.2):

[0074]

[0075] Gene sequence of nsP2 (SEQ ID NO.3):

[0076]

[0077] Gene sequence of nsP3 (SEQ ID NO.4):

[0078]

[0079] Gene sequence of nsP3 (SEQ ID NO.5):

[0080]

[0081] Gene sequence of nsP1 after point mutation (SEQ ID NO.6):

[0082]

[0083] T7 promoter (SEQ ID NO: 7):

[0084] TAATACGACTCACTATAGGG;

[0085] 5’UTR (SEQ ID NO: 8)

[0086] ATGGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCCAAA; Luciferase gene (SEQ ID NO. 9):

[0087] GCCACCATGGAAGATGCCAAGAACATCAAGAAAGGCCCTGCCCCCTTCTACCCCCTGGAAGATGGCACAGCCGGCGAGCAGCTGCACAAGGCCATGAAGAGATACGCCCTCGTCCCTGGAACAATCGCCTTCACCGACGCCCACATCGAGGTGGACATCACCTACGCCGAGTACTTCGAGATGAGCGTG

[0088] CGGCTGGCCGAGGCCATGAAACGCTACGGCCTGAACACCAACCACCG

[0089] GATCGTGGTGTGCAGCGAGAACAGCCTGCAGTTCTTCATGCCCGTGCT

[0090] GGGCGCCCTGTTCATCGGCGTGGCCGTGGCCCCTGCCAACGACATCTA

[0091] CAACGAGCGGGAGCTGCTGAACAGCATGGGCATCAGCCAGCCCACCGT

[0092] GGTGTTCGTGAGCAAGAAGGGCCTGCAGAAAATCCTGAACGTGCAGA

[0093] AGAAGCTGCCCATCATCCAGAAAATCATCATCATGGACAGCAAGACCG

[0094] ACTACCAGGGCTTCCAGAGCATGTACACCTTCGTGACCAGCCACCTGC

[0095] CCCCTGGCTTCAACGAGTACGACTTCGTGCCCGAGAGCTTCGACAGGG

[0096] ACAAGACCATCGCCCTGATCATGAACAGCAGCGGCAGCACCGGCCTGC

[0097] CTAAAGGCGTGGCCCTGCCTCACCGGACCGCCTGCGTGCGGTTCAGCC

[0098] ACGCCCGGGACCCCATCTTCGGCAACCAGATCATCCCCGACACCGCCA

[0099] TCCTGAGCGTGGTGCCCTTCCACCACGGCTTCGGCATGTTCACCACCCT

[0100] GGGCTACCTGATCTGCGGCTTCCGGGTGGTGCTGATGTACCGGTTCGAG

[0101] GAAGAGCTGTTCCTGCGGAGCCTGCAGGACTACAAGATCCAGAGCGCC

[0102] CTGCTGGTGCCCACCCTGTTCAGCTTTTTCGCCAAGAGCACCCTGATCG

[0103] ACAAGTACGACCTGAGCAACCTGCACGAGATCGCCAGCGGCGGAGCC

[0104] CCCCTGAGCAAAGAAGTGGGCGAAGCCGTCGCCAAGCGGTTCCACCT

[0105] GCCCGGCATCCGGCAGGGCTATGGCCTGACCGAGACCACAAGCGCCAT

[0106] TCTGATCACCCCCGAGGGCGACGACAAGCCTGGCGCCGTGGGCAAGGT

[0107] GGTGCCTTTCTTCGAGGCCAAGGTGGTGGACCTGGACACCGGCAAGAC

[0108] CCTGGGCGTGAACCAGCGGGGCGAGCTGTGCGTGAGGGGCCCCATGAT

[0109] CATGAGCGGCTACGTGAACAACCCCGAGGCCACCAACGCCCTGATTGA

[0110] CAAGGACGGCTGGCTGCACAGCGGCGACATCGCCTACTGGGACGAGG

[0111] ACGAGCACTTCTTCATCGTGGACCGGCTGAAGAGCCTGATCAAGTACA

[0112] AGGGCTACCAGGTGGCCCCAGCCGAGCTGGAAAGCATCCTGCTGCAGC

[0113] ACCCCAACATCTTCGACGCCGGGGTGGCCGGCCTGCCCGACGATGACG

[0114] CCGGCGAGCTGCCTGCCGCCGTGGTGGTCCTCGAACATGGCAAAACCA

[0115] TGACCGAGAAAGAAATCGTGGACTACGTGGCCAGCCAGGTGACCACC

[0116] GCCAAGAAGCTGAGAGGCGGCGTCGTGTTTGTGGACGAGGTGCCCAA

[0117] GGGCCTGACCGGCAAGCTGGACGCCCGGAAGATCCGGGAGATCCTGAT

[0118] TAAGGCCAAGAAGGGCGGCAAGATCGCCGTGGGCTCCGGCTGA;

[0119] 3’UTR (SEQ ID NO: 10):

[0120] AAAATTTTTATTTTATTTTTTCTTTTCTTTTCCGAATCGGATTTTGTTT TTAATATTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA;

[0121] PolyA tail (SEQ ID NO: 11):

[0122] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA;

[0123] nsP1 C492A -Luc-samRNA full sequence (SEQ ID NO: 12):

[0124]

[0125] The technical solution of the present invention is further described by experiments. In the following experiments, the samples used are nsP1 prepared according to Example 1, Example 2 and Comparative Example. C492A -Luc-samRNA, nsP1 wt -Luc-samRNA, nsP1 wt -IMP3-samRNA and nsP1 wt -IMP3-samRNA.

[0126] Experimental Example 1nsP1 C492A -Luc-samRNA and nsP1 wt -Comparison of Luc-samRNA expression level and duration

[0127] The experimental groups of this experiment were divided into the non-mutated samRNA vaccine group (nsP1 wt -Luc-samRNA and mutant alphavirus vector samRNA vaccine group (nsP1 C492A -Luc-samRNA).

[0128] Female BALB / C mice (n=5) were intravenously injected with 5 μg nsP1 C492A -Luc-samRNA or nsP1 wt -Luc-samRNA, Luc expression was detected by mouse in vitro imaging (PerkinElmerIVIS Lumina III). 200 μL of luciferin (30 mg / mL) dissolved in PBS was injected intraperitoneally 10 minutes before the measurement, and the changes of Luc in mice were observed at 5, 7, 9, 11, 13, 15, and 20 days after injection. The results are shown in Figure 1 .

[0129] nsP1 was observed by in vivo imaging system (IVIS) C492A -Enhancement of transgene expression levels and duration of Luc-samRNA vaccines. nsP1 C492A The expression level of Luc in the -Luc-samRNA group reached its peak on the 5th day. wt -Luc-samRNA group Luc expression also reached a peak on the 5th day, but its expression decreased significantly faster than nsP1 C492A -Luc-samRNA group. In addition, the Luc expression level on day 7 was significantly lower than that of nsP1 C492A -Luc-samRNA group. Figure 1 It was shown that nsP1 C492A-Luc-samRNA vaccine has higher Luc expression than nsP1 wt -Luc-samRNA vaccine expression was about two times higher.

[0130] The above experimental results show that the nsP1 provided by the present invention C492A -Luc-samRNA compared to nsP1 made from unmutated nsP1 wt -Luc-samRNA has a higher expression level.

[0131] Experimental Example 2nsP1 C492A -IMP3-samRNA in vitro immunogenicity test

[0132] The experimental groups of this experiment were divided into the non-mutated samRNA vaccine group (nsP1 wt -IMP3-samRNA and mutant alphavirus vector samRNA vaccine group (nsP1 C492A -IMP3-samRNA).

[0133] In advance, 12 mL of complete culture medium was used, which was DMEM (PM150210) + 10% FBS (164210-50) + 1% P / S (PB180120). HEK293T (human embryonic kidney cells) cells were inoculated into a 24-well plate and cultured the next day to reach a 60% confluence. C492A -IMP3-samRNA and nsP1 wt -IMP3-samRNA (10 μg / well), mix well and place in a 37°C incubator, and extract protein after 48 hours of incubation.

[0134] The expression of IMP3 target protein was detected by WB. The specific method is as follows:

[0135] (1) Collect HEK293T expression cells of different groups into 1.5 mL EP tubes, centrifuge at 1000 rpm for 5 min, wash once with PBS, and centrifuge at 1000 rpm for 5 min.

[0136] (2) Add 100 μL / well of RIPA (with protease inhibitors), lyse on ice for 30 min, centrifuge at 12,000 rpm, 4°C for 10 min, and collect the supernatant into a 1.5 mL EP tube.

[0137] (3) Sample electrophoresis: prepare samples, add 5X loading buffer, and place in a 100°C metal bath for 5 min; prepare electrophoresis buffer, load protein, and load 15 μl per well; perform electrophoresis at 80 V for 10 min and 150 V for 40 min.

[0138] (4) Transfer: pry open the electrophoresis gel plate, cut the gel and put it into the transfer solution, prepare the PVDF membrane, and place a piece of filter paper, gel, PVDF membrane, and a piece of filter paper in order from top to bottom. Assemble the transfer tank, add the transfer solution, and transfer at room temperature and 400 mA for 60 min.

[0139] (5) After transfer, cut the PVDF membrane and block it with 5% skim milk at room temperature for 1 h; rinse it once with TBST for 5 min.

[0140] (6) Incubate the primary antibody at 4°C overnight; rinse with TBST three times, 5 min each time.

[0141] (7) Incubate the secondary antibody on a shaker at room temperature for 2 h; rinse with TBST three times, 5 min each time.

[0142] (8) Color development: Mix solution A and solution B in the ECL luminescent agent in a ratio of 1:1 and add dropwise to the PVDF membrane with the protein side.

[0143] Exposure, development, photography and data processing in the darkroom.

[0144] The developed bands were processed and analyzed using Image J software. The results are as follows: Figure 3 As shown, with nsP1 wt Compared with the IMP3-samRNA group, nsP1 C492A -IMP3-samRNA transfection of HEK293T for 48h can effectively increase the expression level of IMP3 protein, and the expression level of IMP3 protein increased by about 3 times.

[0145] Experimental Example 3nsP1 C492A -Verification of the anti-tumor performance of IMP3-samRNA

[0146] This experimental example provides an experiment to verify the anti-tumor performance of samRNA. The specific experimental process is as follows:

[0147] Construction of IMP3-positive mouse melanoma subcutaneous model: 18 normal healthy 6-8 week old C57BL / 6 mice were selected and inoculated with 5×10 B16F10 cells subcutaneously. 5 / mouse, the cells overexpressed humanized IMP3, and there were 6 mice in each group.

[0148] The first administration was performed on the 5th day after the C57BL / 6 mice were inoculated with melanoma cells, and the second administration was performed 3 days after the inoculation, for a total of 3 administrations. The control group was given PBS, and the other two groups were given nsP1 wt -IMP3-samRNA and nsP1 C492A-IMP3-samRNA immunotherapy, the treatment volume is 50μL (10μg / mouse / time). The size of mouse tumors was measured regularly with a vernier caliper, and the measurement time points were 5, 7, 9, 11, 13, 15, 20, 25, and 30 days.

[0149] The results are as follows Figure 4 As shown, Figure 4 Figure 2 shows the changes in mouse tumors after treatment. Figure 4 It can be seen that the tumors of mice in the control group grew rapidly, reaching a volume of 1200mm 3 . Give nsP1 C492A -IMP3-samRNA and nsP1 wt -IMP3-samRNA mice had slower tumor growth, which was consistent with nsP1 wt Compared with the IMP3-samRNA group, nsP1 C492A -IMP3-samRNA group mice tumor growth rate is slower. Tumor volume growth curve shows that the samRNA vaccine based on IMP3 can effectively inhibit tumor growth, among which nsP1 C492A -IMP3-samRNA group more effectively inhibited tumor growth ( Figure 4 ).

[0150] The above experimental results show that compared with the non-mutated nsP1 wt -IMP3-samRNA vaccine, nsP1 made from mutant alphavirus vector C492A -IMP3-samRNA vaccine can more effectively inhibit the development of IMP3-positive tumors.

[0151] It can be seen from the above embodiments and experimental examples that constructing samRNA according to the scheme of the present invention can more efficiently and continuously express the target gene, and can also more effectively exert the efficacy of the prepared vaccine, such as nsP1 C492A -IMP3-samRNA vaccine has an inhibitory effect on IMP3-positive tumors. Therefore, the present invention has a good application prospect in the development of drugs and vaccines.

Claims

1. A self-replicating mRNA, characterized in that: The self-replicating mRNA is transcribed from an alphavirus backbone vector, which includes gene sequences of alphavirus non-structural proteins nsP2, nsP3, nsP4 and a mutant nsP1, wherein the 492nd cysteine ​​of the mutant nsP1 is mutated to serine.

2. The self-replicating mRNA according to claim 1, characterized in that: The gene sequence of the mutant nsP1 is as shown in SEQ ID NO.

6.

3. The self-replicating mRNA according to claim 1, characterized in that: The alphavirus backbone vector also includes a gene sequence of an immunogen, the immunogen is selected from IMP3, and the gene sequence of the immunogen is shown in SEQ ID NO.

1.

4. The self-replicating mRNA according to any one of claims 1 to 3, characterized in that: The alphavirus backbone vector comprises a promoter, a 5'UTR, a mutated gene sequence of nsP1, a gene sequence of nsP2, a gene sequence of nsp3, a gene sequence of nsp4, a gene sequence of an immunogen, a 3'UTR and a PolyA tail.

5. The self-replicating mRNA according to claim 4, characterized in that: The gene sequence of the nsP2 is as described in SEQ ID NO.3, the gene sequence of the nsP3 is as described in SEQ ID NO.4, and the gene sequence of the nsP4 is as described in SEQ ID NO.5; The nucleotide sequence of the promoter is as described in SEQ ID NO.7, the nucleotide sequence of the 5'UTR is as described in SEQ ID NO.8, the nucleotide sequence of the 3'UTR is as described in SEQ ID NO.10, and the nucleotide sequence of the PolyA tail is as described in SEQ ID NO.

11.

6. The self-replicating mRNA according to claim 1, characterized in that: The nucleotide sequence of the alphavirus backbone vector is shown in SEQ ID NO.

12.

7. The method for preparing the self-replicating mRNA according to any one of claims 1 to 6, characterized in that: The steps include: Step 1, digesting the plasmid containing the DNA sequence shown in SEQ ID NO. 12 to obtain a linearized template, and purifying it; Step 2, in vitro transcription and purification of the purified linearized template to obtain purified RNA; Step 3, capping and purifying the purified RNA obtained in step 2 to obtain self-replicating mRNA.

8. Use of the self-replicating mRNA vaccine according to any one of claims 1 to 6 in the preparation of an immunogenic composition.

9. The use according to claim 8, characterized in that: The immunogenic composition is used for preventing and / or treating tumors.

10. An immunogenic composition, characterized in that The invention is prepared by using the self-replicating mRNA as claimed in any one of claims 1 to 6 as an active ingredient and adding pharmaceutically acceptable excipients.

Images