Method for preparing trehalose from cellulose microsphere immobilized trehalose multienzyme complex

Abstract

The invention provides a method for preparing trehalose from a cellulose microsphere immobilized trehalose multienzyme complex, and belongs to the technical field of biology, the cellulose microsphere suitable for immobilizing the trehalose multienzyme complex is prepared, and trehalose is prepared by mediating three enzymes through scaffold protein. Wherein MTSase, MTHase and CGTase for catalyzing maltodextrin to prepare trehalose are key enzymes for catalysis, construction of a trehalose multi-enzyme complex is achieved through fusion expression of artificial scaffold protein containing CBM, immobilization is carried out through prepared cellulose microspheres, the conversion rate of trehalose is increased, the utilization rate of the enzymes is greatly increased, and the trehalose multi-enzyme complex is obtained. And the production cost is reduced.

Description

Technical Field

[0001] The invention relates to a method for preparing trehalose by using cellulose microspheres to immobilize trehalose multi-enzyme complex, belonging to the field of biotechnology. Background Art

[0002] Trehalose is a safe and stable non-reducing disaccharide that can form a protective film in extremely harsh environments to prevent protein denaturation and provide nonspecific protection for active organisms or cells. It is known as the "sugar of life". In recent years, the preparation technology of trehalose in my country has been continuously developing. Although the preparation of trehalose by the double enzyme method (maltooligosaccharide trehalose synthase MTSase and maltooligosaccharide trehalose hydrolase MTHase) has made breakthroughs, it still has defects such as low enzyme utilization and enzyme waste, resulting in a high cost of trehalose preparation, which is in urgent need of improvement.

[0003] Cellulosome is a multi-enzyme complex for efficient cellulose degradation formed by the assembly of multiple cellulases. It consists of two parts: scaffold protein and catalytic module, and forms a multi-enzyme complex by dockerin-cohesion interaction. Through the natural multi-enzyme configuration of cellulosome, the present invention aims to study the use of artificial scaffold protein as a medium to complete the assembly of in vitro dual enzyme complexes. Through a series of assembly verification and characterization, a trehalose dual enzyme complex that fully utilizes the enzyme system is obtained and immobilized.

[0004] Enzyme immobilization is an effective way to solve the solubility and stability problems of enzymes, allowing enzymes to be reused and reducing the cost of biological processes. One engineering method to simulate multi-enzyme cascades in nature is to use immobilization to connect pathway enzyme systems to polymers to achieve continuous chemical transformations. Multi-enzyme immobilization using the method of simulating cascade enzymes has the advantages of short operating time, small reactor volume, large volume flow, short reaction cycle, and reduced waste. Therefore, immobilizing multi-enzymes on certain carriers helps to improve storage and working stability and helps to achieve efficient enzyme cascade reactions at the same time. Enzymes can be immobilized in a variety of ways, such as physical methods such as non-covalent and embedding, and chemical methods such as covalent and cross-linking. Random co-immobilization is the simplest method, which combines enzymes and carriers with classical immobilization methods such as cross-linking, covalent or non-covalent immobilization.

[0005] Although there are many studies on immobilized carriers and immobilized enzymes in the prior art, the final immobilization effect is difficult to predict due to different immobilized carriers and immobilized enzymes, and it is not easy to prepare an immobilized enzyme with a high immobilization rate.

[0006] There are also relevant reports on the research on how to improve the conversion rate of trehalose in the existing technology, and the conversion rate of trehalose is also constantly improving; with the deepening of research, on the basis of the existing technical effects, it is more and more difficult to further improve the conversion rate of trehalose; however, because trehalose has a wide range of applications and the market has corresponding demands, further improving the conversion rate of trehalose is urgently needed in trehalose production.

[0007] Therefore, it is currently needed in the market to provide a method for preparing trehalose with a high conversion rate. Summary of the invention

[0008] In view of the shortcomings of the prior art, the present invention provides a method for preparing trehalose by immobilizing trehalose multi-enzyme complex by cellulose microspheres.

[0009] The technical solution of the present invention is as follows:

[0010] A method for preparing trehalose by immobilizing trehalose multi-enzyme complex by cellulose microspheres comprises the following steps:

[0011] Step 1: Construction of the recombinant scaffold protein WB800N-PP-ScafCCR strain, including the following steps:

[0012] a Using the genome of B. subtilis WB800N as a template, primers were designed to amplify the gene fragment of P43 promoter and the gene fragment of PhoD signal peptide by PCR;

[0013] b Using the biosynthesized ScafCCR bacterial solution as a template, primers were designed to PCR amplify Rfcoh-Ctcoh-CBM-Cccoh, and the Rfcoh-Ctcoh-CBM-Cccoh gene fragment was called the scaffolding protein ScafCCR gene fragment;

[0014] The ScafCCR bacterial solution is composed of the gene sequences of Ruminococcus flavefaciens, Clostridium Thermocellum, Clostridium cellulolyticum adhesion proteins Rfcoh, Ctcoh and Cccoh and cellulose binding domain CBM connected to the PUC57 plasmid;

[0015] The nucleotide sequence of the scaffold protein ScafCCR gene fragment is shown in SEQ ID NO.1;

[0016] c. Double digestion of the free plasmid pHT01 with restriction endonucleases SacⅠ and BamHI;

[0017] d. Using multi-fragment seamless cloning, the P43 promoter gene fragment and the PhoD signal peptide gene fragment obtained in step a and the ScafCCR gene fragment obtained in step b were connected to the linearized pHT01 plasmid obtained in step c after the concentration was determined by MD2000H, and transformed into Escherichia coli DH5α competent cells. After verification, the pHT01-P43-PhoD-ScafCCR recombinant plasmid was obtained;

[0018] e. The recombinant plasmid pHT01-P43-PhoD-ScafCCR prepared in step d was transformed into B. subtilis WB800N bacteria, and the recombinant B. subtilis WB800N / pHT01-P43-PhoD-ScafCCR was obtained by verification, and the recombinant bacteria was named WB800N-PP-ScafCCR;

[0019] Step 2: Construction of the recombinant fusion enzyme WB800N-PP-MTSase-Ccdoc strain, comprising the following steps:

[0020] (1) Using the B. subtilis WB800N genome as a template, primers were designed to amplify the gene fragment of the P43 promoter and the gene fragment of the PhoD signal peptide by PCR;

[0021] (2) Using the genome of Sulfolobus acidocaldarius ATCC 33909 as a template, PCR amplified the maltooligosyltrehalose synthase MTSase gene fragment;

[0022] (3) Using the biosynthesized Ccdoc bacterial solution as a template, primers were designed to perform PCR amplification of the docking protein Ccdoc gene fragment;

[0023] The Ccdoc bacterial solution is composed of the Ccdoc gene sequence of the docking protein in Clostridium cellulolyticum connected to the PUC57 plasmid;

[0024] (4) The free plasmid pHT01 was double-digested with restriction endonucleases SacⅠ and BamHI;

[0025] (5) Using multi-fragment seamless cloning, the P43 promoter gene fragment and the PhoD signal peptide gene fragment obtained in step (1), the MTSase gene fragment obtained in step (2), and the Ccdoc gene fragment obtained in step (3) were connected to the linearized pHT01 plasmid obtained in step (4), and transformed into Escherichia coli DH5α competent cells. After verification, the pHT01-P43-PhoD-MTSase-Ccdoc recombinant plasmid was obtained;

[0026] The nucleotide sequence of the fusion enzyme MTSase-Ccdoc gene fragment is shown in SEQ ID NO.2;

[0027] (6) The recombinant plasmid pHT01-P43-PhoD-MTSase-Ccdoc prepared in step (5) was transformed into B. subtilis WB800N bacteria, and the recombinant B. subtilis WB800N / pHT01-P43-PhoD-MTSase-Ccdoc was obtained by verification, and the recombinant bacteria was named WB800N-PP-MTSase-Ccdoc;

[0028] Step 3: Construction of the recombinant fusion enzyme WB800N-PP-Ctdoc-MTHase ​​strain, including the following steps:

[0029] ① Using the B. subtilis WB800N genome as a template, primers were designed to amplify the gene fragments of the P43 promoter and the PhoD signal peptide by PCR;

[0030] ②Using the biosynthesized Ctdoc bacterial solution as a template, primers were designed to PCR amplify the docking protein Ctdoc gene fragment;

[0031] The Ctdoc bacterial solution is composed of a Clostridium thermocellum docking protein Ctdoc gene sequence connected to a PUC57 plasmid;

[0032] ③Using the genome of Sulfolobus acidocaldarius ATCC 33909 as a template, PCR amplified the gene fragment of maltooligosaccharide-trehalose hydrolase MTHase;

[0033] ④ Double digest the free plasmid pHT01 with restriction endonucleases SacⅠ and BamHI;

[0034] ⑤Use multi-fragment seamless cloning to connect the P43 promoter gene fragment and the PhoD signal peptide gene fragment obtained in step ①, the Ctdoc gene fragment obtained in step ②, and the MTHase ​​gene fragment obtained in step ③ to the linearized pHT01 plasmid obtained in step ④, and transform them into Escherichia coli DH5α competent cells. After verification, the pHT01-P43-PhoD-Ctdoc-MTHase ​​recombinant plasmid is obtained;

[0035] The nucleotide sequence of the fusion enzyme Ctdoc-MTHase ​​gene fragment is shown in SEQ ID NO.3;

[0036] ⑥ The recombinant plasmid pHT01-P43-PhoD-Ctdoc-MTHase ​​prepared in step ⑤ was transformed into B. subtilis WB800N bacteria, and the recombinant B. subtilis WB800N / pHT01-P43-PhoD-Ctdoc-MTHase ​​was obtained after verification, and the recombinant bacteria was named WB800N-PP-Ctdoc-MTHase;

[0037] Step 4: Construction of the recombinant fusion enzyme WB800N-PP-CGTase-Rfdoc strain, comprising the following steps:

[0038] Ⅰ Using the recombinant plasmid pHT01-P43-PhoD-Ctdoc-MTHase ​​obtained in step ⑤ as a template, design primers for reverse PCR amplification of pHT01-P43-PhoD;

[0039] Ⅱ Using the biosynthesized CGTase-Rfdoc bacterial solution as a template, primers were designed to amplify the fusion enzyme CGTase-Rfdoc gene fragment by PCR;

[0040] The CGTase-Rfdoc bacterial solution is composed of the gene sequences of cyclodextrin glucosyltransferase CGTase in Bacillus ohbensis and docking protein Rfdoc in Ruminococcus flavefaciens connected to the PUC57 plasmid;

[0041] Ⅲ. Connect the pHT01-P43-PhoD gene fragment obtained in step Ⅰ with the fusion enzyme CGTase-Rfdoc gene fragment obtained in step Ⅱ by using single-fragment seamless cloning technology, and transform them into Escherichia coli DH5α competent cells. After successful verification, the pHT01-P43-PhoD-CGTase-Rfdoc plasmid can be obtained;

[0042] The nucleotide sequence of the fusion enzyme CGTase-Rfdoc gene fragment is shown in SEQ ID NO.4;

[0043] IV. Transform the recombinant plasmid pHT01-P43-PhoD-CGTase-Rfdoc prepared in step III into B. subtilis WB800N bacteria, and obtain recombinant B. subtilis WB800N / pHT01-P43-PhoD-CGTase-Rfdoc after verification. The recombinant bacteria are named WB800N-PP-CGTase-Rfdoc;

[0044] Step 5: A method for preparing cellulose microspheres, comprising the following steps:

[0045] A. A mixture of microcrystalline cellulose, chitosan and polyethylene glycol in a mass ratio of 7:2:1 is dissolved in 1-butyl 3-methylimidazolium chloride (BmimCl) and stirred to prepare a paste-like mucus with a final mass concentration of 5%;

[0046] B. Stir the paste-like mucus in step A at 85-95 rpm in a water bath at 75-85°C until it is completely dissolved and reaches a transparent and clear paste-like liquid state;

[0047] C uses anhydrous ethanol as a coagulation bath, completes the preparation of microspheres by extrusion, and rinses in deionized water for 1 to 3 times to obtain wet fiber microspheres. The cellulose microspheres are named CMS-1 and stored in a 20% ethanol solution;

[0048] Step 6, immobilizing the trehalose multi-enzyme complex on cellulose microspheres, comprising the following steps:

[0049] The above recombinant strains WB800n-PP-ScafCCR, WB800n-PP-MTSase-Ccdoc, WB800n-PP-Ctdoc-MTHase, and WB800n-PP-CGTase-Rfdoc were fermented respectively, and then extracted and purified to prepare scaffold protein ScafCCR, fusion enzyme MTSase-Ccdoc, fusion enzyme Ctdoc-MTHase, and fusion enzyme CGTase-Rfdoc;

[0050] The scaffolding protein ScafCCR, the fusion enzyme MTSase-Ccdoc, the fusion enzyme Ctdoc-MTHase ​​and the fusion enzyme CGTase-Rfdoc were mixed to prepare the trehalose multienzyme complex;

[0051] The prepared trehalose multi-enzyme complex is mixed with the cellulose microspheres CMS-1 prepared in step 5, and cross-linked with glutaraldehyde to prepare immobilized trehalose multi-enzyme complex cellulose microspheres;

[0052] Step 7, catalyzing the preparation of trehalose by the immobilized trehalose multi-enzyme complex cellulose microspheres prepared in step 6, comprising the following steps:

[0053] Trehalose was prepared using maltodextrin as substrate and cellulose microspheres as catalyzer of immobilized trehalose multienzyme complex.

[0054] According to the present invention, preferably: the nucleotide sequence of the PCR amplification primer of the gene fragment of the promoter P43 in step a is as follows:

[0055] P43-F: 5'-AGTGAATTCGAGCTCAGCTTCG-3'SEQ ID NO.5;

[0056] P43-R: 5'-GTCGTATGCCATAAGCTTCTGTTATTAATT-3' SEQ ID NO. 6.

[0057] According to the present invention, preferably, the nucleotide sequence of the PCR amplification primer of the gene fragment of the signal peptide PhoD in step a is as follows:

[0058] PhoD-F: 5'-ACAGAAGCTTATGGCATACGACA-3'SEQ ID NO.7;

[0059] PhoD-Scaf-R: 5'-GGTTGGGGCCTTTGAAGTAATGACAACAACAGGCGG-3' SEQ ID NO. 8.

[0060] Preferably according to the present invention, the nucleotide sequence of the PCR amplification primers of the scaffold protein ScafCCR gene fragment composed of Rfcoh-Ctcoh-CBM-Cccoh in step b is as follows:

[0061] Scaffold-F: 5'-GCCTTTGAAGTAATGACAACAACAGGCG-3'SEQ ID NO.9;

[0062] Scaffold-R: 5'-AGAGGATCCTTAATGATGGTGATGATG-3' SEQ ID NO. 10.

[0063] Preferably according to the present invention, the PCR amplification system in step a or b is as follows:

[0064] 1 μl of 10 μmol / L upstream primer, 1 μl of 10 μmol / L downstream primer, 1 μl of gene template, 2×Phanta MaxMaster Mix 25 μl, add ddH2O to 50 μl

[0065] The amplification procedure is as follows:

[0066] Pre-denaturation at 95℃ for 3min; denaturation at 95℃ for 15sec, annealing at 55℃ for 15sec, extension at 72℃ for 30sec / kb, 30 cycles; final extension at 72℃ for 5min; storage at 4℃.

[0067] The 72°C extension of 30 sec / kb refers to the amplification speed of DNA polymerase at 72°C of 30 sec / kb. Due to the different lengths of amplified genes, the 72°C extension time is calculated according to the enzyme cleavage efficiency.

[0068] Preferably according to the present invention, the double enzyme digestion system in step c is:

[0069] Free plasmid pHT01 2μl, restriction endonuclease SacⅠ20μl, restriction endonuclease BamHI20μl, 10*Buffer5μl, add water to 50μl, incubate in 37℃ water bath for 1-3h, incubate in 70℃ water bath for 10min to terminate the reaction, and then detect the enzyme cutting effect by electrophoresis.

[0070] Preferably according to the present invention, the multi-fragment seamless cloning in step d adopts the ClonExpress multi-fragment one-step cloning kit.

[0071] Preferably, according to the present invention, the screening of the integration of pHT01-P43-PhoD-ScafCCR plasmid into B. subtilis WB800N strain in step d is:

[0072] The transformants were spread on LB solid medium containing 100ug / mL chloramphenicol resistance and cultured at 37°C for 12h. Single colonies were picked up with a pipette and inoculated into LB liquid medium containing 100ug / mL chloramphenicol resistance and cultured at 37°C for 12h. PCR amplification verification was performed using the above bacterial liquid as a template, and the corresponding target bands were obtained by agarose gel electrophoresis, thus obtaining the integrated recombinant strain WB800N-PP-ScafCCR.

[0073] According to the present invention, preferably: the nucleotide sequence of the PCR amplification primer of the gene fragment of the promoter P43 in step (1) is as follows:

[0074] P43-F: 5'-AGTGAATTCGAGCTCAGCTTCG-3'SEQ ID NO.5;

[0075] P43-R: 5'-GTCGTATGCCATAAGCTTCTGTTATTAATT-3' SEQ ID NO. 6.

[0076] According to the present invention, preferably: the nucleotide sequence of the PCR amplification primer of the gene fragment of the signal peptide PhoD in step (1) is as follows:

[0077] PhoD-F: 5'-ACAGAAGCTTATGGCATACGACA-3'SEQ ID NO.7;

[0078] PhoD-Sase-R:

[0079] 5'-GTAGGTTGCTGATATCACTTCAAAGGCCCCAAC-3'SEQ ID NO. 11.

[0080] Preferably, according to the present invention, the nucleotide sequence of the PCR amplification primer for the maltooligosyltrehalose synthase MTSase gene fragment in step (2) is as follows:

[0081] Sase-F:

[0082] 5'-GGTTGGGGCCTTTGAAGTAGTGATATCAGCAACCTAC-3'SEQ ID NO.12;

[0083] Sase-R:

[0084] 5'-ATCGCCATTAACATCGCCCAGCAGTTTTTCCGGACCCTGGTCCGGCATTCTAACTAGTA TCCTA-3'SEQ ID NO. 13.

[0085] Preferably, according to the present invention, the nucleotide sequence of the PCR amplification primers for the docking protein Ccdoc gene fragment in step (3) is as follows:

[0086] Ccdoc-F:

[0087] 5'-TACTAGTTAGAATGCCGGACCAGGGTCCGGAAAAACTGCTGGGCGATGTTAATGGCGATGAAACAG-3'SEQ ID NO.14;

[0088] Ccdoc-R:

[0089] 5'-GACTCTAGAGGATCCTTAGTGGTGGTGGTGGTGGTGTTGAATGCTCAGCAGTGCTTTT TTC-3'SEQ ID NO. 15.

[0090] Preferably, according to the present invention, the PCR amplification system in steps (1), (2) and (3) is as follows:

[0091] 1 μl of 10 μmol / L upstream primer, 1 μl of 10 μmol / L downstream primer, 1 μl of gene template, 2×Phanta MaxMaster Mix 25 μl, add ddH2O to 50 μl;

[0092] The amplification procedure is as follows:

[0093] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 55°C for 15 sec, extension at 72°C for 30 sec / kb, 30 cycles; final extension at 72°C for 5 min; storage at 4°C;

[0094] The 72°C extension of 30 sec / kb refers to the amplification speed of DNA polymerase at 72°C of 30 sec / kb. Due to the different lengths of amplified genes, the 72°C extension time is calculated according to the enzyme cleavage efficiency.

[0095] Preferably, according to the present invention, the double enzyme digestion system in step (4) is:

[0096] Free plasmid pHT01 2μl, restriction endonuclease SacⅠ20μl, restriction endonuclease BamHI20μl, 10*Buffer5μl, add water to 50μl, incubate in 37℃ water bath for 1-3h, incubate in 70℃ water bath for 10min to terminate the reaction, and then detect the enzyme cutting effect by electrophoresis.

[0097] Preferably according to the present invention, the multi-fragment seamless cloning in step (5) adopts the ClonExpress multi-fragment one-step cloning kit.

[0098] Preferably, according to the present invention, the pHT01-P43-PhoD-MTSase-Ccdoc plasmid is integrated into the screening of B. subtilis WB800N strain in step (5):

[0099] The transformants were spread on LB solid medium containing 100ug / mL chloramphenicol resistance and cultured at 37°C for 12h. Single colonies were picked up with a pipette and inoculated into LB liquid medium containing 100ug / mL chloramphenicol resistance and cultured at 37°C for 12h. PCR amplification verification was performed using the above bacterial liquid as a template, and the corresponding target bands were obtained by agarose gel electrophoresis, thus obtaining the integrated recombinant strain WB800N-PP-MTSase-Ccdoc.

[0100] According to the preferred embodiment of the present invention: the nucleotide sequence of the PCR amplification primer of the gene fragment of the promoter P43 in step ① is as follows:

[0101] P43-F: 5'-AGTGAATTCGAGCTCAGCTTCG-3'SEQ ID NO.5;

[0102] P43-R: 5'-GTCGTATGCCATAAGCTTCTGTTATTAATT-3' SEQ ID NO. 6.

[0103] According to the present invention, preferably: the nucleotide sequence of the PCR amplification primer of the gene fragment of the signal peptide PhoD in step ① is as follows:

[0104] PhoD-F: 5'-ACAGAAGCTTATGGCATACGACA-3'SEQ ID NO.7;

[0105] PhoD-Hase-R:

[0106] 5'-CATTAACATCGCCATACATTACTTCAAAGGCCCCAACC-3'SEQ ID NO. 16.

[0107] Preferably, according to the present invention, the nucleotide sequence of the PCR amplification primers for the docking protein Ctdoc gene fragment in step ② is as follows:

[0108] Ctdoc-F: 5'-GGGGCCTTTGAAGTAATGTATGGCGATGTTAAT-3'SEQ ID NO.17;

[0109] Ctdoc-R:

[0110] 5'-TTTGTGCTCGGTGTGCCCGGAACTTTATACGTATTTTTATACGGCAGTGT-3'SEQ ID NO. 18.

[0111] Preferably, according to the present invention, the nucleotide sequence of the PCR amplification primer of the maltooligosyltrehalose hydrolase MTHase ​​gene fragment in step ③ is as follows:

[0112] Hase-F: 5'-TTCCGGGCACACCGAGCACAAAACTGTTTTCGTTCGGTGGAAATATTG-3'SEQ IDNO.19;

[0113] Hase-R:

[0114] 5'-TCGACTCTAGAGGATCCTTAATGATGATGTGTGATGATGTTCTAATTGATATACC-3'SEQ IDNO.20.

[0115] Preferably according to the present invention, the PCR amplification system in steps ①, ② and ③ is as follows:

[0116] 1 μl of 10 μmol / L upstream primer, 1 μl of 10 μmol / L downstream primer, 1 μl of gene template, 2×Phanta MaxMaster Mix 25 μl, add ddH2O to 50 μl;

[0117] The amplification procedure is as follows:

[0118] Pre-denaturation at 95℃ for 3min; denaturation at 95℃ for 15sec, annealing at 55℃ for 15sec, extension at 72℃ for 30sec / kb, 30 cycles; final extension at 72℃ for 5min; storage at 4℃.

[0119] The 72°C extension of 30 sec / kb refers to the amplification speed of DNA polymerase at 72°C of 30 sec / kb. Due to the different lengths of amplified genes, the 72°C extension time is calculated according to the enzyme cleavage efficiency.

[0120] Preferably according to the present invention, the double enzyme digestion system in step ④ is:

[0121] Free plasmid pHT01 2μl, restriction endonuclease SacⅠ20μl, restriction endonuclease BamHI20μl, 10*Buffer5μl, add water to 50μl, incubate in 37℃ water bath for 1-3h, incubate in 70℃ water bath for 10min to terminate the reaction, and then detect the enzyme cutting effect by electrophoresis.

[0122] Preferably according to the present invention, the multi-fragment seamless cloning in step ⑤ adopts the ClonExpress multi-fragment one-step cloning kit.

[0123] Preferably, according to the present invention, the screening of the integration of pHT01-P43-PhoD-Ctdoc-MTHase ​​plasmid into B. subtilis WB800N strain in step ⑤ is as follows:

[0124] The transformants were spread on LB solid medium containing 100ug / mL chloramphenicol resistance and cultured at 37°C for 12h. Single colonies were picked up with a pipette and inoculated into LB liquid medium containing 100ug / mL chloramphenicol resistance and cultured at 37°C for 12h. PCR amplification verification was performed using the above bacterial liquid as a template, and the corresponding target bands were obtained by agarose gel electrophoresis, thus obtaining the integrated recombinant strain WB800N-PP-Ctdoc-MTHase.

[0125] According to the preferred embodiment of the present invention: the nucleotide sequence of the reverse PCR amplification primer of the gene fragment of pHT01-P43-PhoD in step I is as follows:

[0126] pHT01-PP-F:

[0127] 5'-GCACCACCACCACCACCACTAAGGATCCTCTAGAGTCGACGT-3'SEQ ID NO.21;

[0128] pHT01-PP-R:

[0129] 5'-CGCCGGATCCCATTACTTCAAAGGCCCCAACCGACTGGGCAA-3'SEQ ID NO. 22.

[0130] According to the preferred embodiment of the present invention, the nucleotide sequence of the PCR amplification primer of the gene fragment of the fusion enzyme CGTase-Rfdoc in step II is as follows:

[0131] CGTase-Rfdoc-F:

[0132] 5'-GGGGCCTTTGAAGTAatgATGAATGATCTGAATGATTTTCTG-3'SEQ ID NO.23;

[0133] CGTase-Rfdoc-R:

[0134] 5'-GGTGGTGCTCGAGCTGCGGCAGGGTTAT-3'SEQ ID NO. 24.

[0135] Preferably according to the present invention, the PCR amplification system in steps Ⅰ and Ⅱ is as follows:

[0136] 1 μl of 10 μmol / L upstream primer, 1 μl of 10 μmol / L downstream primer, 1 μl of gene template, 2×Phanta MaxMaster Mix 25 μl, add ddH2O to 50 μl;

[0137] The amplification procedure is as follows:

[0138] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 53°C for 15 sec, extension at 72°C for 30 sec / kb, 30 cycles; final extension at 72°C for 5 min; storage at 4°C.

[0139] The 72°C extension of 30 sec / kb refers to the amplification speed of DNA polymerase at 72°C of 30 sec / kb. Due to the different lengths of amplified genes, the 72°C extension time is calculated according to the enzyme cleavage efficiency.

[0140] Preferably according to the present invention, the single fragment seamless cloning in step III adopts the ClonExpress single fragment one-step cloning kit.

[0141] Preferably, according to the present invention, the screening of the integration of pHT01-P43-PhoD-CGTase-Rfdoc plasmid into B. subtilis WB800N strain in step III is as follows:

[0142] The transformants were spread on LB solid medium containing 100ug / mL chloramphenicol resistance and cultured at 37°C for 12h. Single colonies were picked up with a pipette and inoculated into LB liquid medium containing 100ug / mL chloramphenicol resistance and cultured at 37°C for 12h. PCR amplification verification was performed using the above bacterial liquid as a template, and the corresponding target bands were obtained by agarose gel electrophoresis, thus obtaining the integrated recombinant strain WB800N-PP-CGTase-Rfdoc.

[0143] Preferably, according to the present invention, in step 6, the preparation of the immobilized trehalose multi-enzyme complex cellulose microspheres comprises the following steps:

[0144] (i) activating and expanding the above-mentioned recombinant scaffold protein strain WB800N-PP-ScafCCR and the recombinant fusion enzyme strains WB800N-PP-MTSase-Ccdoc, WB800N-PP-Ctdoc-MTHase, and WB800N-PP-CGTase-Rfdoc, respectively, and fermenting them at 37° C. for 40-50 hours, collecting the bacterial cells, resuspending them, and using an ultrasonic disruptor to disrupt the cells to obtain a cell disruption solution as a crude enzyme solution; purifying, desalting, and concentrating the crude enzyme solution as a pure enzyme solution for subsequent assembly;

[0145] (ii) mixing the scaffold protein pure enzyme solution ScafCCR in step (i) with the pure enzyme solutions of the fusion enzymes MTSase-Ccdoc, Ctdoc-MTHase, and CGTase-Rfdoc in step (i) at 30-70° C. and pH 4.0-8.0 to form a trehalose multienzyme complex;

[0146] (iii) immobilizing the trehalose multienzyme complex in step (ii) using the fiber microspheres CMS-1 prepared in step 5, adding 1% glutaraldehyde to the fixed microspheres, cross-linking at 25° C. for 1 hour, and then rinsing with PBS buffer for 3 times to remove excess cross-linking agent and unadsorbed residual protein, and obtaining immobilized microspheres of trehalose multienzyme complex, and recovering them to obtain immobilized trehalose multienzyme complex cellulose microspheres;

[0147] (iv) separating the immobilized trehalose multi-enzyme complex cellulose microspheres in step (iii) by filtering, washing the immobilized trehalose multi-enzyme complex cellulose microspheres, and recovering the immobilized trehalose multi-enzyme complex cellulose microspheres after drying.

[0148] Preferably, in step (i), the activation culture conditions are 37° C., 200-220 rpm, and 10-12 h, and the activation culture medium is a liquid LB culture medium having the following components:

[0149] Tryptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L, adjust pH to 7.0 with NaOH.

[0150] Preferably, in step (i), the expansion culture conditions are 37° C., 200-220 rpm, 10-12 h, and the expansion culture medium is TB medium.

[0151] In the step (i), the seed solution obtained by the expanded culture is transferred to the TB culture medium at a volume percentage of 8-10%, and fermented at a speed of 400-500 rpm and a temperature of 37° C. for 45-50 hours;

[0152] The composition of TB medium is as follows:

[0153] TB fermentation medium: tryptone 12 g / L, yeast extract powder 24 g / L, KH2PO4 2.4 g / L, K2HPO4 16.5 g / L, glycerol 4 ml / L.

[0154] Preferably, in step (i), the fermentation liquid is placed in a centrifuge at 4°C and 8000 rpm for 10 min, and the bacterial cells are collected; the bacterial cells are resuspended and washed multiple times using 10 mM PBS buffer to remove excess impurities, pigments and culture medium components;

[0155] The resuspended bacteria were crushed by ultrasonic crusher, with a power of 400 W and a Φ6 amplitude, and the working principle of 4 seconds of crushing and 6 seconds of rest for a total of 20 minutes was followed. The whole process was carried out on ice. The crushing liquid was centrifuged at 12000 rpm in a centrifuge precooled at 4°C for 30 minutes, and the collected supernatant was the crude enzyme solution.

[0156] Preferably, according to the present invention, in step (i), an AKTA protein purification chromatograph is used to separate and purify the crude enzyme solution of each module to obtain pure enzyme.

[0157] The pure enzyme solution obtained by purification in step (i) has high imidazole and salt ion components, which will affect the subsequent assembly research. Therefore, a desalting column is selected with an AKTA protein purification chromatograph to desalt the protein.

[0158] The pure enzyme solution after desalination in step (i) is affected by dilution, so it is concentrated by ultrafiltration tube.

[0159] According to the preferred embodiment of the present invention, in step (ii), the scaffold protein and the fusion enzyme are incubated at 37°C, Ca 2+ In vitro assembly was completed at a concentration of 10 mM.

[0160] Preferably, according to the present invention, the immobilization is carried out at a temperature of 30° C., pH=7.4, a calcium ion concentration of 10 mmol / L, and an action time of 40 min in step (iii).

[0161] Preferably, in the step (iv), the fiber pellets are washed with sterile water and then vacuum freeze-dried for recovery, and the vacuum freeze-drying conditions are as follows: a cold trap temperature of -54°C and a vacuum degree of 8Pa;

[0162] In the step 7, maltodextrin is used as a substrate for catalytic preparation of trehalose, and the amount of trehalose produced is determined by HPLC.

[0163] Preferably, according to the present invention, in step 7, after the immobilized trehalose multi-enzyme complex cellulose microspheres catalyze the preparation of trehalose, the immobilized trehalose multi-enzyme complex cellulose microspheres are filtered and recovered, and further utilized to prepare trehalose.

[0164] A method for preparing cellulose microspheres comprises the following steps:

[0165] A mixture of microcrystalline cellulose, chitosan and polyethylene glycol in a mass ratio of 7:2:1 is dissolved in 1-butyl 3-methylimidazolium chloride (BmimCl), and a paste-like mucus with a final mass concentration of 5% is prepared by stirring; the obtained paste-like mucus is stirred at 85-95 rpm in a water bath of 75-85°C until it is completely dissolved and reaches a transparent and clear paste-like liquid state; anhydrous ethanol is used as a coagulation bath, and microspheres are prepared by extrusion, and rinsed in deionized water for 1-3 times to obtain wet fiber microspheres. The cellulose microspheres are named CMS-1 and stored in a 20% ethanol solution.

[0166] Application of the cellulose microspheres prepared by the above method in enzyme immobilization.

[0167] Beneficial Effects

[0168] 1. The present invention uses scaffolding protein to mediate three enzymes to achieve the preparation of trehalose, wherein MTSase, MTHase ​​and CGTase that catalyze the preparation of trehalose from maltodextrin are key enzymes for catalysis, and the construction of a trehalose multi-enzyme complex is mediated by fusion expression of an artificial scaffolding protein containing CBM, and the trehalose multi-enzyme complex is immobilized using cellulose microspheres prepared by the present invention. The immobilized trehalose multi-enzyme complex cellulose microspheres prepared by the present invention catalyze the preparation of trehalose, and the conversion rate of trehalose is significantly improved.

[0169] 2. The immobilized trehalose multi-enzyme complex cellulose microspheres prepared by the present invention not only improve the conversion rate of trehalose but also can be recycled for multiple times, greatly improving the utilization rate of the enzyme and reducing the production cost.

[0170] 3. The trehalose multienzyme complex constructed by the present invention improves the enzymatic properties of the three enzymes without affecting the initial enzymatic activities of MTSase, MTHase ​​and CGTase, improves the temperature and acid resistance, and also improves the efficiency of catalytic preparation of trehalose. BRIEF DESCRIPTION OF THE DRAWINGS

[0171] Figure 1 This is a schematic diagram of the construction of pHT01-P43-PhoD-ScafCCR vector.

[0172] Figure 2 This is a schematic diagram of the construction of pHT01-P43-PhoD-MTSase-Ccdoc vector.

[0173] Figure 3 This is a schematic diagram of the construction of pHT01-P43-PhoD-Ctdoc-MTHase ​​vector.

[0174] Figure 4 This is a schematic diagram of the construction of pHT01-P43-PhoD-CGTase-Rfdoc vector.

[0175] Figure 5 It is the agarose gel electrophoresis diagram of P43 promoter, PhoD signal peptide gene, linearized pHT01, reverse P43-PhoD-pHT01 gene, scaffolding protein ScafCCR gene, fusion enzymes MTSase-Ccdoc, Ctdoc-MTHase, and CGTase-Rfdoc.

[0176] Figure 6 The electrophoretic diagrams of transformation verification of WB800N-PP-ScafCCR, WB800N-PP-MTSase-Ccdoc, WB800N-PP-Ctdoc-MTHase, and WB800N-PP-CGTase-Rfdoc using B. subtilis as the host bacteria;

[0177] In the picture: 1: WB800N-PP-ScafCCR;

[0178] 2: WB800N-PP-MTSase-Ccdoc;

[0179] 3: WB800N-PP-Ctdoc-MTHase;

[0180] 4:WB800N-PP-CGTase-Rfdoc.

[0181] Figure 7Western Blot was used to verify the uniqueness and correctness of the expression of the fusion enzymes Sase-Ccdoc, Ctdoc-Hase, CGTase-Rfdoc and the scaffolding protein ScafCCR;

[0182] M in the figure: protein marker;

[0183] 1: Fusion enzyme MTSase-Ccdoc;

[0184] 2: Scaffolding protein ScafCCR;

[0185] 3: Fusion enzyme Ctdoc-MTHase;

[0186] 4: Fusion enzyme CGTase-Rfdoc.

[0187] Figure 8 This is the normal physical picture and the SEM picture after freeze-drying.

[0188] Fig. 9 This is a SEM image of the trehalose-enzyme complex fixed on the surface of fiber microspheres.

[0189] Fig.10 It is a comparison of the immobilization rates of different cellulose microspheres.

[0190] Fig.11 Effect of temperature on immobilization rate.

[0191] Fig.12 Effect of pH on immobilization efficiency.

[0192] Fig.13 Effect of calcium ion concentration on the immobilization rate.

[0193] Fig.14 Effect of time on fixation rate.

[0194] Fig.15 Diagram of the recycling of the immobilized trehalose dual-enzyme complex.

[0195] Fig.16 This is a schematic diagram of the in vitro assembly of three enzymes by artificial scaffolding protein. DETAILED DESCRIPTION

[0196] The technical solution of the present invention is further described below in conjunction with the embodiments, but the protection scope of the present invention is not limited thereto. The reagents and drugs involved in the embodiments, unless otherwise specified, are common commercially available products;

[0197] The experimental operations involved in the examples are all routine operations in the art unless otherwise specified.

[0198] Figure 1This is a schematic diagram of the construction of pHT01-P43-PhoD-ScafCCR vector.

[0199] Figure 2 This is a schematic diagram of the construction of pHT01-P43-PhoD-MTSase-Ccdoc vector.

[0200] Figure 3 This is a schematic diagram of the construction of pHT01-P43-PhoD-Ctdoc-MTHase ​​vector.

[0201] Figure 4 This is a schematic diagram of the construction of pHT01-P43-PhoD-CGTase-Rfdoc vector.

[0202] Fig.16 This is a schematic diagram of the in vitro assembly of three enzymes by artificial scaffolding protein.

[0203] Sources of biological materials and reagents:

[0204] Sulfolobus acidocaldarius ATCC 33909, laboratory collection;

[0205] B. Subtilis WB800N was purchased from Hangzhou Baosai Biological Co., Ltd.;

[0206] The episomal plasmid pHT01 was purchased from Youbao Biotechnology Co., Ltd.;

[0207] ScafCCR bacterial solution was purchased from Shanghai Shenggong Company;

[0208] MTSase-Ccdoc bacterial solution was purchased from Shanghai Shenggong Company;

[0209] Ctdoc-MTHase ​​bacterial solution was purchased from Shanghai Shenggong Company;

[0210] CGTase-Rfdoc bacterial solution was purchased from Shanghai Shenggong Company;

[0211] E. coli DH5α is stored in the laboratory, or purchased commercially;

[0212] 1-Butyl 3-methylimidazolium chloride (BmimCl) was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.;

[0213] Microcrystalline cellulose was purchased from Sinopharm Chemical Reagent Co., Ltd.;

[0214] 25% glutaraldehyde was purchased from Maoming Xiongda Chemical Co., Ltd.

[0215] Example 1

[0216] Construction of recombinant scaffold protein strain WB800N-PP-ScafCCR

[0217] (1) Cloning of the scaffolding protein ScafCCR gene fragment

[0218] Using the B. subtilis WB800N genome as a template, primers were designed to PCR amplify the gene fragments of the P43 promoter and the PhoD signal peptide; using the ScafCCR bacterial solution synthesized by Shanghai Shenggong Company as a template, primers were designed to PCR amplify the Rfcoh-Ctcoh-CBM-Cccoh gene fragment. The gel electrophoresis diagram is shown in Figure 5 As shown;

[0219] The nucleotide sequence of the scaffold protein ScafCCR gene fragment is shown in SEQ ID NO.1;

[0220] The PCR primers for the P43 promoter gene sequence are as follows:

[0221] P43-F: 5'-AGTGAATTCGAGCTCAGCTTCG-3'SEQ ID NO.5;

[0222] P43-R:5'-GTCGTATGCCATAAGCTTCTGTTATTAATT-3'SEQ ID NO.6

[0223] The PCR reaction system is as follows:

[0224] 1 μl of 10 μmol / L upstream primer P43-F, 1 μl of 10 μmol / L downstream primer P43-R, 1 μl of gene template B. subtilis WB800N, 25 μl of 2×Phanta Max Master Mix, supplemented with ddH2O to 50 μl;

[0225] The above PCR reaction was carried out according to the following procedure:

[0226] Pre-denaturation at 95℃ for 3min; denaturation at 95℃ for 15sec, annealing at 55℃ for 15sec, extension at 72℃ for 30sec / kb, 30 cycles; final extension at 72℃ for 5min; storage at 4℃.

[0227] The PCR primers for the gene sequence of the PhoD signal peptide are as follows:

[0228] PhoD-F: 5'-ACAGAAGCTTATGGCATACGACA-3'SEQ ID NO.7;

[0229] PhoD-Scaf-R: 5'-GGTTGGGGCCTTTGAAGTAATGACAACAACAGGCGG-3'SEQ ID NO.8;

[0230] The PCR reaction system is as follows:

[0231] 1 μl of 10 μmol / L upstream primer PhoD-F, 1 μl of 10 μmol / L downstream primer PhoD-Scaf-R, 1 μl of gene template B. subtilis WB800N, 25 μl of 2×Phanta Max Master Mix, supplemented with ddH2O to 50 μl;

[0232] The above PCR reaction was carried out according to the following procedure:

[0233] Pre-denaturation at 95℃ for 3min; denaturation at 95℃ for 15sec, annealing at 55℃ for 15sec, extension at 72℃ for 30sec / kb, 30 cycles; final extension at 72℃ for 5min; storage at 4℃.

[0234] The PCR primers for the ScafCCR protein gene sequence are as follows:

[0235] Scaffold-F: 5'-GCCTTTGAAGTAATGACAACAACAGGCG-3'SEQ ID NO.9;

[0236] Scaffold-R: 5'-AGAGGATCCTTAATGATGGTGATGATG-3'SEQ ID NO.10;

[0237] The PCR reaction system is as follows:

[0238] 1 μl of 10 μmol / L upstream primer Scaffold-F, 1 μl of 10 μmol / L downstream primer Scaffold-R, 1 μl of gene template ScafCCR, 25 μl of 2×Phanta Max Master Mix, add ddH2O to 50 μl;

[0239] The above PCR reaction was carried out according to the following procedure:

[0240] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 54°C for 15 sec, extension at 72°C for 30 sec / kb, 30 cycles; final extension at 72°C for 5 min; storage at 4°C.

[0241] After PCR, the fragment length was analyzed by 1% agarose gel electrophoresis, the target band was cut out according to the fragment size, and the cut gel was recovered using Shanghai Biotech Gel Recovery Kit.

[0242] 2) The free plasmid pHT01 was double-digested with Scal and BamH I

[0243] The pHT01 plasmid digestion system is:

[0244] Free plasmid pHT01 2μl, restriction endonuclease SacⅠ20μl, restriction endonuclease BamHI20μl, 10*Buffer5μl, add water to 50μl. Terminate the reaction in 37℃ water bath for 1-3h, 70℃ water bath for 10min, and detect the product by 1% agarose gel electrophoresis, and recover it using DNA gel recovery kit.

[0245] The following fragments were constructed and connected using the ClonExpress multi-fragment one-step cloning kit. The seamless cloning and connection system is:

[0246] pHT01 plasmid 128.4 ng; P43 9.6 ng; PhoD 3.3 ng; ScafCCR 44 ng; Exnase 2 μL; 5×CE buffer 4 μL; ddH2O is added to make up to 20 μL.

[0247] Reaction conditions: metal bath at 37°C for 30 min.

[0248] The seamless cloning product was transformed into E. coli DH5α competent cells, and the agarose gel electrophoresis diagram of ScafCCR was verified as shown in Figure 5 shown.

[0249] (3) Preparation of B. subtilis WB800N electroporation competent cells

[0250] The preparation method of the competent cells is as follows:

[0251] The B.subtilis WB800N strain was activated and cultured. A single colony was selected and inoculated into LB medium and cultured overnight at 37°C and 200 r / min. 100 μL of the overnight culture was inoculated into a 50 mL conical flask containing 5 mL SPI medium, and cultured at 37°C in a shaking incubator at 200 r / min for 3-3.5 h. The OD600 value was measured to be between 0.9 and 1.2. 500 μL of the above SPI culture was quickly inoculated into a 250 mL conical flask containing 5 mL SPII medium, and cultured at 37°C and 100 r / min for 90 min in a constant temperature shaking incubator. Under a sterile environment, 50 μL of the above culture was added. 100×EGTA solution was incubated at 37°C, 100 r / min in a shaker for 10 min; finally, sterile glycerol was added to a final concentration of 10% and dispensed into 1.5 mL sterile EP tubes according to the specification of 100 μL. It can be stored at -80°C for 1-3 months.

[0252] The solution formula required for the preparation of the competent cells is as follows. All solutions must be sterilized at 121°C before use:

[0253] The SPI medium (50 mL) has the following components:

[0254] 24.5mL SPI-A, 24.5mL SPI-B, 500μL 50% glucose, 500μL 100×CAYE

[0255] The SPI-A components are as follows:

[0256] (NH4)2SO4 4g / L, K2HPO4·3H2O 28g / L, KH2PO4 12g / L, trisodium citrate dihydrate 2g / L;

[0257] The SPI-B component is MgSO4·7H2O 0.4 g / L;

[0258] The 100×CAYE components include 20 g / L casein hydrolysate and 100 g / L yeast extract;

[0259] The components of the SPI I medium (20 mL) are as follows:

[0260] 19.6mL SPI medium, 200μL 250mM MgCl2, 200μL 50mM CaCl2;

[0261] (4) Transform the recombinant plasmid P43-PhoD-ScafCCR into B. subtilis WB800N

[0262] Place the stored B.subtilis WB800N competent cells in a 40℃ water bath to recover for 2 minutes, add 10μL of the recombinant plasmid pHT01-P43-PhoD-ScafCCR in a sterile environment, flick the tube wall to mix, incubate on ice for 5 minutes, add to the pre-cooled electroporation cup, and perform electrotransformation at 2500V and 5ms. After the electroporation is completed, immediately add 1mL of 37℃ preheated RM medium to the electroporation cup, and then incubate at 37℃ for 90 minutes on a shaker at 200r / min; after centrifuging the bacterial solution at 5000rpm for 10 minutes, pour out part of the supernatant, and then apply the remaining resuspended bacteria to the LB solid plate containing a final concentration of 30μg / mL chloramphenicol for screening and culture, and incubate overnight at 37℃ incubator for 12-16h;

[0263] The RM medium composition is LB+0.5M sorbitol+0.38M mannitol;

[0264] (5) Identification of positive recombinant bacteria WB800N

[0265] After 5-10 overnight cultured B. subtilis single colonies were selected for expansion, the obtained bacterial solution was used as a template, and PCR verification of B. subtilis transformants was performed using universal sequencing primers pHT01-F / R.

[0266] The verification bacterial solution PCR amplification system is 10 μL:

[0267] Template 1 μL; Upstream primer 1 μL; Downstream primer 1 μL; 2×Taq Master Mix 5 μL; ddH2O 2 μL;

[0268] The universal primers for bacterial liquid PCR amplification are as follows:

[0269] pHT01-F: 5'-GATCGGTGCGGGCCTCTTCG-3'SEQ ID NO.25;

[0270] pHT01-R: 5'-CAACCATTTGTTCCAGGTAAGG-3'SEQ ID NO.26;

[0271] The bacterial solution PCR amplification procedure is as follows:

[0272] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 1 min 30 s, 30 cycles; extension at 72°C for 5 min; storage at 4°C;

[0273] After DNA agarose gel electrophoresis, the preliminarily verified bacterial solution was sent to the company for further sequencing, which proved that the exogenous fragment P43-PhoD-ScafCCR had been transferred into B. subtilis WB800N. Figure 6 As shown, the recombinant bacteria was named WB800N-PP-ScafCCR.

[0274] Example 2

[0275] Construction of recombinant bacteria WB800N-PP-MTSase-Ccdoc

[0276] (1) Cloning the fusion enzyme MTSase-Ccdoc gene fragment

[0277] Using the genome of B. subtilis WB800N as a template, primers were designed to amplify the gene fragment of the P43 promoter and the gene fragment of the PhoD signal peptide by PCR; MTSase-Ccdoc synthesized by Shanghai Shenggong Company was used to amplify the gene fragment of the P43 promoter and the PhoD signal peptide by PCR.

[0278] The bacterial solution was used as a template, and primers were designed to PCR amplify the MTSase-Ccdoc gene fragment. The gel electrophoresis diagram is shown in Figure 5 As shown;

[0279] The PCR primers for the P43 promoter gene sequence are as follows:

[0280] P43-F: 5'-AGTGAATTCGAGCTCAGCTTCG-3'SEQ ID NO.5;

[0281] P43-R:5'-GTCGTATGCCATAAGCTTCTGTTATTAATT-3'SEQ ID NO.6

[0282] The PCR reaction system is as follows:

[0283] 1 μl of 10 μmol / L upstream primer P43-F, 1 μl of 10 μmol / L downstream primer P43-R, 1 μl of gene template B. subtilis WB800N, 25 μl of 2×Phanta Max Master Mix, supplemented with ddH2O to 50 μl;

[0284] The above PCR reaction was carried out according to the following procedure:

[0285] Pre-denaturation at 95℃ for 3min; denaturation at 95℃ for 15sec, annealing at 55℃ for 15sec, extension at 72℃ for 30sec / kb, 30 cycles; final extension at 72℃ for 5min; storage at 4℃.

[0286] The PCR primers for the gene sequence of the PhoD signal peptide are as follows:

[0287] PhoD-F: 5'-ACAGAAGCTTATGGCATACGACA-3'SEQ ID NO.7;

[0288] PhoD-Sase-R: 5'-GTAGGTTGCTGATATCACTTCAAAGGCCCCAAC-3'SEQ ID NO.11;

[0289] The PCR reaction system is as follows:

[0290] 1 μl of 10 μmol / L upstream primer PhoD-F, 1 μl of 10 μmol / L downstream primer PhoD-Sase-R, 1 μl of gene template B. subtilis WB800N, 25 μl of 2×Phanta Max Master Mix, supplemented with ddH2O to 50 μl;

[0291] The above PCR reaction was carried out according to the following procedure:

[0292] Pre-denaturation at 95℃ for 3min; denaturation at 95℃ for 15sec, annealing at 55℃ for 15sec, extension at 72℃ for 30sec / kb, 30 cycles; final extension at 72℃ for 5min; storage at 4℃.

[0293] The nucleotide sequence of the fusion enzyme MTSase-Ccdoc gene fragment is shown in SEQ ID NO.2;

[0294] The PCR primers of the fusion enzyme MTSase-Ccdoc gene sequence are as follows:

[0295] Sase-F:

[0296] 5'-GGTTGGGGCCTTTGAAGTAGTGATATCAGCAACCTAC-3'SEQ ID NO.12;

[0297] Sase-R:

[0298] 5'-ATCGCCATTAACATCGCCCAGCAGTTTTTCCGGACCCTGGTCCGGCATTCTAACT AGTATCCTA-3'SEQ ID NO.13;

[0299] The PCR reaction system is as follows:

[0300] 10μmol / L upstream primer Sase-F 1μl, 10μmol / L downstream primer Sase-R 1μl, gene template MTSase-Ccdoc1μl, 2×Phanta Max Master Mix 25μl, add ddH2O to 50μl;

[0301] The above PCR reaction was carried out according to the following procedure:

[0302] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 61°C for 15 sec, extension at 72°C for 30 sec / kb, 30 cycles; final extension at 72°C for 5 min; storage at 4°C;

[0303] Ccdoc-F:

[0304] 5'-TACTAGTTAGAATGCCGGACCAGGGTCCGGAAAAACTGCTGGGCGATGTTAATGGCGATGAAACAG-3'SEQ ID NO.14;

[0305] Ccdoc-R:

[0306] 5'-GACTCTAGAGGATCCTTAGTGGTGGTGGTGGTGGTGTTGAATGCTCAGCAGTGC TTTTTTC-3'SEQ ID NO.15;

[0307] The PCR reaction system is as follows:

[0308] 10μmol / L upstream primer Ccdoc-F 1μl, 10μmol / L downstream primer Ccdoc-R 1μl, gene template MTSase-Ccdoc1μl, 2×Phanta Max Master Mix 25μl, add ddH2O to 50μl;

[0309] The above PCR reaction was carried out according to the following procedure:

[0310] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 65°C for 15 sec, extension at 72°C for 30 sec / kb, 30 cycles; final extension at 72°C for 5 min; storage at 4°C;

[0311] After PCR, the fragment length was analyzed by 1% agarose gel electrophoresis, the target band was cut out according to the fragment size, and the cut gel was recovered using Shanghai Biotech Gel Recovery Kit.

[0312] (2) The free plasmid pHT01 was double-digested with Sca I and BamH I

[0313] The pHT01 plasmid digestion system is:

[0314] Free plasmid pHT01 2μl, restriction endonuclease SacⅠ20μl, restriction endonuclease BamHI20μl, 10*Buffer5μl, add water to 50μl. Terminate the reaction in 37℃ water bath for 1-3h, 70℃ water bath for 10min, and detect the product by 1% agarose gel electrophoresis, and recover it using DNA gel recovery kit.

[0315] The following fragments were constructed and connected using the ClonExpress multi-fragment one-step cloning kit. The seamless cloning and connection system is:

[0316] pHT01 plasmid 128.4ng; P43 9.6ng; PhoD 3.3ng; MTSase-Ccdoc 47.58ng; Exnase 2μL; 5×CE buffer 4μL; ddH2O is added to make up to 20μL.

[0317] Reaction conditions: metal bath at 37°C for 30 min.

[0318] The seamless cloning product was transformed into E. coli DH5α competent cells, and the agarose gel electrophoresis diagram of MTSase-Ccdoc was verified as shown in Figure 5 shown.

[0319] (3) Preparation of B. subtilis WB800N electroporation competent cells

[0320] The method for preparing the competent cells is as follows, which is the same as in Example 1.

[0321] (4) Transform the recombinant plasmid P43-PhoD-MTSase-Ccdoc into B. subtilis WB800N

[0322] Place the stored B.subtilis WB800N competent cells in a 40℃ water bath to recover for 2 minutes, add 10μL of the recombinant plasmid pHT01-P43-PhoD-MTSase-Ccdoc in a sterile environment, flick the tube wall to mix, incubate on ice for 5 minutes, add to the pre-cooled electroporation cup, and perform electrotransformation at 2500V and 5ms. After the electroporation is completed, immediately add 1mL of 37℃ preheated RM medium to the electroporation cup, and then incubate at 37℃ for 90 minutes on a shaker at 200r / min; after centrifuging the bacterial solution at 5000rpm for 10 minutes, pour out part of the supernatant, and then apply the remaining resuspended bacteria to the LB solid plate containing a final concentration of 30μg / mL chloramphenicol for screening and culture, and incubate overnight at 37℃ incubator for 12-16h;

[0323] The RM medium composition is LB+0.5M sorbitol+0.38M mannitol;

[0324] (5) Identification of positive recombinant bacteria WB800N

[0325] After 5-10 overnight cultured B. subtilis single colonies were selected for expansion, the obtained bacterial solution was used as a template, and PCR verification of B. subtilis transformants was performed using universal sequencing primers pHT01-F / R.

[0326] The verification bacterial solution PCR amplification system is 10 μL:

[0327] Template 1 μL; Upstream primer 1 μL; Downstream primer 1 μL; 2×Taq Master Mix 5 μL; ddH2O 2 μL;

[0328] The universal primers for bacterial liquid PCR amplification are as follows:

[0329] pHT01-F: 5'-GATCGGTGCGGGCCTCTTCG-3'SEQ ID NO.25;

[0330] pHT01-R: 5'-CAACCATTTGTTCCAGGTAAGG-3'SEQ ID NO.26;

[0331] The bacterial solution PCR amplification procedure is as follows:

[0332] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 1 min 45 s, 30 cycles; extension at 72°C for 5 min; storage at 4°C;

[0333] After DNA agarose gel electrophoresis, the preliminarily verified bacterial solution was sent to the company for further sequencing, which proved that the exogenous fragment P43-PhoD-MTSase-Ccdoc had been transferred into B. subtilis WB800N. Figure 6 As shown, the recombinant bacteria was named WB800N-PP-MTSase-Ccdoc.

[0334] Example 3

[0335] Construction of recombinant bacteria WB800N-PP-Ctdoc-MTHase

[0336] (1) Cloning the fusion enzyme Ctdoc-MTHase ​​gene fragment

[0337] Using the genome of B. subtilis WB800N as a template, primers were designed to amplify the gene fragment of the P43 promoter and the gene fragment of the PhoD signal peptide by PCR; Ctdoc-MTHase ​​synthesized by Shanghai Biotechnology Company was used.

[0338] The bacterial solution was used as a template, and primers were designed to PCR amplify the Ctdoc-MTHase ​​gene fragment. The gel electrophoresis diagram is shown in Figure 5 As shown;

[0339] The PCR primers for the P43 promoter gene sequence are as follows:

[0340] P43-F: 5'-AGTGAATTCGAGCTCAGCTTCG-3'SEQ ID NO.5;

[0341] P43-R:5'-GTCGTATGCCATAAGCTTCTGTTATTAATT-3'SEQ ID NO.6

[0342] The PCR reaction system is as follows:

[0343] 1 μl of 10 μmol / L upstream primer P43-F, 1 μl of 10 μmol / L downstream primer P43-R, 1 μl of gene template B. subtilis WB800N, 25 μl of 2×Phanta Max Master Mix, supplemented with ddH2O to 50 μl;

[0344] The above PCR reaction was carried out according to the following procedure:

[0345] Pre-denaturation at 95℃ for 3min; denaturation at 95℃ for 15sec, annealing at 55℃ for 15sec, extension at 72℃ for 30sec / kb, 30 cycles; final extension at 72℃ for 5min; storage at 4℃.

[0346] The PCR primers for the gene sequence of the PhoD signal peptide are as follows:

[0347] PhoD-F: 5'-ACAGAAGCTTATGGCATACGACA-3'SEQ ID NO.7;

[0348] PhoD-Hase-R:

[0349] 5'-CATTAACATCGCCATACATTACTTCAAAGGCCCCAACC-3'SEQ ID NO.16;

[0350] The PCR reaction system is as follows:

[0351] 1 μl of 10 μmol / L upstream primer PhoD-F, 1 μl of 10 μmol / L downstream primer PhoD-Hase-R, 1 μl of gene template B. subtilis WB800N, 25 μl of 2×Phanta Max Master Mix, supplemented with ddH2O to 50 μl;

[0352] The above PCR reaction was carried out according to the following procedure:

[0353] Pre-denaturation at 95℃ for 3min; denaturation at 95℃ for 15sec, annealing at 55℃ for 15sec, extension at 72℃ for 30sec / kb, 30 cycles; final extension at 72℃ for 5min; storage at 4℃.

[0354] The nucleotide sequence of the fusion enzyme Ctdoc-MTHase ​​gene fragment is shown in SEQ ID NO.3;

[0355] The PCR primers of the fusion enzyme Ctdoc-MTHase ​​gene sequence are as follows:

[0356] Ctdoc-F: 5'-GGGGCCTTTGAAGTAATGTATGGCGATGTTAAT-3'SEQ ID NO.17;

[0357] Ctdoc-R:

[0358] 5'-TTTGTGCTCGGTGTGCCCGGAACTTTATACGTATTTTTATACGGCAGTGT-3'SEQ ID NO.18;

[0359] The PCR reaction system is as follows:

[0360] 1 μl of 10 μmol / L upstream primer Ctdoc-F, 1 μl of 10 μmol / L downstream primer Ctdoc-R, 1 μl of gene template Ctdoc-MTHase, 25 μl of 2×Phanta Max Master Mix, add ddH2O to 50 μl;

[0361] The above PCR reaction was carried out according to the following procedure:

[0362] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 60°C for 15 sec, extension at 72°C for 30 sec / kb, 30 cycles; final extension at 72°C for 5 min; storage at 4°C;

[0363] Hase-F:

[0364] 5'-TTCCGGGCACACCGAGCACAAAACTGTTTTCGTTCGGTGGAAATATTG-3'SEQ ID NO.19;

[0365] Hase-R:

[0366] 5'-TCGACTCTAGAGGATCCTTAATGATGATGTGTGATGATGTTCTAATTGATATACC-3'SEQ IDNO.20;

[0367] The PCR reaction system is as follows:

[0368] 1 μl of 10 μmol / L upstream primer Hase-F, 1 μl of 10 μmol / L downstream primer Hase-R, 1 μl of gene template Ctdoc-MTHase, 25 μl of 2×Phanta Max Master Mix, add ddH2O to 50 μl;

[0369] The above PCR reaction was carried out according to the following procedure:

[0370] Pre-denaturation at 95℃ for 3min; denaturation at 95℃ for 15sec, annealing at 60℃ for 15sec, extension at 72℃ for 30sec / kb, 30 cycles; final extension at 72℃ for 5min; storage at 4℃.

[0371] After PCR, the fragment length was analyzed by 1% agarose gel electrophoresis, the target band was cut out according to the fragment size, and the cut gel was recovered using Shanghai Biotech Gel Recovery Kit.

[0372] (2) The free plasmid pHT01 was double-digested with Sca I and BamH I

[0373] The pHT01 plasmid digestion system is:

[0374] Free plasmid pHT01 2μl, restriction endonuclease SacⅠ20μl, restriction endonuclease BamHI20μl, 10*Buffer5μl, add water to 50μl. Terminate the reaction in 37℃ water bath for 1-3h, 70℃ water bath for 10min, and detect the product by 1% agarose gel electrophoresis, and recover it using DNA gel recovery kit.

[0375] The following fragments were constructed and connected using the ClonExpress multi-fragment one-step cloning kit. The seamless cloning and connection system is:

[0376] pHT01 plasmid 128.4ng; P43 9.6ng; PhoD 3.3ng; Ctdoc-MTHase ​​38.4ng; Exnase 2μL; 5×CE buffer 4μL; ddH2O is added to make up to 20μL.

[0377] Reaction conditions: metal bath at 37°C for 30 min.

[0378] The seamless cloning product was transformed into E. coli DH5α competent cells to verify the agarose gel electrophoresis of Ctdoc-MTHase. Figure 5 shown.

[0379] (3) Preparation of B. subtilis WB800N electroporation competent cells

[0380] The method for preparing the competent cells is as follows, which is the same as in Example 1.

[0381] (4) Transform the recombinant plasmid P43-PhoD-Ctdoc-MTHase ​​into B. subtilis WB800N

[0382] Place the stored B.subtilis WB800N competent cells in a 40℃ water bath to recover for 2 minutes, add 10μL of the recombinant plasmid pHT01-P43-PhoD-Ctdoc-MTHase ​​in a sterile environment, flick the tube wall to mix, incubate on ice for 5 minutes, add to the pre-cooled electroporation cup, and perform electroporation at 2500V and 5ms. After the electroporation is completed, immediately add 1mL of 37℃ preheated RM medium to the electroporation cup, and then incubate at 37℃ for 90 minutes at a constant temperature of 200r / min on a shaker; centrifuge the bacterial solution at 5000rpm for 10 minutes, pour out part of the supernatant, and spread the remaining resuspended bacteria on a solid LB plate containing a final concentration of 30μg / mL chloramphenicol for screening and culture, and incubate overnight at 37℃ incubator for 12-16h;

[0383] The RM medium composition is LB+0.5M sorbitol+0.38M mannitol;

[0384] (5) Identification of positive recombinant bacteria WB800N

[0385] After 5-10 overnight cultured B. subtilis single colonies were selected for expansion, the obtained bacterial solution was used as a template, and PCR verification of B. subtilis transformants was performed using universal sequencing primers pHT01-F / R.

[0386] The verification bacterial solution PCR amplification system is 10 μL:

[0387] Template 1 μL; Upstream primer 1 μL; Downstream primer 1 μL; 2×Taq Master Mix 5 μL; ddH2O 2 μL;

[0388] The universal primers for bacterial liquid PCR amplification are as follows:

[0389] pHT01-F: 5'-GATCGGTGCGGGCCTCTTCG-3'SEQ ID NO.25;

[0390] pHT01-R: 5'-CAACCATTTGTTCCAGGTAAGG-3'SEQ ID NO.26;

[0391] The bacterial solution PCR amplification procedure is as follows:

[0392] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 1 min 45 s, 30 cycles; extension at 72°C for 5 min; storage at 4°C;

[0393] After DNA agarose gel electrophoresis, the preliminarily verified bacterial solution was sent to the company for further sequencing, which proved that the exogenous fragment P43-PhoD-Ctdoc-MTHase ​​had been transferred into B. subtilis WB800N. Figure 6 As shown, the recombinant bacteria was named WB800N-PP-Ctdoc-MTHase.

[0394] Example 4

[0395] Construction of recombinant bacteria WB800N-PP-CGTase-Rfdoc

[0396] (1) Cloning of the fusion enzyme CGTase-Rfdoc gene fragment

[0397] Using the recombinant plasmid pHT01-P43-PhoD-Ctdoc-MTHase ​​obtained in Example 3 as a template, primers were designed for reverse PCR amplification of the pHT01-P43-PhoD gene fragment; using the CGTase-Rfdoc bacterial solution synthesized by Shanghai Shenggong Company as a template, primers were designed for PCR amplification of the CGTase-Rfdoc gene fragment. The gel electrophoresis diagram is shown in FIG. Figure 5 As shown;

[0398] The reverse PCR primers of the pHT01-P43-PhoD gene sequence are as follows:

[0399] pHT01-PP-F:

[0400] 5'-CATCATCATCACCATCATTAAGGATCCTCTAGAGTCGACGT-3'SEQ ID NO.21;

[0401] pHT01-PP-R:

[0402] 5'-CGCCGGATCCCATTACTTCAAAGGCCCCAACCGACTGGGCAA-3'SEQ ID NO.22;

[0403] The PCR reaction system is as follows:

[0404] 1 μl of 10 μmol / L upstream primer pHT01-PP-F, 1 μl of 10 μmol / L downstream primer pHT01-PP-R, 1 μl of gene template WB800N-PP-Ctdoc-MTHase, 2×Phanta Max Master Mix 25 μl, add ddH2O to 50 μl;

[0405] The above PCR reaction was carried out according to the following procedure:

[0406] Pre-denaturation at 95℃ for 3min; denaturation at 95℃ for 15sec, annealing at 60℃ for 15sec, extension at 72℃ for 30sec / kb, 30 cycles; final extension at 72℃ for 5min; storage at 4℃.

[0407] The nucleotide sequence of the fusion enzyme CGTase-Rfdoc gene fragment is shown in SEQ ID NO.4;

[0408] The PCR primers of the fusion enzyme CGTase-Rfdoc gene sequence are as follows:

[0409] CGTase-Rfdoc-F:

[0410] 5'-GGGGCCTTTGAAGTAatgATGAATGATCTGAATGATTTTCTG-3'SEQ ID NO.23;

[0411] CGTase-Rfdoc-R:

[0412] 5'-GGTGGTGCTCGAGCTGCGGCAGGGTTAT-3'SEQ ID NO.24;

[0413] The PCR reaction system is as follows:

[0414] 10μmol / L upstream primer CGTase-Rfdoc-F 1μl, 10μmol / L downstream primer CGTase-Rfdoc-R 1μl, gene template CGTase-Rfdoc 1μl, 2×Phanta Max Master Mix 25μl, add ddH2O to 50μl;

[0415] The above PCR reaction was carried out according to the following procedure:

[0416] Pre-denaturation at 95℃ for 3min; denaturation at 95℃ for 15sec, annealing at 62℃ for 15sec, extension at 72℃ for 30sec / kb, 30 cycles; final extension at 72℃ for 5min; storage at 4℃.

[0417] After PCR, the fragment length was analyzed by 1% agarose gel electrophoresis, the target band was cut out according to the fragment size, and the cut gel was recovered using Shanghai Biotech Gel Recovery Kit.

[0418] (2) Single fragment seamless cloning connection vector and fusion enzyme

[0419] The following fragments were constructed and connected using the ClonExpress single-fragment one-step cloning kit. The seamless cloning and connection system is:

[0420] pHT01-P43-PhoD plasmid 180.5ng; CGTase-Rfdoc 60.8ng; Exnase 2μL; 5×CE buffer 4μL; ddH2O to make up to 20μL.

[0421] Reaction conditions: metal bath at 37°C for 30 min.

[0422] The seamless cloning product was transformed into E. coli DH5α competent cells, and the agarose gel electrophoresis diagram of CGTase-Rfdoc was verified as shown in Figure 5 shown.

[0423] (3) Preparation of B. subtilis WB800N electroporation competent cells

[0424] The method for preparing the competent cells is as follows, which is the same as in Example 1.

[0425] (4) Transform the recombinant plasmid P43-PhoD-CGTase-Rfdoc into B. subtilis WB800N

[0426] Place the stored B.subtilis WB800N competent cells in a 40℃ water bath to recover for 2 minutes, add 10μL of the recombinant plasmid pHT01-P43-PhoD-CGTase-Rfdoc in a sterile environment, flick the tube wall to mix, incubate on ice for 5 minutes, add to the pre-cooled electroporation cup, and perform electroporation at 2500V and 5ms. After the electroporation is completed, immediately add 1mL of 37℃ preheated RM medium to the electroporation cup, and then incubate at 37℃ for 90 minutes on a shaker at 200r / min; centrifuge the bacterial solution at 5000rpm for 10 minutes, pour out part of the supernatant, and spread the remaining resuspended bacteria on a LB solid plate containing a final concentration of 30μg / mL chloramphenicol for screening and culture, and incubate overnight at 37℃ incubator for 12-16h;

[0427] The RM medium composition is LB+0.5M sorbitol+0.38M mannitol;

[0428] (5) Identification of positive recombinant bacteria WB800N

[0429] After 5-10 overnight cultured B. subtilis single colonies were selected for expansion, the obtained bacterial solution was used as a template, and PCR verification of B. subtilis transformants was performed using universal sequencing primers pHT01-F / R.

[0430] The verification bacterial solution PCR amplification system is 10 μL:

[0431] Template 1 μL; Upstream primer 1 μL; Downstream primer 1 μL; 2×Taq Master Mix 5 μL; ddH2O 2 μL;

[0432] The universal primers for bacterial liquid PCR amplification are as follows:

[0433] pHT01-F: 5'-GATCGGTGCGGGCCTCTTCG-3'SEQ ID NO.25;

[0434] pHT01-R: 5'-CAACCATTTGTTCCAGGTAAGG-3'SEQ ID NO.26;

[0435] The bacterial solution PCR amplification procedure is as follows:

[0436] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 1 min 45 s, 30 cycles; extension at 72°C for 5 min; storage at 4°C;

[0437] After DNA agarose gel electrophoresis, the preliminarily verified bacterial solution was sent to the company for further sequencing, which proved that the exogenous fragment P43-PhoD-CGTase-Rfdoc had been transferred into B. subtilis WB800N. Figure 6 As shown, the recombinant bacteria was named WB800N-PP-CGTase-Rfdoc.

[0438] Example 5

[0439] Fermentation expression, purification, desalting and concentration of scaffold protein and fusion enzyme

[0440] (1) Fermentation expression of positive recombinant bacteria WB800N-PP-ScafCCR, WB800N-PP-MTSase-Ccdoc, WB800N-PP-Ctdoc-MTHase, and WB800N-PP-CGTase-Rfdoc

[0441] ① The recombinant bacterial scaffold protein WB800N-PP-ScafCCR and fusion enzymes WB800N-PP-MTSase-Ccdoc, WB800N-PP-Ctdoc-MTHase, and WB800N-PP-CGTase-Rfdoc constructed in Example 1-4 were inoculated into LB solid culture medium and cultured at 37°C for 12h;

[0442] ② Inoculate the single colony cultured overnight in step ① into LB liquid culture medium, and culture in a constant temperature shaker at 37°C and 200 r / min for 12 h to prepare the initial seed solution;

[0443] ③ The seed solution prepared in step ② was transferred to TB fermentation medium at a ratio of 1% by volume, and cultured in a constant temperature shaker at 37° C. and 200 r / min for 10 h to obtain seed solution;

[0444] ④ Transfer the inoculated seed solution prepared in step ③ into 50L TB fermentation medium at a volume percentage of 10%, and ferment at a speed of 500rpm and a temperature of 37°C for 48h;

[0445] ⑤ Using an ultrasonic disruptor to disrupt the cells of the fermentation broth to obtain a cell disrupted liquid as a crude enzyme solution;

[0446] ⑥ Analyze and detect the crude enzyme solution using the Western Blot method;

[0447] The culture medium formula is:

[0448] LB liquid medium: tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, NaOH adjusted to pH 7.0;

[0449] LB solid medium is based on liquid medium with 20g / L agar powder added;

[0450] TB fermentation medium: tryptone 12g / L, yeast extract powder 24g / L, KH2PO4 2.4g / L, K2HPO4 16.5g / L, glycerol 4ml / L;

[0451] The ultrasonic disruption procedure is as follows:

[0452] The fermentation liquid was centrifuged to obtain the bacterial cells, which were resuspended in 10 mM PBS buffer and then crushed by an ultrasonic crusher. The working procedure was 400 W and the amplitude was Φ6. The working principle of 4 seconds of crushing and 6 seconds of rest for a total of 20 minutes was followed, and the whole process was operated on ice. The crushed liquid was centrifuged at 12000 rpm for 30 minutes in a centrifuge precooled at 4°C, and the collected supernatant was the crude enzyme solution.

[0453] The Western Blot method is:

[0454] SDS-PAGE gel electrophoresis, then remove the protein gel and place it in a "sandwich" structure in the transfer solution environment, set 400mA, and wet transfer to the PVDF membrane on ice for 2h; the imprinted PVDF membrane is placed in the blocking solution for 1h. After rinsing, the membrane is placed in the primary antibody dilution solution and incubated overnight at 4℃; the membrane is washed with TBST at 120rpm for 5min, 3 times in a row, and then the secondary antibody dilution solution is completely covered with the membrane. After shaking at 45rpm for 1h, it is washed with TBST at 120rpm for 10min, 3 times in a row, and the transfer results of the membrane are scanned with a gel imager, such as Figure 7 ;

[0455] The transfer solution is 39 mM glycine, 48 mM Tris, 0.037% SDS, and 20% methanol;

[0456] The "sandwich" structure is that the order from the negative electrode to the positive electrode of the transfer plate is sponge, filter paper, protein glue, PVDF membrane soaked in methanol for 1s, filter paper and sponge;

[0457] The blocking solution is a mixture of 5% skim milk powder and TBST, wherein TBST is prepared as follows: 10 mM Tris-HCl, 0.1% Tween20, 150 mM NaCl;

[0458] The primary antibody diluent is Anti-GFP antibody: primary antibody diluent = 1:3000;

[0459] The secondary antibody diluent is HRP-goat anti-mouse-IgG (HL): blocking solution = 1:5000

[0460] (2) Purification of crude enzyme solutions of positive recombinant bacteria WB800N-PP-ScafCCR, WB800N-PP-MTSase-Ccdoc, WB800N-PP-Ctdoc-MTHase, and WB800N-PP-CGTase-Rfdoc

[0461] The crude enzyme solution of each module was separated and purified using an AKTA protein purification chromatograph. Since the pHT01 plasmid carried a 6×His tag when the strain was constructed, the His tag was used to purify the enzyme solution. 2+ Column Binding Purification:

[0462] The AKTA protein purification process is as follows:

[0463] After connecting the computer to the AKTA instrument, clean the pipelines, place the A and B pipelines in distilled water and run the entire instrument to clean 10 times the column volume, then insert the A and B tubes below the liquid level of the binding buffer and elution buffer respectively to balance the column, and then add 1mL of pre-loaded Ni 2+ The column is connected to the instrument, and the purification column is balanced with 5 column volumes of binding buffer; the sample is loaded, and the pretreated crude enzyme solution is controlled to enter the purification column from the injection port at a flow rate of 0.5-1mL / min; the binding buffer is flushed at a flow rate of 1-2mL / min for 10-15 column volumes, and it is ready when the baseline reaches a stable state or no medium flows out; the elution buffer is used for linear gradient elution, and the flow rate is maintained at 1-2mL / min. The purification effect is judged according to the peak situation and SDS-PAGE electrophoresis results to obtain pure enzyme, such as Figure 7 ;

[0464] The binding buffer and elution buffer formulas are as follows:

[0465] Binding buffer: 20 mM sodium phosphate, 0.5 M NaCl, 20 mM imidazole, adjust pH to 7.4, filter twice;

[0466] Elution buffer: 20 mM sodium phosphate, 0.5 M NaCl, 500 mM imidazole, adjust pH to 7.4, and filter twice;

[0467] 20mM sodium phosphate: Dissolve 3.12g NaH2PO4-2H2O and 2.84g Na2HPO4 in 1L water respectively, then mix according to the proportion and adjust the pH to 7.4;

[0468] 0.5M NaCl: 29.22g NaCl dissolved in 1L water;

[0469] 20mM imidazole: 1.36g imidazole dissolved in 1L water;

[0470] 500mM imidazole: 34.04g imidazole dissolved in 1L water;

[0471] (3) Desalting and concentration of pure enzymes of positive recombinant bacteria WB800N-PP-ScafCCR, WB800N-PP-MTSase-Ccdoc, WB800N-PP-Ctdoc-MTHase, and WB800N-PP-CGTase-Rfdoc

[0472] The pure enzyme solution obtained by purification in the above step (2) has high imidazole and salt ion components, which will affect the subsequent assembly research. Therefore, a desalting column is selected with an AKTA protein purification chromatograph to desalt the protein. The pure enzyme solution after desalting will be affected by dilution, so it is concentrated by an ultrafiltration tube;

[0473] The AKTA protein desalting process is as follows:

[0474] After flushing the pipeline with 20mM PBS buffer, insert tube A into the ultrasonic desalting buffer, control the flow rate at 1-2mL / min, load 2mL, and collect the pure enzyme solution after desalting according to the principle of salt baseline peak first;

[0475] The concentration process is as follows:

[0476] Balance the ultrafiltration tube; put 2mL of pure enzyme solution after desalting into an ultrafiltration tube with a molecular weight cutoff of 30kDa, centrifuge at 4℃, 4000rpm, centrifuge for 6min, repeat twice, and obtain 400-500μL of ultrafiltration pure enzyme solution; if the obtained enzyme solution is not used in time, it can be stored in 40% sterile glycerol at -20℃;

[0477] Example 6

[0478] In vitro assembly of scaffolding proteins and fusion enzymes to form a trehalose multienzyme complex

[0479] The protein concentration of the scaffold protein pure enzyme solution ScafCCR and the fusion enzyme pure enzyme solutions MTSase-Ccdoc, Ctdoc-MTHase ​​and CGTase-Rfdoc after purification, desalting and concentration in Example 5 was determined using a BCA protein concentration determination kit to determine the amount to be added during assembly. The three protein samples were mixed in equal moles with a buffer solution (10 mM PBS buffer, 10 mM CaCl2, pH = 7.4) to a final volume of 10 mL. The final concentrations of the three proteins were all 20 umol / L. The samples were reacted in a constant temperature water bath at 37°C for 2 h to assemble and form a trehalose multienzyme complex.

[0480] Example 7

[0481] Preparation of cellulose microspheres

[0482] 1-Butyl 3-methylimidazolium chloride (BmimCl) is a strong solvent that can directly dissolve cellulose without activation. Under the action of heating, the solubility can reach 25%, and there is little degradation during the action process and no obvious chemical reaction;

[0483] The preparation method of the cellulose microspheres is as follows:

[0484] (1) A mixture of microcrystalline cellulose, chitosan, and polyethylene glycol in a mass ratio of 7:2:1 was dissolved in 1-butyl 3-methylimidazolium chloride (BmimCl) and stirred to prepare a paste-like mucus with a final mass concentration of 5%;

[0485] (2) stirring the paste-like mucus in step (1) in a water bath at 80° C. at 90 rpm until it is completely dissolved and reaches a transparent and clear paste-like liquid state;

[0486] (3) using anhydrous ethanol as a coagulation bath, the microspheres were prepared by extrusion, and then rinsed in deionized water for three times to obtain wet fiber microspheres. The cellulose microspheres were named CMS-1 and stored in a 20% ethanol solution;

[0487] (4) washing with sterile water and then vacuum freeze-drying for recovery, the vacuum freeze-drying conditions being a cold trap temperature of -54°C and a vacuum degree of 8 Pa;

[0488] like Figure 8 The SEM images of the immobilized carrier in normal state and after freeze-drying are shown. Figure 8 a is the prepared cellulose microspheres, which are in the shape of microspheres under normal conditions, are smooth and transparent, and have a diameter of about 2-3 mm, and are stored in 20% anhydrous ethanol; Figure 8 b is the overall morphology of cellulose microspheres under a scanning electron microscope. In the SEM image, the overall state of the microspheres after freeze-drying and the wrinkled state on the surface of the microspheres can be observed. In addition to the undulating wrinkles, there are also tiny micropores. These features can increase friction, enhance the contact area with the enzyme, and better achieve the fixation of the trehalose multi-enzyme complex.

[0489] Example 8

[0490] Immobilization of Trehalose Multienzyme Complex on Cellulose Microspheres

[0491] The immobilization rate was calculated, and the immobilization steps were as follows:

[0492] (1) Take 10 g of the cellulose microspheres stored in the 20% ethanol solution of Example 7 and rinse them twice in deionized water;

[0493] (2) 2 mL of the trehalose multi-enzyme complex assembled in Example 6 was taken and reacted with an equal amount of cellulose microspheres in a constant temperature water bath at 25° C. for 2 h, so that the CBM module in the trehalose dual-enzyme complex was more completely adsorbed into the microspheres;

[0494] (3) In order to consolidate the adsorption effect and prevent the multi-enzyme complex from falling off during the subsequent catalytic process, glutaraldehyde was used for cross-linking. 1% glutaraldehyde was added to the fixed microspheres. After cross-linking at 25°C for 1 h, the microspheres were rinsed three times with PBS buffer to remove excess cross-linking agent and unadsorbed residual proteins. The immobilized microspheres of trehalose multi-enzyme complex were stored at 4°C, freeze-dried, and characterized by scanning electron microscopy (SEM);

[0495] Fig. 9 This is the surface state of the microspheres after enzyme fixation. The binding effect between the agglomerated protein and the carrier can be clearly observed. Due to adsorption, the assembled trehalose multienzyme complex is bound to the surface micropores of the fiber microspheres. The folds will increase the adsorption of the protein, showing a large number of aggregates. This also greatly shows the possibility of immobilization of the trehalose multienzyme complex.

[0496] The immobilization rate is calculated based on the change in protein concentration after the trehalose-enzyme complex is immobilized. The enzyme activity of the trehalose-enzyme complex immobilized on the microspheres is defined as the content of the immobilized microspheres;

[0497] The immobilization rate:

[0498] A represents the protein amount of the multienzyme complex before fixation (g); B represents the protein amount of the multienzyme complex after fixation (g)

[0499] Example 9

[0500] Optimization of the immobilization of trehalose multienzyme complex

[0501] The optimal immobilization conditions were determined by exploring the effects of temperature, pH, time and calcium ion concentration on the immobilization of the trehalose multienzyme complex in Example 8:

[0502] (1) Effect of temperature on the immobilization of trehalose multienzyme complex:

[0503] 2 mL of trehalose multienzyme complex was mixed with an equal amount of fiber microspheres, and the temperature was controlled at 15, 25, 30, 37, and 60°C to complete the immobilization of the trehalose multienzyme complex, wherein the pH was kept at 6.0, and the action time was 2 hours. The amount of residual protein after immobilization was measured, and the effect of different temperatures on immobilization was analyzed;

[0504] (2) Effect of pH on the immobilization of trehalose multienzyme complex:

[0505] Under the above-mentioned optimal immobilization temperature of 30°C, 2 mL of trehalose multienzyme complex was mixed with an equal amount of fiber microspheres, and placed in an environment of pH 3.0, 4.0, 5.0, 6.0, 7.4, and 9.0 for 1 hour, and the amount of residual protein was measured to analyze the effect of different pH on immobilization;

[0506] (3) Effect of calcium ion concentration on the immobilization of trehalose multienzyme complex

[0507] Under the above-mentioned optimal immobilization temperature and optimal pH conditions, 2 mL of trehalose multienzyme complex was mixed with an equal amount of fiber microspheres and placed in an environment with calcium ion concentrations of 1, 5, 10, 20, 50, and 100 mmol / L, respectively. The amount of residual protein was measured after 2 hours to analyze the effect of different calcium ion concentrations on immobilization.

[0508] (4) Effect of action time on the immobilization of trehalose multienzyme complex:

[0509] Under the above-mentioned optimal immobilization temperature, optimal pH, and optimal calcium ion concentration, the immobilization rates of the trehalose multienzyme complex were measured when the immobilization time was 5 min, 10 min, 20 min, 40 min, 1 h, and 2 h, respectively, and the effect of the action time was analyzed;

[0510] Example 10

[0511] The immobilized catalytic preparation of trehalose by the trehalose multienzyme complex was achieved under the optimal immobilization conditions, specifically:

[0512] The preparation of cellulose microsphere immobilized trehalose multienzyme complex was different from that in Example 8 in that the pH value was 7.4, the temperature was 30°C, the calcium ion concentration was 10 mmol / L, and the adsorption time was 40 min. The other conditions were the same, and the cellulose microsphere immobilized trehalose multienzyme complex (immobilized microsphere) was obtained.

[0513] The trehalose multienzyme complex was immobilized by cellulose microspheres, and maltodextrin with a concentration of 200 g / L was used as the substrate. The reaction was carried out at 60°C for 50 h, and the trehalose production of the immobilized trehalose multienzyme complex was monitored by HPLC.

[0514] Recycling of immobilized trehalose-enzyme complex

[0515] The unit enzyme activity per gram of fiber microspheres was roughly measured. 10 and 100 microspheres were added to 10 mL of multi-enzyme complex for adsorption and fixation, respectively. The immobilized enzyme activity and the dry weight of two groups of blank microspheres were measured twice to roughly obtain the enzyme activity per gram of microspheres fixed.

[0516] The enzyme activity is defined as the amount of enzyme required to convert 1 μmol of maltodextrin per minute at 60°C and pH 6.0 per gram of microspheres as one unit of enzyme activity (U);

[0517] The prepared immobilized trehalose multienzyme complex was used in the trehalose conversion experiment. Maltodextrin (200·g, DE value 8.8) was used as the substrate, and 150·U / g (1g substrate requires 150U of enzyme for catalysis) of immobilized fiber microspheres were used for conversion at 60℃ and pH 6.0 for 50h. The immobilized fiber microspheres were recovered by filtration.

[0518] During the repeated use and conversion process, the production of trehalose each time was measured by high performance liquid chromatography (HPLC), and the conversion rate was used to determine the number of times the immobilized fiber microspheres were used. The results are as follows Fig.15 shown.

[0519] Comparative Example 1

[0520] (1) A mixture of microcrystalline cellulose, chitosan, and polyethylene glycol in a mass ratio of 6:2:2 is dissolved in 1-butyl 3-methylimidazolium chloride (BmimCl) and stirred to prepare a paste-like mucus with a final mass concentration of 5%;

[0521] (2) the viscous paste obtained in step (1) is slowly stirred at a constant speed of 90 rpm in a water bath at 80° C. until the paste is completely dissolved and becomes a transparent and clear paste-like liquid;

[0522] (3) Using anhydrous ethanol as a coagulation bath, the microspheres were prepared by extrusion, and then rinsed in deionized water for three times to obtain wet fiber microspheres. The cellulose microspheres were named CMS-2.

[0523] Comparative Example 2

[0524] (1) A mixture of microcrystalline cellulose, chitosan, and polyethylene glycol in a mass ratio of 6:3:1 was dissolved in 1-butyl 3-methylimidazolium chloride (BmimCl) and stirred to prepare a paste-like mucus with a final mass concentration of 5%;

[0525] (2) the viscous paste obtained in step (1) is slowly stirred at a constant speed of 90 rpm in a water bath at 80° C. until the paste is completely dissolved and becomes a transparent and clear paste-like liquid;

[0526] (3) Using anhydrous ethanol as a coagulation bath, the microspheres were prepared by extrusion, and then rinsed in deionized water for three times to obtain wet fiber microspheres. The cellulose microspheres were named CMS-3.

[0527] Effect Example 1

[0528] The cellulose microspheres prepared in Example 7, Comparative Examples 1 and 2 were used to immobilize the trehalose multienzyme complex, and the difference in their immobilization rates was compared. Fig.10 As shown, under the same conditions, the immobilization rate of CMS-1 was 67.2%, and the immobilization rates of CMS-2 and CMS-3 were 52.3% and 54.9%, respectively.

[0529] Effect Example 2

[0530] Example 9 Effect of Temperature on the Immobilization of Trehalose Multienzyme Complex Fig.11 At 15-25℃, the immobilization rate increases with the temperature. When it reaches 25℃, the immobilization rate is 64.7%, which is somewhat different from the immobilization rate of 67.7% at the optimal temperature of 30℃. However, when the immobilization temperature exceeds 30℃, the immobilization effect tends to decrease. At 60℃, the immobilization rate is only 29.5%;

[0531] Effect Example 3

[0532] Example 9 Effect of pH on the immobilization of trehalose multienzyme complex Fig.12 The immobilization results at pH = 3.0, 4.0, 5.0, 6.0, 7.4 and 9.0 are shown in the figure. The best immobilization pH is 7.4, and the immobilization rate is about 76.5%. If the pH is at 3.0, 4.0 and 9.0, the effect of CBM adsorption fiber microspheres will become worse, and the immobilization rate is below 50%, which shows that the over-acidic or over-alkaline environment affects the adsorption and binding effect. Only when the pH is in a neutral environment, the immobilization rate can be maintained above 60%;

[0533] Effect Example 4

[0534] Example 9 Effect of calcium ion concentration on the immobilization of trehalose multienzyme complex Fig.13 The immobilization rate was 1, 5, 10, 20, 50, and 100 mmol / L. With the increase of calcium ion concentration, the immobilization rate gradually increased. When the calcium ion concentration reached 10 mmol / L, the immobilization rate remained unchanged at more than 80%. This shows that the appropriate calcium ion concentration will increase the adsorption rate of CBM, so the optimal calcium ion concentration is 10 mmol / L.

[0535] Effect Example 5

[0536] Example 9 Effect of the action time on the immobilization of trehalose multienzyme complex Fig.14As shown in the figure, with the extension of the action time, the immobilization effect gradually increases. When it reaches 40 minutes, the immobilization rate reaches 82.4%. After the action time exceeds 40 minutes, the immobilization rate tends to be balanced. At 1 hour, the immobilization rate is 81.7%, and at 2 hours, the immobilization rate is 81.6%. Therefore, the optimal immobilization action time is 40 minutes.

[0537] Effect Example 6

[0538] The immobilized trehalose multienzyme complex prepared in Example 10 was used in a trehalose conversion experiment. After the catalysis was completed, the immobilized trehalose multienzyme complex was recovered by filtration and used in a new trehalose conversion experiment. The production of trehalose each time was determined by high performance liquid chromatography (HPLC). The conversion rate was used to determine the number of times the immobilized fiber microspheres were used. The comparison of the conversion rates is shown in Analysis Table 1.

[0539] The method for detecting the trehalose content in the reaction solution is as follows:

[0540] The concentration of trehalose generated in the reaction solution (saccharification solution) was determined by high performance liquid chromatography. An amino column was used in the determination process. The column temperature was 40°C. The mobile phase was a mixed solution of acetonitrile and water with a volume ratio of 3:1. The flow rate was 1 mL / min. The detector was a differential detector. The detection time was 20 min.

[0541] Table 1

[0542]

[0543]

[0544] Results Analysis

[0545] The cellulose microspheres prepared by the present invention have a higher immobilization rate for immobilizing trehalose multienzyme complexes, and the immobilized trehalose multienzyme complexes prepared by the present invention are used for catalytic preparation of trehalose. Using maltodextrin (200 g / L, DE value of 8.8) as a substrate, taking 150 U / g of immobilized fiber microspheres, and converting for 50 hours under the condition of pH 6.0, the conversion rate of the first round of trehalose can reach 78.8%. With the increase of the cycle, the conversion rate shows a steady downward trend. The first 5 uses can maintain a conversion rate of more than 60%. When used for the 8th time, the conversion rate drops to 40.6%. The decrease in conversion rate may be caused by the continuous rotation and continuous high temperature during the catalytic process, which causes the cellulose carrier to undergo autonomous degradation; the immobilized trehalose multienzyme complex provided by the present invention not only improves the conversion rate of trehalose but also can be recycled for multiple times, greatly improving the utilization rate of the enzyme and reducing production costs.

Claims

1. A method for preparing trehalose by immobilizing trehalose multienzyme complex by cellulose microspheres, characterized in that: The steps include: Step 1: Construction of the recombinant scaffold protein WB800N-PP-ScafCCR strain, including the following steps: a Using the genome of B. subtilis WB800N as a template, primers were designed to amplify the gene fragment of P43 promoter and the gene fragment of PhoD signal peptide by PCR; b Using the biosynthesized ScafCCR bacterial solution as a template, primers were designed to PCR amplify Rfcoh-Ctcoh-CBM-Cccoh, and the Rfcoh-Ctcoh-CBM-Cccoh gene fragment was called the scaffolding protein ScafCCR gene fragment; The ScafCCR bacterial solution is composed of the gene sequences of Ruminococcus flavefaciens, Clostridium Thermocellum, Clostridium cellulolyticum adhesion proteins Rfcoh, Ctcoh and Cccoh and cellulose binding domain CBM connected to the PUC57 plasmid; The nucleotide sequence of the scaffold protein ScafCCR gene fragment is shown in SEQ ID NO.1; c. Double digestion of the free plasmid pHT01 with restriction endonucleases SacⅠ and BamHI; d. Using multi-fragment seamless cloning, the P43 promoter gene fragment and the PhoD signal peptide gene fragment obtained in step a and the ScafCCR gene fragment obtained in step b were connected to the linearized pHT01 plasmid obtained in step c after the concentration was determined by MD2000H, and transformed into Escherichia coli DH5α competent cells. After verification, the pHT01-P43-PhoD-ScafCCR recombinant plasmid was obtained; e. The recombinant plasmid pHT01-P43-PhoD-ScafCCR prepared in step d was transformed into B. subtilis WB800N bacteria, and the recombinant B. subtilis WB800N / pHT01-P43-PhoD-ScafCCR was obtained by verification, and the recombinant bacteria was named WB800N-PP-ScafCCR; Step 2: Construction of the recombinant fusion enzyme WB800N-PP-MTSase-Ccdoc strain, comprising the following steps: (1) Using the B. subtilis WB800N genome as a template, primers were designed to amplify the gene fragment of the P43 promoter and the gene fragment of the PhoD signal peptide by PCR; (2) Using the genome of Sulfolobus acidocaldarius ATCC 33909 as a template, PCR amplified the maltooligosyltrehalose synthase MTSase gene fragment; (3) Using the biosynthesized Ccdoc bacterial solution as a template, primers were designed to perform PCR amplification of the docking protein Ccdoc gene fragment; The Ccdoc bacterial solution is composed of the Ccdoc gene sequence of the docking protein in Clostridium cellulolyticum connected to the PUC57 plasmid; (4) The free plasmid pHT01 was double-digested with restriction endonucleases SacⅠ and BamHI; (5) Using multi-fragment seamless cloning, the P43 promoter gene fragment and the PhoD signal peptide gene fragment obtained in step (1), the MTSase gene fragment obtained in step (2), and the Ccdoc gene fragment obtained in step (3) were connected to the linearized pHT01 plasmid obtained in step (4), and transformed into Escherichia coli DH5α competent cells. After verification, the pHT01-P43-PhoD-MTSase-Ccdoc recombinant plasmid was obtained; The nucleotide sequence of the fusion enzyme MTSase-Ccdoc gene fragment is shown in SEQ ID NO.2; (6) The recombinant plasmid pHT01-P43-PhoD-MTSase-Ccdoc prepared in step (5) was transformed into B. subtilis WB800N bacteria, and the recombinant B. subtilis WB800N / pHT01-P43-PhoD-MTSase-Ccdoc was obtained by verification, and the recombinant bacteria was named WB800N-PP-MTSase-Ccdoc; Step 3: Construction of the recombinant fusion enzyme WB800N-PP-Ctdoc-MTHase ​​strain, including the following steps: ① Using the B. subtilis WB800N genome as a template, primers were designed to amplify the gene fragments of the P43 promoter and the PhoD signal peptide by PCR; ②Using the biosynthesized Ctdoc bacterial solution as a template, primers were designed to PCR amplify the docking protein Ctdoc gene fragment; The Ctdoc bacterial solution is composed of a Clostridium thermocellum docking protein Ctdoc gene sequence connected to a PUC57 plasmid; ③Using the genome of Sulfolobus acidocaldarius ATCC 33909 as a template, PCR amplified the gene fragment of maltooligosaccharide-trehalose hydrolase MTHase; ④ Double digest the free plasmid pHT01 with restriction endonucleases SacⅠ and BamHI; ⑤Use multi-fragment seamless cloning to connect the P43 promoter gene fragment and the PhoD signal peptide gene fragment obtained in step ①, the Ctdoc gene fragment obtained in step ②, and the MTHase ​​gene fragment obtained in step ③ to the linearized pHT01 plasmid obtained in step ④, and transform them into Escherichia coli DH5α competent cells. After verification, the pHT01-P43-PhoD-Ctdoc-MTHase ​​recombinant plasmid is obtained; The nucleotide sequence of the fusion enzyme Ctdoc-MTHase ​​gene fragment is shown in SEQ ID NO.3; ⑥ The recombinant plasmid pHT01-P43-PhoD-Ctdoc-MTHase ​​prepared in step ⑤ was transformed into B. subtilis WB800N bacteria, and the recombinant B. subtilis WB800N / pHT01-P43-PhoD-Ctdoc-MTHase ​​was obtained after verification, and the recombinant bacteria was named WB800N-PP-Ctdoc-MTHase; Step 4: Construction of the recombinant fusion enzyme WB800N-PP-CGTase-Rfdoc strain, comprising the following steps: Ⅰ Using the recombinant plasmid pHT01-P43-PhoD-Ctdoc-MTHase ​​obtained in step ⑤ as a template, design primers for reverse PCR amplification of pHT01-P43-PhoD; Ⅱ Using the biosynthesized CGTase-Rfdoc bacterial solution as a template, primers were designed to amplify the fusion enzyme CGTase-Rfdoc gene fragment by PCR; The CGTase-Rfdoc bacterial solution is composed of the gene sequences of cyclodextrin glucosyltransferase CGTase in Bacillus ohbensis and docking protein Rfdoc in Ruminococcus flavefaciens connected to the PUC57 plasmid; The nucleotide sequence of the fusion enzyme CGTase-Rfdoc gene fragment is shown in SEQ ID NO.4; Ⅲ. Connect the pHT01-P43-PhoD gene fragment obtained in step Ⅰ with the fusion enzyme CGTase-Rfdoc gene fragment obtained in step Ⅱ by using single-fragment seamless cloning technology, and transform them into Escherichia coli DH5α competent cells. After successful verification, the pHT01-P43-PhoD-CGTase-Rfdoc plasmid can be obtained; IV. Transform the recombinant plasmid pHT01-P43-PhoD-CGTase-Rfdoc prepared in step III into B. subtilis WB800N bacteria, and obtain recombinant B. subtilis WB800N / pHT01-P43-PhoD-CGTase-Rfdoc after verification. The recombinant bacteria are named WB800N-PP-CGTase-Rfdoc; Step 5: A method for preparing cellulose microspheres, comprising the following steps: AQ: A mixture of microcrystalline cellulose, chitosan, and polyethylene glycol in a mass ratio of 7:2:1 was dissolved in 1-butyl 3-methylimidazole chloride, and a final concentration of 5% was prepared by stirring to form a paste-like mucus; B. Stir the paste-like mucus in step A at 85-95 rpm in a water bath at 75-85°C until it is completely dissolved and reaches a transparent and clear paste-like liquid state; C uses anhydrous ethanol as a coagulation bath and completes the preparation of microspheres by extrusion, and rinses them in deionized water for 1 to 3 times to obtain wet fiber microspheres, and the cellulose microspheres are named CMS-1; Step 6, immobilizing the trehalose multi-enzyme complex on cellulose microspheres, comprising the following steps: The above recombinant strains WB800n-PP-ScafCCR, WB800n-PP-MTSase-Ccdoc, WB800n-PP-Ctdoc-MTHase ​​and WB800n-PP-CGTase-Rfdoc were fermented separately, and then extracted and purified to prepare scaffold protein ScafCCR, fusion enzyme MTSase-Ccdoc, fusion enzyme Ctdoc-MTHase ​​and fusion enzyme CGTase-Rfdoc; The scaffolding protein ScafCCR, the fusion enzyme MTSase-Ccdoc, the fusion enzyme Ctdoc-MTHase ​​and the fusion enzyme CGTase-Rfdoc were mixed to prepare the trehalose multienzyme complex; The prepared trehalose multi-enzyme complex is mixed with the cellulose microspheres CMS-1 prepared in step 5, and cross-linked with glutaraldehyde to prepare immobilized trehalose multi-enzyme complex cellulose microspheres; Step 7, catalyzing the preparation of trehalose by the immobilized trehalose multi-enzyme complex cellulose microspheres prepared in step 6, comprising the following steps: Trehalose was prepared using maltodextrin as substrate and cellulose microspheres as catalyzer of immobilized trehalose multienzyme complex.

2. The method according to claim 1, characterized in that The nucleotide sequence of the PCR amplification primer of the gene fragment of promoter P43 in step a is as follows: P43-F: 5'-AGTGAATTCGAGCTCAGCTTCG-3'SEQ ID NO.5; P43-R: 5'-GTCGTATGCCATAAGCTTCTGTTATTAATT-3'SEQ ID NO.6; Preferably: the nucleotide sequence of the PCR amplification primer for the gene fragment of the signal peptide PhoD in step a is as follows: PhoD-F: 5'-ACAGAAGCTTATGGCATACGACA-3'SEQ ID NO.7; PhoD-Scaf-R: 5'-GGTTGGGGCCTTTGAAGTAATGACAACAACAGGCGG-3'SEQ ID NO.8; Preferably, the nucleotide sequence of the PCR amplification primers for the scaffold protein ScafCCR gene fragment composed of Rfcoh-Ctcoh-CBM-Cccoh in step b is as follows: Scaffold-F: 5'-GCCTTTGAAGTAATGACAACAACAGGCG-3'SEQ ID NO.9; Scaffold-R: 5'-AGAGGATCCTTAATGATGGTGATGATG-3'SEQ ID NO.10; Preferably, the PCR amplification system in step a or b is as follows: 1 μl of 10 μmol / L upstream primer, 1 μl of 10 μmol / L downstream primer, 1 μl of gene template, 2×Phanta Max MasterMix 25 μl, add ddH2O to 50 μl; The amplification procedure is as follows: Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 55°C for 15 sec, extension at 72°C for 30 sec / kb, 30 cycles; final extension at 72°C for 5 min; storage at 4°C; Preferably, the double enzyme digestion system in step c: Free plasmid pHT01 2μl, restriction endonuclease SacⅠ20μl, restriction endonuclease BamHI20μl, 10*Buffer5μl, add water to 50μl, 37℃ water bath for 1-3h, 70℃ water bath for 10min to stop the reaction, and then electrophoresis to detect the enzyme cutting effect; Preferably, the multi-fragment seamless cloning in step d adopts the ClonExpress multi-fragment one-step cloning kit; Preferably, the screening of the integration of pHT01-P43-PhoD-ScafCCR plasmid into B. subtilis WB800N strain in step d: The transformants were spread on LB solid medium containing 100ug / mL chloramphenicol resistance and cultured at 37°C for 12h. Single colonies were picked and inoculated into LB liquid medium containing 100ug / mL chloramphenicol resistance and cultured at 37°C for 12h. The obtained bacterial liquids were used as templates for PCR amplification verification, and the corresponding target bands were obtained by agarose gel electrophoresis, thus obtaining the integrated recombinant strain WB800N-PP-ScafCCR.

3. The method according to claim 1, characterized in that The nucleotide sequence of the PCR amplification primers for the gene fragment of promoter P43 in step (1) is as follows: P43-F: 5'-AGTGAATTCGAGCTCAGCTTCG-3'SEQ ID NO.5; P43-R: 5'-GTCGTATGCCATAAGCTTCTGTTATTAATT-3'SEQ ID NO.6; Preferably, the nucleotide sequence of the PCR amplification primer for the gene fragment of the signal peptide PhoD in step (1) is as follows: PhoD-F: 5'-ACAGAAGCTTATGGCATACGACA-3'SEQ ID NO.7; PhoD-Sase-R: 5'-GTAGGTTGCTGATATCACTTCAAAGGCCCCAAC-3'SEQ ID NO.11; Preferably, the nucleotide sequence of the PCR amplification primer for the maltooligosyltrehalose synthase MTSase gene fragment in step (2) is as follows: Sase-F: 5'-GGTTGGGGCCTTTGAAGTAGTGATATCAGCAACCTAC-3'SEQ ID NO.12; Sase-R: 5'-ATCGCCATTAACATCGCCCAGCAGTTTTTCCGGACCCTGGTCCGGCATTCTAACTAGTA TCCTA-3'SEQ ID NO.13; Preferably, the nucleotide sequence of the PCR amplification primer for the docking protein Ccdoc gene fragment in step (3) is as follows: Ccdoc-F: 5'-TACTAGTTAGAATGCCGGACCAGGGTCCGGAAAAACTGCTGGGCGATGTTAATGGCG ATGAAACAG-3'SEQ ID NO.14; Ccdoc-R: 5'-GACTCTAGAGGATCCTTAGTGGTGGTGGTGGTGGTGTTGAATGCTCAGCAGTGCTTTT TTC-3'SEQID NO.15; Preferably, the PCR amplification system in steps (1), (2) and (3) is as follows: 1 μl of 10 μmol / L upstream primer, 1 μl of 10 μmol / L downstream primer, 1 μl of gene template, 2×Phanta Max MasterMix 25 μl, add ddH2O to 50 μl; The amplification procedure is as follows: Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 55°C for 15 sec, extension at 72°C for 30 sec / kb, 30 cycles; final extension at 72°C for 5 min; storage at 4°C; Preferably, the double enzyme digestion system in step (4) is: Free plasmid pHT01 2μl, restriction endonuclease SacⅠ20μl, restriction endonuclease BamHI20μl, 10*Buffer5μl, add water to 50μl, 37℃ water bath for 1-3h, 70℃ water bath for 10min to stop the reaction, and then electrophoresis to detect the enzyme cutting effect; Preferably, the multi-fragment seamless cloning in step (5) adopts the ClonExpress multi-fragment one-step cloning kit; Preferably, in step (5), the pHT01-P43-PhoD-MTSase-Ccdoc plasmid is integrated into the screening of B. subtilis WB800N strain: The transformants were spread on LB solid medium containing 100ug / mL chloramphenicol resistance and cultured at 37°C for 12h. Single colonies were picked and inoculated into LB liquid medium containing 100ug / mL chloramphenicol resistance and cultured at 37°C for 12h. The obtained bacterial liquids were used as templates for PCR amplification verification, and the corresponding target bands were obtained by agarose gel electrophoresis, thus obtaining the integrated recombinant strain WB800N-PP-MTSase-Ccdoc.

4. The method according to claim 1, characterized in that The nucleotide sequence of the PCR amplification primers for the gene fragment of promoter P43 in step ① is as follows: P43-F: 5'-AGTGAATTCGAGCTCAGCTTCG-3'SEQ ID NO.5; P43-R: 5'-GTCGTATGCCATAAGCTTCTGTTATTAATT-3'SEQ ID NO.6; Preferably: the nucleotide sequence of the PCR amplification primer for the gene fragment of the signal peptide PhoD in step ① is as follows: PhoD-F: 5'-ACAGAAGCTTATGGCATACGACA-3'SEQ ID NO.7; PhoD-Hase-R: 5'-CATTAACATCGCCATACATTACTTCAAAGGCCCCAACC-3'SEQ ID NO.16; Preferably, according to the present invention, the nucleotide sequence of the PCR amplification primers for the docking protein Ctdoc gene fragment in step ② is as follows: Ctdoc-F: 5'-GGGGCCTTTGAAGTAATGTATGGCGATGTTAAT-3'SEQ ID NO.17; Ctdoc-R: 5'-TTTGTGCTCGGTGTGCCCGGAACTTTATACGTATTTTTATACGGCAGTGT-3'SEQ ID NO.18; Preferably, the nucleotide sequence of the PCR amplification primer for the maltooligosyltrehalose hydrolase MTHase ​​gene fragment in step ③ is as follows: Hase-F: 5'-TTCCGGGCACACCGAGCACAAAACTGTTTTCGTTCGGTGGAAATATTG-3'SEQ IDNO.19; Hase-R: 5'-TCGACTCTAGAGGATCCTTAATGATGATGTGTGATGATGTTCTAATTGATATACC-3'SEQ ID NO.20; Preferably, the PCR amplification system in steps ①, ②, and ③ is as follows: 1 μl of 10 μmol / L upstream primer, 1 μl of 10 μmol / L downstream primer, 1 μl of gene template, 2×Phanta Max Master Mix 25μl, add ddH2O to 50μl; The amplification procedure is as follows: Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 55°C for 15 sec, extension at 72°C for 30 sec / kb, 30 cycles; final extension at 72°C for 5 min; storage at 4°C; Preferably, the double enzyme digestion system in step ④ is: Free plasmid pHT01 2μl, restriction endonuclease SacⅠ20μl, restriction endonuclease BamHI20μl, 10*Buffer5μl, add water to 50μl, 37℃ water bath for 1-3h, 70℃ water bath for 10min to stop the reaction, and then electrophoresis to detect the enzyme cutting effect; Preferably, the multi-fragment seamless cloning in step ⑤ adopts the ClonExpress multi-fragment one-step cloning kit; Preferably, in step ⑤, the pHT01-P43-PhoD-Ctdoc-MTHase ​​plasmid is integrated into the screening of B. subtilis WB800N strain: The transformants were spread on LB solid medium containing 100ug / mL chloramphenicol resistance and cultured at 37°C for 12h. Single colonies were picked and inoculated into LB liquid medium containing 100ug / mL chloramphenicol resistance and cultured at 37°C for 12h. The obtained bacterial liquids were used as templates for PCR amplification verification, and the corresponding target bands were obtained by agarose gel electrophoresis, thus obtaining the integrated recombinant strain WB800N-PP-Ctdoc-MTHase.

5. The method according to claim 1, characterized in that The nucleotide sequence of the reverse PCR amplification primer of the gene fragment of pHT01-P43-PhoD in step I is as follows: pHT01-PP-F: 5'-GCACCACCACCACCACCACTAAGGATCCTCTAGAGTCGACGT-3'SEQ ID NO.21; pHT01-PP-R: 5'-CGCCGGATCCCATTACTTCAAAGGCCCCAACCGACTGGGCAA-3'SEQ ID NO.22; Preferably: the nucleotide sequence of the PCR amplification primer for the gene fragment of the fusion enzyme CGTase-Rfdoc in step II is as follows: CGTase-Rfdoc-F: 5'-GGGGCCTTTGAAGTAatgATGAATGATCTGAATGATTTTCTG-3'SEQ ID NO.23; CGTase-Rfdoc-R: 5'-GGTGGTGCTCGAGCTGCGGCAGGGTTAT-3'SEQ ID NO.24; Preferably, the PCR amplification system in steps Ⅰ and Ⅱ is as follows: 1 μl of 10 μmol / L upstream primer, 1 μl of 10 μmol / L downstream primer, 1 μl of gene template, 2×Phanta Max MasterMix 25 μl, add ddH2O to 50 μl; The amplification procedure is as follows: Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 53°C for 15 sec, extension at 72°C for 30 sec / kb, 30 cycles; final extension at 72°C for 5 min; storage at 4°C; Preferably, the single-fragment seamless cloning in step III adopts the ClonExpress single-fragment one-step cloning kit; Preferably, the screening of the integration of pHT01-P43-PhoD-CGTase-Rfdoc plasmid into B. subtilis WB800N strain in step III: The transformants were spread on LB solid medium containing 100ug / mL chloramphenicol resistance and cultured at 37°C for 12h. Single colonies were picked and inoculated into LB liquid medium containing 100ug / mL chloramphenicol resistance and cultured at 37°C for 12h. The obtained bacterial liquids were used as templates for PCR amplification verification, and the corresponding target bands were obtained by agarose gel electrophoresis, thus obtaining the integrated recombinant strain WB800N-PP-CGTase-Rfdoc.

6. The method according to claim 1, characterized in that In step 6, the preparation of the immobilized trehalose multi-enzyme complex cellulose microspheres comprises the following steps: (i) Activating and expanding the recombinant scaffold protein strain WB800N-PP-ScafCCR and the recombinant fusion enzyme strains WB800N-PP-MTSase-Ccdoc, WB800N-PP-Ctdoc-MTHase, and WB800N-PP-CGTase-Rfdoc according to claim 1, respectively, and fermenting at 37° C. for 40-50 hours, collecting the bacterial cells, resuspending them, and using an ultrasonic disruptor to disrupt the cells to obtain a cell disruption solution as a crude enzyme solution; purifying, desalting, and concentrating the crude enzyme solution as a pure enzyme solution for subsequent assembly; (ii) mixing the scaffold protein pure enzyme solution ScafCCR in step (i) with the pure enzyme solutions of the fusion enzymes MTSase-Ccdoc, Ctdoc-MTHase, and CGTase-Rfdoc in step (i) at 30-70° C. and pH 4.0-8.0 to form a trehalose multienzyme complex; (iii) immobilizing the trehalose multienzyme complex in step (ii) using the fiber microspheres CMS-1 prepared in step 5, adding 1% glutaraldehyde to the fixed microspheres, cross-linking at 25° C. for 1 hour, and then rinsing with PBS buffer for 3 times to remove excess cross-linking agent and unadsorbed residual protein, and obtaining immobilized microspheres of trehalose multienzyme complex, and recovering them to obtain immobilized trehalose multienzyme complex cellulose microspheres; (iv) separating the immobilized trehalose multi-enzyme complex cellulose microspheres in step (iii) by filtering, washing the immobilized trehalose multi-enzyme complex cellulose microspheres, and recovering the immobilized trehalose multi-enzyme complex cellulose microspheres after drying.

7. The method according to claim 6, characterized in that In the step (i), the activation culture conditions are 37° C., 200-220 rpm, and 10-12 h, and the activation medium is a liquid LB medium, and the components are as follows: Tryptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L, adjust pH to 7.0 with NaOH; Preferably, in step (i), the expansion culture conditions are 37° C., 200-220 rpm, and 10-12 h, and the expansion culture medium is TB medium. In the step (i), the seed solution obtained by the expanded culture is transferred to the TB culture medium at a volume percentage of 8-10%, and fermented at a speed of 400-500 rpm and a temperature of 37° C. for 40-50 hours; The composition of TB medium is as follows: TB fermentation medium: tryptone 12g / L, yeast extract powder 24g / L, KH2PO4 2.4g / L, K2HPO4 16.5g / L, glycerol 4ml / L; Preferably, in step (i), the fermentation broth is placed in a centrifuge at 4°C and 8000 rpm for 10 min, and the bacterial cells are collected; the bacterial cells are resuspended and washed multiple times using 10 mM PBS buffer to remove excess impurities, pigments and culture medium components; The resuspended bacteria were crushed by ultrasonic crusher, with a power of 400W and a 6-diameter amplitude, and the working principle of 4s of crushing and 6s of rest for a total of 20min was followed. The whole process was operated on ice. The crushed liquid was centrifuged at 12000rpm for 30min in a centrifuge precooled at 4℃, and the collected supernatant was the crude enzyme liquid. Preferably, in step (i), an AKTA protein purification chromatograph is used to separate and purify the crude enzyme solution of each module to obtain pure enzyme; Preferably, in step (ii), the scaffold protein and the fusion enzyme are incubated at 37°C, Ca 2+ In vitro assembly was completed at a concentration of 10 mM; Preferably, the immobilization is performed at a temperature of 30° C., pH=7.4, a calcium ion concentration of 10 mmol / L, and an action time of 40 min in step (iii); Preferably, in step (iv), the fiber pellets are washed with sterile water and then vacuum freeze-dried for recovery.

8. The method according to claim 1, characterized in that After the immobilized trehalose multi-enzyme complex cellulose microspheres are catalyzed to prepare trehalose, the immobilized trehalose multi-enzyme complex cellulose microspheres are filtered and recovered, and further utilized to prepare trehalose.

9. A method for preparing cellulose microspheres, comprising the following steps: A mixture of microcrystalline cellulose, chitosan and polyethylene glycol in a mass ratio of 7:2:1 is dissolved in 1-butyl 3-methylimidazole chloride, and a paste-like mucus with a final mass concentration of 5% is prepared by stirring; the obtained paste-like mucus is stirred at 85-95 rpm in a water bath at 75-85°C until it is completely dissolved and reaches a transparent and clear paste-like liquid state; anhydrous ethanol is used as a coagulation bath, and microspheres are prepared by extrusion, and are rinsed in deionized water for 1-3 times to obtain wet fiber microspheres, and the cellulose microspheres are named CMS-1.

10. Use of the cellulose microspheres prepared according to claim 9 in immobilizing enzymes.

Images