Bacillus subtilis with high yield of surfactin, related enzyme mutant and preparation method of bacillus subtilis

Abstract

The invention discloses bacillus subtilis with high yield of surfactin, a related enzyme mutant and a preparation method of the bacillus subtilis, the bacillus subtilis is obtained by a gene modification method and can produce the surfactin with high yield, and the highest yield can reach 9.4 g / L; the invention also provides key enzyme mutants participating in surfactin synthesis in the bacillus subtilis, and the key enzyme mutants comprise a biotin carboxylase IdeHA mutant, a biotin carboxylase accBC mutant, an enoyl reductase FabI mutant, a malonyl transferase FabD mutant and a dihydrolipoyl dehydrogenase IPdU mutant. The key enzyme mutants comprise a biotin carboxylase IdeHA mutant, a biotin carboxylase accBC mutant, an enoyl reductase FabI mutant, a malonyl transferase FabD mutant and a dihydrolipoyl dehydrogenase IPdU mutant. The bacillus subtilis for high-yield surfactin and the preparation method thereof disclosed by the invention are beneficial to realizing industrial production and commercial application of the surfactin.

Description

Technical Field

[0001] The invention relates to a microorganism and a preparation method thereof, in particular to a Bacillus subtilis and a preparation method thereof, and belongs to the field of genetic engineering. Background Art

[0002] Bacillus subtilis belongs to the genus Bacillus. It has the advantages of fast growth, low nutritional requirements, efficient secretion of many proteins and metabolites, and no toxin production. It is a non-pathogenic and safe microorganism that is widely used in aquaculture, plant disease resistance, feed production, medicine and health, and other fields.

[0003] Surfactants are a class of natural surfactants, mainly synthesized by Bacillus, and widely found in nature. They are mainly composed of a cyclic heptapeptide and a β-hydroxy fatty acid chain, and have both hydrophilic and hydrophobic groups, which can significantly reduce the surface and interfacial tension of liquids, allowing water and oil to be better mixed or emulsified. Compared with traditional chemical synthetic surfactants, biological surfactants have many advantages such as eco-friendliness and high safety, and are used in many fields. For example, in the environmental field, surfactants are used to clean up oil spills and organic pollutants in soil; in the medical and agricultural fields, they play their antibacterial, antiviral and anti-tumor effects. Surfactants have shown great application potential in the fields of industry, environment and medicine. However, since the current production of surfactants mainly relies on microbial fermentation, and the current production is limited, the promotion and application of surfactants is greatly restricted.

[0004] There are many methods to improve the ability of microorganisms to produce surfactin, including optimizing culture conditions, genetic modification, and production process optimization. Genetic modification methods include enhancing the expression of key enzymes, such as regulating the expression of enzymes related to surfactin production by genetic engineering. Patent application CN117187286A discloses a method for overexpressing SecA to improve the production of surfactin in Bacillus subtilis. By genetic engineering, the preprotein transposase secA gene of the surfactin product secretion pathway in the Bacillus subtilis genome is overexpressed to enhance the transmembrane efflux of surfactin, which can significantly increase the production of surfactin. The surfactin production of the genetically engineered bacteria obtained by this method can reach 9.9g / L, but the wild-type strain used is limited to the specific strain Bacillus subtilis ATCC 21332, and its original surfactin production can reach 6.83g / L. Patent application CN117946952A discloses a high-yield surfactin engineered bacterium and its construction method and application. By knocking out the CodY and PhoP genes, negative regulators of srfA synthase in the Bacillus subtilis genome through genetic engineering, and strengthening the expression of srfA synthase, the yield of surfactin can be significantly increased. However, after 48 hours of fermentation, the maximum yield of surfactin in the genetically engineered bacteria obtained by this method is only 4.25g / L. In summary, the Bacillus subtilis that can produce high surfactin is very limited, and the preparation conditions are harsh. Summary of the invention

[0005] Purpose of the invention: The purpose of the present invention is to provide a Bacillus subtilis capable of producing a high amount of surfactin, and to provide related enzyme mutants involved in the synthesis of surfactin in Bacillus subtilis, as well as a preparation method and application of the Bacillus subtilis.

[0006] Technical solution: The present invention provides a Bacillus subtilis with high surfactin production, comprising biotin carboxylase IdeHA, biotin carboxylase accBC, enoyl reductase fabI, malonyl transferase fabD and dihydrolipoyl dehydrogenase IPdU, and the amino acid sequences thereof are shown in SEQ ID NO.1-5 in sequence;

[0007] The lysine at position 74 of the biotin carboxylase IdeHA is mutated to asparagine, the alanine at position 125 is mutated to threonine, the glutamic acid at position 136 is mutated to lysine, the cysteine ​​at position 145 is mutated to phenylalanine, and the threonine at position 394 is mutated to asparagine;

[0008] Or the lysine at position 74 of the biotin carboxylase IdeHA is mutated to asparagine, the alanine at position 125 is mutated to threonine, the glutamic acid at position 136 is mutated to lysine, the cysteine ​​at position 145 is mutated to phenylalanine, and the threonine at position 394 is mutated to asparagine; and the serine at position 409 of the biotin carboxylase accBC is mutated to glycine;

[0009] Or the lysine at position 74 of the biotin carboxylase IdeHA is mutated to asparagine, the alanine at position 125 is mutated to threonine, the glutamic acid at position 136 is mutated to lysine, the cysteine ​​at position 145 is mutated to phenylalanine, and the threonine at position 394 is mutated to asparagine; and the serine at position 409 of the biotin carboxylase accBC is mutated to glycine; and the glycine at position 263 of the enoyl reductase fabI is mutated to cysteine;

[0010] Or the lysine at position 74 of the biotin carboxylase IdeHA mutates to asparagine, the alanine at position 125 mutates to threonine, the glutamic acid at position 136 mutates to lysine, the cysteine ​​at position 145 mutates to phenylalanine, and the threonine at position 394 mutates to asparagine; and the serine at position 409 of the biotin carboxylase accBC mutates to glycine; and the glycine at position 263 of the enoyl reductase fabI mutates to cysteine; and the proline at position 64 of the malonyl transferase fabD mutates to arginine;

[0011] Or the lysine at position 74 of the biotin carboxylase IdeHA mutates to asparagine, the alanine at position 125 mutates to threonine, the glutamate at position 136 mutates to lysine, the cysteine ​​at position 145 mutates to phenylalanine, and the threonine at position 394 mutates to asparagine; and the serine at position 409 of the biotin carboxylase accBC mutates to glycine; and the glycine at position 263 of the enoyl reductase fabI mutates to cysteine; and the proline at position 64 of the malonyl transferase fabD mutates to arginine; and the valine at position 163 of the dihydrolipoyl dehydrogenase IPdU mutates to alanine, and the glycine at position 287 mutates to serine.

[0012] The present invention uses Bacillus subtilis as chassis cells, performs 3D modeling on 5 enzymes involved in the synthesis of surfactin, selects key amino acids around the active center or at loop positions on the protein surface for site-directed mutagenesis, and finally selects 5 strains of high-yield surfactin from hundreds of modified Bacillus subtilis. These 5 enzymes are: biotin carboxylase IdeHA with a sequence of SEQ ID No.1, biotin carboxylase accBC with a sequence of SEQ ID No.2, enoyl reductase fabI with a sequence of SEQ ID No.3, malonyl transferase fabD with a sequence of SEQ ID No.4, and dihydrolipoyl dehydrogenase IPdU with a sequence of SEQ ID No.5. The present invention improves the efficiency of fatty acid synthesis by genetically engineering the key enzymes involved in the synthesis of surfactin in Bacillus subtilis, and provides a Bacillus subtilis with high surfactin production.

[0013] The present invention also provides a method for preparing the Bacillus subtilis, comprising the following steps:

[0014] Step 1: Prepare Bacillus subtilis competent cells;

[0015] Step 2: transforming the first recombinant plasmid into the competent cells obtained in step 1 to obtain recombinant cells; the first recombinant plasmid can express a protein with DNA double-strand excision activity;

[0016] Step 3: construct a second recombinant plasmid; the second recombinant plasmid contains the information of the mutation according to claim 1;

[0017] Step 4: constructing homologous fragments; the homologous fragments contain primer sequences;

[0018] Step 5: Transform the second recombinant plasmid and the homologous fragment into the recombinant cell obtained in step 2 to obtain the Bacillus subtilis according to claim 1.

[0019] The present invention uses CRISPR technology to perform gene editing on the above enzyme in Bacillus subtilis: inserting a crRNA sequence into the pcrF19NM plasmid, the sequence containing the mutation site information of the enzyme. The pHT-XCR6 plasmid with the Cpf1 gene and the constructed pcrF19NM plasmid, as well as the homologous sequence as a gene recombination template, are sequentially transformed into Bacillus subtilis competent cells. After eliminating the plasmid, fermentation and surfactin detection are performed to finally screen out Bacillus subtilis with high surfactin production.

[0020] Preferably, in step 2, the first recombinant plasmid is a pHT-XCR6 plasmid.

[0021] Preferably, in step 3, the second recombinant plasmid is pcrF19NM plasmid.

[0022] Furthermore, in step 2, the protein having DNA double-strand excision activity is Cpf1. In step 3, the second recombinant plasmid comprises a crRNA sequence.

[0023] Furthermore, the crRNA sequence is:

[0024] crRNA Name Sequence (5’-3’) IdeHA-K74 GCGAAAAAAGCAAAAGCCGACGCG IdeHA-A125 GCAATGGAGGCTGCAGGTGTC IdeHA-E136 GGCGTTTCTGAATCCCTCGGA IdeHA-C145 GAGGCAGCCTGCCGCACCGCA IdeHA-T394 AAAGGCCAAACCAGAACAGAA accBC-S409 CGCGCATTGAGCGAATTCGTC fabI-G263 GTTGATTCTGGTTTCCATATC fabD-P64 AATGCGCAGCCTGCTTTGCTT IPdU-V163 GGTCTTGAAGTGGACGGTAAG IPdU-G287 AATATCGAAGGCATCGGCCTA

[0025] Further, in step 4, the primer sequence is:

[0026]

[0027]

[0028] The present invention also provides a biotin carboxylase IdeHA mutant of Bacillus subtilis, the amino acid sequence of which is shown in SEQ ID NO.6.

[0029] The present invention also provides a biotin carboxylase accBC mutant of Bacillus subtilis, the amino acid sequence of which is shown in SEQ ID NO.7.

[0030] The present invention also provides a mutant of the enoyl reductase fabI of Bacillus subtilis, the amino acid sequence of which is shown in SEQ ID NO.8.

[0031] The present invention also provides a fabD mutant of the malonyl transferase of Bacillus subtilis, the amino acid sequence of which is shown in SEQ ID NO.9.

[0032] The present invention also provides a dihydrolipoyl dehydrogenase IPdU mutant of Bacillus subtilis, and its amino acid sequence is shown in SEQ ID NO.10.

[0033] The invention also provides an application of the Bacillus subtilis in producing surfactin.

[0034] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. The Bacillus subtilis provided by the present invention can produce a high yield of surfactin, up to 9.4 g / L, and also provides a preparation method and application of the Bacillus subtilis, which is helpful to realize the industrial production and commercial application of surfactin; 2. The biotin carboxylase IdeHA mutant, biotin carboxylase accBC mutant, enoyl reductase fabI mutant, malonyl transferase fabD mutant and dihydrolipoyl dehydrogenase IPdU mutant provided by the present invention are helpful for Bacillus subtilis to produce a high yield of surfactin. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 Schematic diagram of the protein structure of biotin carboxylase IdeHA;

[0036] Figure 2 The schematic diagram of the protein structure of biotin carboxylase accBC;

[0037] Figure 3 is a schematic diagram of the protein structure of enoyl reductase fabI;

[0038] Figure 4 is a schematic diagram of the protein structure of malonyl transferase fabD;

[0039] Figure 5 This is a schematic diagram of the protein structure of dihydrolipoyl dehydrogenase IPdU;

[0040] Figure 6 This is a chromatogram of surfactin in the fermentation broth of Bacillus subtilis CY-5 provided in Example 5 of the present invention. DETAILED DESCRIPTION

[0041] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0042] The wild-type Bacillus subtilis, plasmid pHT-XCR6 and pcrF19NM plasmid used in the examples were all preserved in our laboratory. Unless otherwise specified, other materials used were commercially available.

[0043] Example 1: A high-yield surfactin-producing Bacillus subtilis

[0044] In this example, the preparation method of steps 1-5 is first used to construct a Bacillus subtilis with a biotin carboxylase IdeHA mutant, and then steps 6-8 are used to screen out a strain with high surfactin production.

[0045] Step 1. Prepare Bacillus subtilis competent cells

[0046] Spread wild-type Bacillus subtilis on LB solid medium and culture at 37°C overnight. Pick a single colony and inoculate it into 4 mL LB liquid medium, culture it at 37°C and 140 rpm for 6 h, wash the cells three times with sterile 10% glycerol solution, and finally resuspend the cells with 0.2 mL 10% glycerol and store them in a -80°C refrigerator for use.

[0047] Step 2. Preparation of Bacillus subtilis competent cells carrying plasmid pHT-XCR6

[0048] About 10 ng of plasmid pHT-XCR6 was added to 0.1 mL of Bacillus subtilis competent cells, placed in a pre-cooled electroporation cup for 5 min, electroporated once at 2.0 kV, resuscitated with 1 mL of LB medium for 2 h, spread on LB solid medium containing 50 ug / mL chloramphenicol, and cultured overnight at 37°C. Obtained Bacillus subtilis competent cells with plasmid pHT-XCR6 were stored in a -80°C refrigerator for later use.

[0049] Step 3. Construction of pcrF19NM plasmid

[0050] The pcrF19NM plasmid contains the mutation site information of biotin carboxylase IdeHA and is inserted between the DR2 elements. The crRNA sequence with targeting function is shown in Table 1.

[0051] Table 1 crRNA sequences for biotin carboxylase IdeHA gene editing

[0052] crRNA Name Sequence (5’-3’) IdeHA-K74 GCGAAAAAAGCAAAAGCCGACGCG IdeHA-A125 GCAATGGAGGCTGCAGGTGTC IdeHA-E136 GGCGTTTCTGAATCCCTCGGA IdeHA-C145 GAGGCAGCCTGCCGCACCGCA IdeHA-T394 AAAGGCCAAACCAGAACAGAA

[0053] Step 4. Construction of homologous fragments

[0054] The homologous fragments were constructed using a complementary primer annealing procedure, and the primer sequences used are shown in Table 2.

[0055] Table 2 Primer sequences for constructing homologous fragments of biotin carboxylase IdeHA gene editing

[0056] Primer Name Sequence (5’-3’) IdeHA-K74-F AAAAAAGCAAACGCCGACGCGATCCACCCGGGATATG IdeHA-K74-R CGCGTCGGCGTTTGCTTTTTTCGCCGTCTTTATG IdeHA-A125-F GCAATGGAGACGGCAGGTGTCCCTGTGGTGCCGGGC IdeHA-A125-R GACACCTGCCGTCTCCATTGCTTTTCGCGCTTCAATTTTG IdeHA-E136-F GGCGTTTCTNNKTCCCTCGGAGATATAGAGGCAGCC IdeHA-E136-R TCCGAGGGAMNNAGAAACGCCCGGCACCACAGGGAC IdeHA-C145-F GAGGCAGCCNNKCGCACCGCAAGTCAAATCGGCTATC IdeHA-C145-R TGCGGTGCGMNNGGCTGCCTCTATATCTCCGAGGG IdeHA-T394-F AAAGGCCAANNKAGAACAGAAGCAATTGAAAAACTAG IdeHA-T394-R TTCTGTTCTMNNTTGGCCTTTGACAATCATCTTAG

[0057] Among them, "F" represents the upstream primer, "R" represents the downstream primer, and the underlined sequence is the mutation site.

[0058] The system of annealing PCR is shown in Table 3, and the procedure is shown in Table 4.

[0059] Table 3 Annealing PCR system

[0060] Composition volume 10pmol / μL upstream primer 5μL 10pmol / μL downstream primer 5μL

[0061] Table 4 Annealing PCR program

[0062]

[0063] The resulting PCR product is the homologous fragment.

[0064] Step 5. Transformation of pcrF19NM plasmid and homologous fragment

[0065] According to the above second step experimental steps, the pcrF19NM plasmid and homologous fragments were transformed into Bacillus subtilis competent cells carrying the plasmid pHT-XCR6, and spread on LB solid medium supplemented with 50ug / mL chloramphenicol, 50ug / mL kanamycin and 3% xylose, and cultured overnight at 30°C. The grown single colonies can be used for liquid culture and fermentation verification.

[0066] Step 6. Cultivation and fermentation of Bacillus subtilis to produce surfactin

[0067] Pick 48 single colonies of Bacillus subtilis from the plate and inoculate them into 10mL test tubes containing 3mL LB liquid medium, and culture them overnight at 37℃ and 200rpm in a shaker as the first-level seed liquid. Add 1mL of the first-level seed liquid to a 250mL conical flask containing 30mL LB liquid medium, and culture it at 37℃ and 200rpm in a shaker for 16h as the second-level seed liquid. Add 5mL of the second-level seed liquid to a 2L conical flask containing 1L fermentation medium, and culture it at 37℃ and 200rpm in a shaker for 48h. The ingredients of 1L fermentation medium are: 40g soluble starch, 7g sodium nitrate, 1g potassium dihydrogen phosphate, 1g yeast extract, 0.5g magnesium sulfate, 0.5g potassium chloride, 0.28g ferrous sulfate heptahydrate, 1.7mg manganese sulfate, and 0.16mg copper sulfate pentahydrate.

[0068] Step 7. Surfactant content produced by Bacillus subtilis fermentation

[0069] Centrifuge the Bacillus subtilis fermentation broth, take 1mL of supernatant, and centrifuge at 12000rpm for 3min. Take 200uL of supernatant, add methanol 3-10 times appropriately, shake thoroughly and centrifuge at 12000rpm for 10min, and the supernatant is the sample to be tested. Agilent 1260 high performance liquid chromatography is used as the detection tool, and the chromatographic column used is Amethyst C18-Hcolumn (5μm, 250×4.6mm). The mobile phase used is 90% methanol and 10% water, and 0.05% trifluoroacetic acid is added, with a flow rate of 0.8mL / min. The injection volume is 20ul. The detection wavelength is 214nm. The surfactin standard is prepared as a gradient concentration and a standard curve is prepared to calculate the surfactin content in the fermentation broth sample. Among the 48 Bacillus subtilis strains selected in step 6, the strain with the most increased surfactin production is recorded as CY-1, and its surfactin production is shown in Table 13.

[0070] Step 8. Genome sequencing of dominant strains

[0071] The genomic DNA of CY-1 was extracted using a gram-positive bacteria genomic DNA extraction kit (Beijing Solebow), and the biotin carboxylase IdeHA gene on the genome was sequenced. The sequence of the biotin carboxylase IdeHA mutant of CY-1 is shown in SEQ ID No. 6, where the 74th lysine mutated to asparagine, the 125th alanine mutated to threonine, the 136th glutamic acid mutated to lysine, the 145th cysteine ​​mutated to phenylalanine, and the 394th threonine mutated to asparagine. The position of the mutation site in the 3D structure of the enzyme is shown in Figure 1 shown.

[0072] Example 2: A high-yield surfactin-producing Bacillus subtilis

[0073] Similar to Example 1, in this example, the preparation method of steps 1-5 is first used to construct Bacillus subtilis carrying a biotin carboxylase IdeHA mutant and a biotin carboxylase accBC mutant, and then steps 6-8 are used to screen out a strain with high surfactin production.

[0074] Step 1. Prepare Bacillus subtilis competent cells

[0075] This step is substantially the same as step 1 of Example 1, except that the wild-type Bacillus subtilis used in Example 1 is replaced with the high-yield strain CY-1 screened out in Example 1.

[0076] Step 2. Preparation of Bacillus subtilis competent cells carrying plasmid pHT-XCR6

[0077] This step is the same as step 2 of Example 1.

[0078] Step 3. Construction of pcrF19NM plasmid

[0079] This step is basically the same as step 3 of Example 1, except that the crRNA sequence is changed to that shown in Table 5.

[0080] Table 5 crRNA sequences for biotin carboxylase accBC gene editing

[0081] crRNA name Sequence (5'-3') accBC-S409 CGCGCATTGAGCGAATTCGTC

[0082] Step 4. Construction of homologous fragments

[0083] This step is basically the same as step 4 of Example 1, except that the sequence of the primers for constructing the homologous fragments is changed to that shown in Table 6.

[0084] Table 6 Primer sequences for constructing homologous fragments of biotin carboxylase accBC gene editing

[0085] Primer name Sequence (5'-3') accBC-S409-F CGCGCATTGGGCGAATTCGTCATCGAAGGCATTGAG accBC-S409-R GACGAATTCGCCCAATGCGCGCTTCATGCGGGCAATC

[0086] Step 5. Transformation of pcrF19NM plasmid and homologous fragment

[0087] This step is substantially the same as step 5 of Example 1, except that the picking of 48 single colonies is changed to picking of 192 single colonies.

[0088] Step 6. Cultivation and fermentation of Bacillus subtilis to produce surfactin

[0089] This step is the same as step 6 of Example 1.

[0090] Step 7. Surfactant content produced by Bacillus subtilis fermentation

[0091] This step is the same as step 7 of Example 1. Among the 192 Bacillus subtilis strains selected in step 6, the strain with the most improved surfactin production was recorded as CY-2, and its surfactin production is shown in Table 13.

[0092] Step 8. Genome sequencing of dominant strains

[0093] This step is basically the same as step 8 of Example 1, except that the gene sequenced is the biotin carboxylase accBC gene of the CY-2 genome. The mutation of the biotin carboxylase accBC of CY-2 is that the 409th serine is mutated to glycine, and the sequence is shown in SEQ ID No.7. The position of the mutation site in the 3D structure of the protein is shown in Figure 2 shown.

[0094] Example 3: A high-yield surfactin-producing Bacillus subtilis

[0095] Similar to Example 1, in this example, the preparation method of steps 1-5 is first used to construct Bacillus subtilis with biotin carboxylase IdeHA and accBC mutants and enoyl reductase fabI mutant, and then steps 6-8 are used to screen out strains with high surfactin production.

[0096] Step 1. Prepare Bacillus subtilis competent cells

[0097] This step is basically the same as step 1 of Example 1, except that the wild-type Bacillus subtilis is replaced by the high-yield strain CY-2 screened out in Example 2.

[0098] Step 2. Preparation of Bacillus subtilis competent cells carrying plasmid pHT-XCR6

[0099] This step is the same as step 2 of Example 1.

[0100] Step 3. Construction of pcrF19NM plasmid

[0101] This step is basically the same as step 3 of Example 1, except that the crRNA sequence is changed to that shown in Table 7.

[0102] Table 7 crRNA sequences for enoyl reductase fabI gene editing

[0103] crRNA name Sequence (5'-3') fabI-G263 GTTGATTCTGGTTTCCATATC

[0104] Step 4. Construction of homologous fragments

[0105] This step is basically the same as step 4 of Example 1, except that the sequence of the primers for constructing the homologous fragments is changed to that shown in Table 8.

[0106] Table 8 Primer sequences for constructing homologous fragments of enoyl reductase fabI gene editing

[0107] Primer name Sequence (5'-3') fabI-G263-F GTTGATTCTNNKTTCCATATCACTGCCCGCTAAG fabI-G263-R GATATGGAAMNNAGAATCAACGTGAAGATTTTCACC

[0108] Step 5. Transformation of pcrF19NM plasmid and homologous fragment

[0109] This step is substantially the same as step 5 of Example 1, except that the picking of 48 single colonies is changed to picking of 96 single colonies.

[0110] Step 6. Cultivation and fermentation of Bacillus subtilis to produce surfactin

[0111] This step is the same as step 6 of Example 1.

[0112] Step 7. Surfactant content produced by Bacillus subtilis fermentation

[0113] This step is the same as step 7 of Example 1. Among the 96 Bacillus subtilis strains selected in step 6, the strain with the most improved surfactin production was recorded as CY-3, and its surfactin production is shown in Table 13.

[0114] Step 8. Genome sequencing of dominant strains

[0115] This step is basically the same as step 8 of Example 1, except that the gene sequenced is the enoyl reductase fabI gene of the CY-2 genome. The mutation of the enoyl reductase fabI of CY-3 is that the glycine at position 263 is mutated to cysteine, and the sequence is shown in SEQ ID No. 8. The position of the mutation site in the 3D structure of the protein is shown in Figure 3 shown.

[0116] Example 4: A high-yield surfactin-producing Bacillus subtilis

[0117] Similar to Example 1, in this example, the preparation method of steps 1-5 is first used to construct Bacillus subtilis with biotin carboxylase IdeHA and accBC mutants, enoyl reductase fabI mutant and malonyl transferase fabD, and then steps 6-8 are used to screen out strains with high surfactin production.

[0118] Step 1. Prepare Bacillus subtilis competent cells

[0119] This step is substantially the same as step 1 of Example 1, except that the wild-type Bacillus subtilis is replaced with the strain CY-3 screened out in Example 3 for the greatest improvement in surfactin production.

[0120] Step 2. Preparation of Bacillus subtilis competent cells carrying plasmid pHT-XCR6

[0121] This step is the same as step 2 of Example 1.

[0122] Step 3. Construction of pcrF19NM plasmid

[0123] This step is basically the same as step 3 of Example 1, except that the crRNA sequence is changed to that shown in Table 9.

[0124] Table 9 crRNA sequences for malonyltransferase fabD gene editing

[0125] crRNA name Sequence (5'-3') fabD-P64 AATGCGCAGCCTGCTTTGCTT

[0126] Step 4. Construction of homologous fragments

[0127] This step is basically the same as step 4 of Example 1, except that the sequence of the primers for constructing the homologous fragments is changed to that shown in Table 10.

[0128] Table 10 Primer sequences for constructing homologous fragments of malonyltransferase fabD gene editing

[0129] Primer name Sequence (5'-3') fabD-P64-F AATCGCAGNNKGCTTTGCTTACGACAAGCATCGCTG fabD-P64-R AAGCAAAGCMNNCTGCGCATTGTATGTAAGTGTTAATTC

[0130] Step 5. Transformation of pcrF19NM plasmid and homologous fragment

[0131] This step is substantially the same as step 5 of Example 1, except that the picking of 48 single colonies is changed to picking of 96 single colonies.

[0132] Step 6. Cultivation and fermentation of Bacillus subtilis to produce surfactin

[0133] This step is the same as step 6 of Example 1.

[0134] Step 7. Surfactant content produced by Bacillus subtilis fermentation

[0135] This step is the same as step 7 of Example 1. Among the 96 Bacillus subtilis strains selected in step 6, the strain with the most improved surfactin production was recorded as CY-4, and its surfactin production is shown in Table 13.

[0136] Step 8. Genome sequencing of dominant strains

[0137] This step is basically the same as step 8 of Example 1, except that the gene sequenced is the malonyltransferase fabD gene of the CY-2 genome. The mutation of the malonyltransferase fabD of CY-4 is that the 64th amino acid proline is mutated to arginine, and the sequence is shown in SEQ ID No. 9. The position of the mutation site in the 3D structure of the protein is shown in Figure 4 shown.

[0138] Example 5: A high-yield surfactin-producing Bacillus subtilis

[0139] Similar to Example 1, in this example, the preparation method of steps 1-5 is first used to construct Bacillus subtilis with biotin carboxylase IdeHA and accBC mutants, enoyl reductase fabI mutant, malonyl transferase fabD and dihydrolipoyl dehydrogenase IPdU mutant, and then steps 6-8 are used to screen out strains with high surfactin production.

[0140] Step 1. Prepare Bacillus subtilis competent cells

[0141] This step is substantially the same as step 1 of Example 1, except that the wild-type Bacillus subtilis is replaced with the strain CY-4 screened out in Example 4 with the greatest increase in surfactin production.

[0142] Step 2. Preparation of Bacillus subtilis competent cells carrying plasmid pHT-XCR6

[0143] This step is the same as step 2 of Example 1.

[0144] Step 3. Construction of pcrF19NM plasmid

[0145] This step is basically the same as step 3 of Example 1, except that the crRNA sequence is changed to that shown in Table 11.

[0146] Table 11 crRNA sequences for dihydrolipoyl dehydrogenase IPdU gene editing

[0147] crRNA name Sequence (5'-3') IPdU-V163 GGTCTTGAAGTGGACGGTAAG IPdU-G287 AATATCGAAGGCATCGGCCTA

[0148] Step 4. Construction of homologous fragments

[0149] This step is basically the same as step 4 of Example 1, except that the sequence of the primers for constructing the homologous fragments is changed to that shown in Table 12.

[0150] Table 12 Primer sequences for constructing homologous fragments of dihydrolipoyl dehydrogenase IPdU gene editing

[0151] Primer name Sequence (5'-3') IPdU-V163-F GGTCTTGAANNKGACGGTAAGTCTGTACTGACTTCAGATG IPdU-V163-R CTTACCGTCMNNTTCAAGACCCGGAAGCATTCTCGGTCTTG IPdU-G287-F AATATCGAANNKATCGGCCTAGAGAACACCGATATTG IPdU-G287-R TAGGCCGATMNNTTCGATATTTGCCTGTCTGCCGATG

[0152] Step 5. Transformation of pcrF19NM plasmid and homologous fragment

[0153] This step is substantially the same as step 5 of Example 1, except that the picking of 48 single colonies is changed to picking of 96 single colonies.

[0154] Step 6. Cultivation and fermentation of Bacillus subtilis to produce surfactin

[0155] This step is the same as step 6 of Example 1.

[0156] Step 7. Surfactant content produced by Bacillus subtilis fermentation

[0157] This step is the same as step 7 of Example 1. Among the 96 Bacillus subtilis strains selected in step 6, the strain with the most improved surfactin production was recorded as CY-5, and its surfactin production is shown in Table 13. Figure 6 The chromatograms of surfactin in the standard product and CY-5 fermentation broth are shown in FIG.

[0158] Step 8. Genome sequencing of dominant strains

[0159] This step is basically the same as step 8 of Example 1, except that the sequenced gene is the dihydrolipoyl dehydrogenase IPdU gene of the CY-2 genome. The mutation of the dihydrolipoyl dehydrogenase IPdU of CY-5 is that the 163rd amino acid valine is mutated to alanine, and the 287th amino acid glycine is mutated to serine. The sequence is shown in SEQ ID No. 10. The position of the mutation site in the 3D structure of the protein is shown in Figure 5 shown.

[0160] The surfactin contents of wild-type Bacillus subtilis and CY-1, CY-2, CY-3, CY-4, and CY-5 strains are shown in Table 13. The surfactin production of these five strains of Bacillus subtilis was significantly increased compared with that of wild-type Bacillus subtilis, with the highest increase being 15.7 times.

[0161] Table 13 Surfactant production of different strains of Bacillus subtilis

[0162]

[0163]

Claims

1. A Bacillus subtilis, comprising biotin carboxylase IdeHA, biotin carboxylase accBC, enoyl reductase fabI, malonyl transferase fabD and dihydrolipoyl dehydrogenase IPdU, wherein the amino acid sequences are shown in SEQ ID NO.1-5 in sequence; characterized in that: The lysine at position 74 of the biotin carboxylase IdeHA is mutated to asparagine, the alanine at position 125 is mutated to threonine, the glutamic acid at position 136 is mutated to lysine, the cysteine ​​at position 145 is mutated to phenylalanine, and the threonine at position 394 is mutated to asparagine; Or the lysine at position 74 of the biotin carboxylase IdeHA is mutated to asparagine, the alanine at position 125 is mutated to threonine, the glutamic acid at position 136 is mutated to lysine, the cysteine ​​at position 145 is mutated to phenylalanine, and the threonine at position 394 is mutated to asparagine; and the serine at position 409 of the biotin carboxylase accBC is mutated to glycine; Or the lysine at position 74 of the biotin carboxylase IdeHA is mutated to asparagine, the alanine at position 125 is mutated to threonine, the glutamic acid at position 136 is mutated to lysine, the cysteine ​​at position 145 is mutated to phenylalanine, and the threonine at position 394 is mutated to asparagine; and the serine at position 409 of the biotin carboxylase accBC is mutated to glycine; and the glycine at position 263 of the enoyl reductase fabI is mutated to cysteine; Or the lysine at position 74 of the biotin carboxylase IdeHA mutates to asparagine, the alanine at position 125 mutates to threonine, the glutamic acid at position 136 mutates to lysine, the cysteine ​​at position 145 mutates to phenylalanine, and the threonine at position 394 mutates to asparagine; and the serine at position 409 of the biotin carboxylase accBC mutates to glycine; and the glycine at position 263 of the enoyl reductase fabI mutates to cysteine; and the proline at position 64 of the malonyl transferase fabD mutates to arginine; Or the lysine at position 74 of the biotin carboxylase IdeHA mutates to asparagine, the alanine at position 125 mutates to threonine, the glutamate at position 136 mutates to lysine, the cysteine ​​at position 145 mutates to phenylalanine, and the threonine at position 394 mutates to asparagine; and the serine at position 409 of the biotin carboxylase accBC mutates to glycine; and the glycine at position 263 of the enoyl reductase fabI mutates to cysteine; and the proline at position 64 of the malonyl transferase fabD mutates to arginine; and the valine at position 163 of the dihydrolipoyl dehydrogenase IPdU mutates to alanine, and the glycine at position 287 mutates to serine.

2. A method for preparing Bacillus subtilis according to claim 1, characterized in that: The following steps are involved: Step 1: Prepare Bacillus subtilis competent cells; Step 2: transforming the first recombinant plasmid into the competent cells obtained in step 1 to obtain recombinant cells; the first recombinant plasmid can express a protein with DNA double-strand excision activity; Step 3: construct a second recombinant plasmid; the second recombinant plasmid contains the information of the mutation according to claim 1; Step 4: constructing homologous fragments; the homologous fragments contain primer sequences; Step 5: Transform the second recombinant plasmid and the homologous fragment into the recombinant cell obtained in step 2 to obtain the Bacillus subtilis according to claim 1.

3. The preparation method according to claim 2, characterized in that: In step 2, the first recombinant plasmid is pHT-XCR6 plasmid.

4. The preparation method according to claim 2, characterized in that: In step 3, the second recombinant plasmid is pcrF19NM plasmid.

5. A biotin carboxylase IdeHA mutant of Bacillus subtilis according to claim 1, characterized in that: Its amino acid sequence is shown in SEQ ID NO.

6.

6. A biotin carboxylase accBC mutant of Bacillus subtilis according to claim 1, characterized in that: Its amino acid sequence is shown in SEQ ID NO.

7.

7. A fabI mutant of the enoyl reductase of Bacillus subtilis according to claim 1, characterized in that: Its amino acid sequence is shown in SEQ ID NO.

8.

8. A malonyltransferase fabD mutant of Bacillus subtilis according to claim 1, characterized in that: Its amino acid sequence is shown in SEQ ID NO.

9.

9. A dihydrolipoyl dehydrogenase IPdU mutant of Bacillus subtilis according to claim 1, characterized in that: Its amino acid sequence is shown in SEQ ID NO.

10.

10. Use of the Bacillus subtilis according to claim 1 in producing surfactin.

Images