DNA constructs for genome editing in plants

Abstract

The present invention provides a DNA construct for expressing a genome editing system in plant cells, which comprises an excised region sandwiched by two recombinase recognition sites arranged in the same direction, a gene encoding a site-specific recombinase that specifically recognizes these recombinase recognition sites is arranged outside the excised region, and the excised region comprises a marker gene divided into a 5' region and a 3' region, and a gene encoding the genome editing system arranged between the 3' region and the 5' region.

Description

Technical Field

[0001] The present invention relates to a DNA construct for expressing a genome editing system in plant cells, and a method for producing genome-edited plant cells using the DNA construct. Background Art

[0002] As a tool for genetic modification of crops, attention to genome editing technology is rising globally. Genome editing technology is a technology that uses a genome editing system (CRISPR / Cas system, TALEN system, ZFN system, PPR system, etc.) to accurately rewrite (edit) a target gene (target gene), and the genome editing system is composed of a region that specifically binds to a specific base sequence on the genome and an enzyme region that cuts DNA, etc. Since the target gene can be changed simply and with a high probability, genome editing technology is being used in various fields related to plants such as crop breeding, production of useful materials, variety improvement, and functional analysis of target genes (Non-patent Document 1).

[0003] However, genome editing technology has the problem that foreign genes such as the genome editing system and selection markers remain in the genome of the genome-edited plant obtained. Therefore, if only necessary mutations are introduced into the plant genome, it is necessary to suppress the insertion of these genes into the genome or remove them from the genome after insertion.

[0004] Prior art literature

[0005] Non-patent literature

[0006] Non-patent document 1: Osakabe Y. et al., Plant Cell Physiol. March 2015, Vol. 56, No. 3, pp. 389-400

[0007] Non-patent document 2: Nanto, K. et al., Plant Biotechnol. J. 2005, Vol. 3, pp. 203-214 Summary of the invention

[0008] Problems to be solved by the invention

[0009] The present invention has been completed in view of the problems of the above-mentioned prior art, and its purpose is to provide a plant genome editing method that can modify the target gene without introducing foreign genes such as encoding genome editing systems into the plant genome.

[0010] Solution to the problem

[0011] In order to achieve the above-mentioned purpose, the present inventors have focused on the previously developed MAT (Multi-Auto-Transformation) vector. The MAT vector has the advantage of not leaving the marker gene (selection gene) used for selection in the genome of the genome-edited plant by utilizing the Cre / loxP system as a site-specific recombination system. Specifically, Figure 1 As shown, in the MAT vector, the selection gene introduced into the genome is sandwiched between two recombinase recognition sites (loxP sequences), and the selection gene is circularly cut out by the action of the site-specific recombinase (Cre recombinase) (Non-Patent Document 2).

[0012] Therefore, the following system is envisioned: artificial restriction enzyme genes (genes encoding genome editing systems) for genome editing are introduced between the recombinase recognition sites to replace the selection gene, and the site-specific recombinase is transiently expressed, thereby excising the region containing the above-mentioned gene, etc., and circular DNA can be generated before introduction into the genome. In addition, the following situation is also envisioned: by configuring the segmented marker gene at both ends of the above-mentioned excised region, when circularization occurs in the region, the marker gene is reconfigured and becomes expressible, thereby monitoring the behavior of the above-mentioned circular DNA.

[0013] Therefore, it can be clearly seen that, in fact, the preparation Figure 3 The result of the DNA construct shown and introduced into the plant is that due to the generation of a circular DNA containing a gene encoding a genome editing system (sgRNA and Cas9), the genome editing system is transiently expressed and the gene is not introduced into the plant genome, thereby being able to change the sequence of the target gene. In addition, the inventors also found that the above-mentioned circular DNA can be stably maintained in plant cells for a certain period of time (about 35 days), thereby completing the present invention. Therefore, the present invention provides the following aspects.

[0014] [1] A DNA construct for expressing a genome editing system in a plant cell,

[0015] It comprises a region to be excised which is sandwiched between a first recombinase recognition site located on the 5' side and a second recombinase recognition site located on the 3' side.

[0016] The first recombinase recognition site and the second recombinase recognition site are oriented in the same direction.

[0017] A gene encoding a site-specific recombinase that specifically recognizes the first and second recombinase recognition sites is arranged outside at least one side of the excised region,

[0018] The excised region includes a gene encoding the genome editing system and a marker gene divided into a 5' region and a 3' region, the 3' region of the marker gene is adjacent to the 3' end of the first recombinase recognition site, the 5' region of the marker gene is adjacent to the 5' end of the second recombinase recognition site, and the gene encoding the genome editing system is arranged between the 3' region and the 5' region of the marker gene, and

[0019] When introduced into plant cells, the excision region is excised and circularized by expression of the site-specific recombinase, so that the 5' region and the 3' region are bound with the recombinase recognition site sandwiched therebetween, thereby enabling expression of the marker gene.

[0020] [2] The DNA construct according to [1], further comprising a right border sequence (RB) and a left border sequence (LB) derived from the T-DNA sequence of Agrobacterium, wherein the excised region and the gene encoding the site-specific recombinase are arranged in the transfer region sandwiched by the RB and LB.

[0021] [3] The DNA construct according to [1] or [2], wherein the marker gene is a fluorescent protein gene, a luminescent enzyme gene, a chromogenic enzyme gene or a drug resistance gene.

[0022] [4] The DNA construct according to any one of [1] to [3], wherein the marker gene is divided into a 5' region and a 3' region in an intron.

[0023] [5] The DNA construct according to any one of [1] to [4], wherein the excised region further comprises a foreign gene between the 3' region and the 5' region of the marker gene.

[0024] [6] The DNA construct according to [5], wherein the exogenous gene is a plant hormone biosynthesis gene.

[0025] [7] A method for producing genome-edited plant cells, the method comprising the following steps (1) to (2):

[0026] (1) a step of introducing the DNA construct described in any one of [1] to [6] into a plant cell; and

[0027] (2) A step of screening, using the expression of the marker gene as an indicator, cells obtained in the step into which the DNA construct has been introduced and into which the excised region has been circularized.

[0028] [8] A method for producing a genome-edited plant, the method comprising the following steps (1) to (3):

[0029] (1) A step of introducing the DNA construct described in [6] into plant cells;

[0030] (2) a step of screening, using the expression of the marker gene as an indicator, cells obtained in the step into which the DNA construct has been introduced and into which the excised region has been circularized; and

[0031] (3) A step of culturing the cells obtained in the above step to generate plant tissues, and screening plant tissues that have undergone morphological changes using the morphological changes of the plant tissues caused by the expression of the plant hormone biosynthesis gene on the DNA construct as an indicator.

[0032] Effects of the Invention

[0033] According to the present invention, the sequence of the target gene can be changed in the plant cell without introducing an exogenous gene encoding a genome editing system into the genome. In addition, according to the present invention, the genome editing system can be stably expressed from circular DNA. Therefore, genome-edited plants with high safety can be produced with high efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 This is a diagram showing the outline of the MAT (Multi-Auto-Transformation) vector system, which is the basis of the DNA construct of the present invention. In the MAT vector, the loxP sequence is located in the forward direction, and the selection gene and the Cre recombinase, which is a site-specific enzyme, are located between them. Therefore, the selection gene can be cut out in a circular shape by the Cre / loxP system, and a marker-free plant can be obtained.

[0035] Figure 2 : It is a figure showing an example of genome editing using the DNA construct of the present invention. In the DNA construct of the present invention, the site-specific enzyme Cre gene is configured in the T-DNA, and the two recognition sites loxP are configured in the forward direction. When the DNA construct is introduced into the plant cell, the circular DNA is cut out using the Cre / loxP system. In addition, by pre-introducing Cas9 as an artificial restriction enzyme and the SgRNA of the target sequence (represented by scissors in the figure) in the region cut out in a circular shape, genome editing can be performed based on the circular DNA ("circularized DNA" in the figure) that is not introduced into the genome. Then, finally, when the cell divides, the circular DNA disappears, and a mutant individual in which the exogenous gene is not introduced into the genome can be obtained.

[0036] Figure 3Schematic diagram showing one method of the DNA construct of the present invention (A in the figure) and the circular DNA cut therefrom (B in the figure). The circular DNA is cut from the T-DNA region introduced by the Agrobacterium method (the region sandwiched by "OD / RB" (overdrive sequence and right border sequence) and LB / LB (2 left border sequences) in the figure) using the Cre / loxP system. Genes encoding the genome editing system ("Cas9" and "SgRNA" in the figure) and plant hormone biosynthesis genes ("iaaM", "iaaH" and "ipt" in the figure) are configured in the circular DNA. The genes in the circular DNA can be transiently expressed in plant cells to introduce non-integrated mutations. In addition, in the DNA construct of the present invention, the gfp gene is divided and introduced ("P 35S ”, “G” and “in”, and “tron”, “FP” and “T”) is that when circularization occurs, the introns between the gfp genes (“in” and “tron” in the figure) are recombined, and then splicing occurs in the plant cells, causing the intron to fall off and the encoded GFP protein to be expressed. It should be noted that the “SgRNA” in the figure represents the gene encoding the guide RNA of the target sequence for genome editing. “P 35S " " indicates the 35S cauliflower mosaic virus promoter. "T" indicates the heat shock protein terminator. "intCre" indicates the Cre recombinase gene with an intron added at 5'. "lox" indicates the loxP sequence recognized by the Cre recombinase. "Ri-Ori" and "NPTIII" indicate the kanamycin resistance gene. The arrow recorded together with "G" and "FP" indicates the primer set for gfp gene detection. It should be noted that the symbols in this figure have the same meaning in the following figures.

[0037] Figure 4 It is a schematic diagram of the vector prepared to verify the effect of the DNA construct of the present invention.

[0038] Figure 5 Schematic diagram showing the vector backbone for preparing the DNA construct of the present invention. The DNA construct of the present invention was prepared by inserting a gene cassette amplified by PCR into each restriction enzyme site located in the MCS of the backbone through a fusion reaction.

[0039] Figure 6 It is shown Figure 5 Schematic diagram of the gene cassette with the backbone inserted and the primers used to amplify them (arrows in the figure).

[0040] Figure 7Schematic diagram showing the DNA construct of the present invention used for agroinfiltration of Nicotiana benthamiana. The agroinfiltration method used two lox int GFP vectors with different positions of loxP sequences ("lox" in the figure) in introns and a GFP vector without introns as controls. The 35S cauliflower mosaic virus promoter ("35SP" in the figure), the heat shock protein terminator ("T" in the figure), and gfp ("G" and "FP" or "GFP" in the figure) are located in the T-DNA region.

[0041] Figure 8 The photographs show the results of observing Nicotiana benthamiana leaves into which lox intron GFP vectors were introduced using a fluorescence microscope. More specifically, the results of observing GFP fluorescence at two locations on the leaves of Nicotiana benthamiana on the 6th day after Agrobacterium infiltration was performed. The upper part shows GFP fluorescence from the lox int GFP01 vector, the middle part shows GFP fluorescence from the lox int GFP02 vector, and the lower part shows GFP fluorescence from the GFP vector used as a positive control.

[0042] Fig. 9 : is a graph showing the results of detecting the fluorescence intensity in Nicotiana benthamiana leaves into which the lox intron GFP vector was introduced. More specifically, Figure 8 The results shown are quantification results of GFP fluorescence intensity in leaves on day 6 by image analysis within a circle with a diameter of 1.5 cm centered at the point of inoculation of the bacterial solution by the Agrobacterium infiltration method.

[0043] Fig.10 It is a schematic diagram of the vector prepared for verifying the effect of the DNA construct of the present invention.

[0044] Fig.11 The fluorescence microscopy shows that the Fig.10 01 vector. More specifically, the results of observing the GFP fluorescence of the leaves of Nicotiana benthamiana on the 7th day since the agrobacterium infiltration method was performed on Nicotiana benthamiana are shown. In the upper part, A in the figure shows the GFP fluorescence from the GFP vector used as a control, B in the figure shows the GFP fluorescence from the Switch on GFP 01 vector, and C in the figure shows the GFP fluorescence from the Switch on GFP 02 vector.

[0045] Fig.12 is shown to be effective for the introduction of Fig.10More specifically, the fluorescence intensity of the vector shown in FIG. Figure 8 The results shown are quantification results of GFP fluorescence intensity in leaves on day 6 by image analysis within a 1.5 cm diameter circle centered at the point of inoculation of the bacterial solution by the Agrobacterium infiltration method.

[0046] Fig.13 This is a schematic diagram of an improved vector prepared to verify the effect of the DNA construct of the present invention. In the figure, "Ipt" represents a cytokinin synthesis gene, and "iaaH" represents an auxin precursor synthesis gene.

[0047] Fig.14 The fluorescence microscopy shows that the Fig.13 The photographs show the results of observing Nicotiana benthamiana leaves containing the vector shown. More specifically, the results of observing the GFP fluorescence of the leaves 7 days after the Agrobacterium infiltration of Nicotiana benthamiana are shown. In the upper part, "GFP-npt (control)" in the figure shows the GFP fluorescence from the GFP vector used as a control, and "S01 iGFP (1) intCre ipt iaaH" and "S01 iGFP (2) intCre ipt iaaH" in the figure show the GFP fluorescence from the improved vectors, respectively.

[0048] Fig.15 This shows that the Fig.13 More specifically, the fluorescence intensity of the vector shown in FIG. Figure 8 The results shown are quantification results of GFP fluorescence intensity in leaves on day 6 by image analysis within a 1.5 cm diameter circle centered at the point of inoculation of the bacterial solution by the Agrobacterium infiltration method.

[0049] Fig.16 The fluorescence microscopy shows that the Fig.13 The results of the Nicotiana benthamiana leaves with the vectors shown in Figures A and B show the GFP fluorescence from the ipt, iaaH integrated improved vector (S01 iGFP (1) intCre ipt iaaH) on the 7th and 35th days after infection, respectively. The GFP fluorescence from the ipt, iaaH integrated improved vector (S01 iGFP (2) intCre ipt iaaH) on the 7th and 35th days after infection, respectively.

[0050] Fig.17 The results show that the genome was transformed by Agrobacterium infiltration. Fig.13The upper part shows the results of the analysis on the 7th day after infection with the ipt, iaaH integrated modified vector, and the lower part shows the results of the analysis on the 35th day after infection with the ipt, iaaH integrated modified vector.

[0051] Fig.18 This is a schematic diagram showing the structure of the NtPDS gene as a target gene for genome editing in the embodiment. As the target sequence for genome editing. The third exon sequence (PDS3) of PDS, which is a common sequence of Arabidopsis theliana and SR1 tobacco, was selected. Specifically, a portion of the third exon of PDS was hit. The SgRNA target sequence of PDS3 is GAGGCAAGAGATGTCCTAGGTGG (sequence number: 21). It should be noted that the TGG at the 3' end of the sequence is a PAM sequence. In addition, the insert for smooth-end cloning of pUC118 was amplified using primer sets (1) and (2). Primer sets (3) and (4) were used for colony PCR.

[0052] Fig.19 This is an electrophoresis photograph showing the results of analyzing the PDS3 gene of SR1 WT by colony PCR. It shows the results of colony PCR using Emerald Amp for colonies obtained by blunt-end cloning of pUC118 described in the Examples. "M" in the figure indicates the marker lane obtained by electrophoresis of a 500 bp DNA ladder.

[0053] Fig. 20 It is a schematic diagram showing the structure of the DNA construct of the present invention for verifying the effect of the genome editing system (Cas9 protein and SgRNA). In the figure, "a-ipt" represents the ipt gene having a promoter from the Agrobacterium pO22 system.

[0054] Fig.21 The figure shows the introduction of the gene into tobacco (SR1) leaves by Agrobacterium method. Fig. 20 The DNA construct shown in the figure was cultured. After being placed on a selection medium that killed Agrobacterium for 2 days after infection, it was subcultured every week on a hormone-free medium. In the figure, A shows the results of observing the leaves of SR1 on the 9th day after Agrobacterium infection, B shows the results of observing the leaves of SR1 on the 16th day after infection, and C shows the results of observing the leaves of SR1 on the 40th day after infection. It can be observed that callus tissue has been formed from the leaves. D shows the callus tissue isolated from the leaves.

[0055] Fig. 22The results show that the introduction of the gene into tobacco (SR1) leaves by Agrobacterium tumefaciens Fig. 20 The electrophoresis photograph of the CAPS analysis results of callus tissue obtained by culturing with the DNA construct shown in FIG. Fig.18 The PCR reaction was carried out with the primer set shown, and the obtained amplified product was treated with the restriction enzyme BlnI at 37°C for 4 hours. The electrophoresis photograph on the left shows the results of CAPS analysis of callus tissue on the 39th day after infection. In this analysis, Fig.18 The primers (1) and (2) shown in the figure are used. The "WT" in the figure is the fragment amplified from PDS3 of SR1, which is used as a rough reference for the uncut fragment. The electrophoresis photograph on the right shows the results of CAPS analysis of callus tissue on day 45 after infection. In this analysis, Fig.18 Primers (3) and (4) shown. "M" in the figure is a labeled lane showing the results of electrophoresis of a 100 bp DNA gradient. The black arrow shows the position of the uncut fragment of Bln1. It should be noted that circle 1 and circle 3 in the figure are samples in which mutation introduction was detected by CAPS analysis. Circle 2 in the figure is a sample in which mutation could not be detected by CAPS analysis.

[0056] Fig.23 The results show that the introduction of the gene into tobacco (SR1) leaves by Agrobacterium tumefaciens Fig. 20 The electrophoresis photograph of the results of CAPS analysis of callus tissue (39 days after infection) obtained by culturing with the DNA construct shown in Figure 1. For this callus tissue, blunt-end cloning was performed, and colony PCR was performed on the obtained colonies to amplify PDS3. Then, the results of electrophoresis of samples treated with BlnI at 37°C for 4 hours are shown. In the figure, "M" is the lane marked with 100 bp, and the black arrow shows the position of the uncut fragment.

[0057] Fig.24 The results show that the introduction of the gene into tobacco (SR1) leaves by Agrobacterium tumefaciens Fig. 20 The electrophoresis photograph of the results of CAPS analysis of callus tissue (45 days after infection) obtained by culturing the DNA construct shown in Figure 1. For this callus tissue, blunt-end cloning was performed, and colony PCR was performed on the obtained colonies to amplify PDS3. Then, the results of electrophoresis of samples treated with BlnI at 37°C for 4 hours are shown. In the figure, "M" is the lane marked with 100bp, and the black arrow shows the position of the uncut fragment.

[0058] Fig.25It is a schematic diagram showing the constitution of the DNA construct of the present invention used for morphological screening and mutation introduction. In the figure, "35S-ipt" represents the ipt gene whose promoter is changed from the promoter from the Agrobacterium pO22 system to the 35S promoter.

[0059] Fig.26 It is shown that the Fig.25 The results of observing the callus obtained by the DNA construct shown in FIG. 1 were obtained by the Agrobacterium method. The DNA construct was introduced into SR1. 30 days after infection, callus formation was confirmed in the peripheral part (see A, C, E, G and I in the figure). The results of observing the GFP fluorescence of the callus-forming leaves showed that GFP fluorescent callus was observed in 5 of the 18 leaves (see B, D, F, H and J in the figure). Fig.25 The callus obtained by growing the construct A in MS medium is shown in Figures A to D. Fig.25 The callus obtained by growing the construct B shown in FIG. 1 in MS medium containing NAM is shown in FIG. Fig.25 Calli obtained by growing construct C in MS medium are shown in Figures I and J.

[0060] Fig. 27 It is a schematic diagram showing the positional relationship between the DNA construct of the present invention, the circular DNA generated by the DNA construct, and the primers used to verify the behavior of the circular DNA. Primers (1) and (2) are a primer set for amplifying the coding region fragment of gfp. It is designed to perform a PCR reaction by cutting off the circular DNA, which is used for the detection of circular DNA. Primers (3) and (4) are a primer set for amplifying the coding region fragment of Cas9. It is used to confirm the presence of Cas9. It is used to confirm the cutting of the circular DNA according to the length of the amplified band.

[0061] Fig.28 It shows that for import Fig.25 The electrophoresis photographs of the results of genomic PCR analysis and CAPS analysis of callus tissue obtained by using the DNA construct shown in FIG. 30 . Genomic DNA was extracted from callus tissue on day 30 after infection and used Fig. 27 The primer set shown was used to perform genomic PCR to detect the gfp gene (circular DNA) and Cas9 gene. Fig. 22 The CAPS analysis was performed using the method described in , and the mutation introduced into the target gene was detected. Fig.25 The calli obtained by growing the construct A in MS medium are shown in lanes 1 to 6. Fig.25Calli obtained by growing the construct B in MS medium are shown in lanes 7 and 8. Fig.25 The calli obtained by growing the construct B shown in FIG. 1 in MS medium containing NAM are shown in lanes 9 to 13. Fig.25 The callus obtained by growing the construct C in MS medium is shown in lanes 14 to 18. In addition, "M" in the figure indicates the marker lane for electrophoresis of 500 bp DNA ladder. The black arrow indicates the position of the uncut fragment in CAPS analysis. DETAILED DESCRIPTION

[0062] (DNA construct)

[0063] The DNA construct for expressing the genome editing system in plant cells of the present invention comprises a region to be excised sandwiched between a first recombinase recognition site located at the 5' side and a second recombinase recognition site located at the 3' side,

[0064] The first recombinase recognition site and the second recombinase recognition site are oriented in the same direction.

[0065] A gene encoding a site-specific recombinase that specifically recognizes the first and second recombinase recognition sites is arranged outside at least one side of the excised region,

[0066] The excised region includes a gene encoding the genome editing system and a marker gene divided into a 5' region and a 3' region, wherein the 3' region of the marker gene is adjacent to the 3' end of the first recombinase recognition site, and the 5' region of the marker gene is adjacent to the 5' end of the second recombinase recognition site, and the gene encoding the genome editing system is configured between the 3' region and the 5' region of the marker gene.

[0067] Moreover, by adopting this structure, when the DNA construct of the present invention is introduced into a plant cell, the above-mentioned excised region is cut out and circularized by expressing the above-mentioned site-specific recombinase, so that the above-mentioned 5' region and 3' region are combined with the recombinase recognition site sandwiched therebetween, thereby being able to express the above-mentioned marker gene. In addition, the circularized region can stably exist in the cell for a certain period of time to express the encoded genome editing system without being introduced into the genome of the plant cell. Therefore, plant cells edited by the genome can be obtained efficiently.

[0068] For the "excised region" of the present invention, in order to be excised and circularized by a site-specific recombinase, at its ends, two recombinase recognition sites specifically recognized by the site-specific recombinase (the first recombinase recognition site located on the 5' side and the second recombinase recognition site located on the 3' side) are arranged in the same direction.

[0069] In the present invention, "site-specific recombinase" is not particularly limited as long as it recognizes a specific sequence (recombinase recognition site) and causes recombination between the sequences. Examples thereof include Cre recombinase, recombinase R from Zygosaccharomyces rouxii, FLP recombinase, γδ resolvase, Tn3 resolvase, ΦC31 integrase, Bxb1-integrase, R4 integrase, and λ integrase. In addition, as a "recombinase recognition site", any sequence that can be specifically recognized by the above enzymes can be used. For example, in the case of Cre recombinase, loxP sequence can be cited, in the case of recombinase R, Rs sequence can be cited, and in the case of FLP recombinase, FRT sequence can be cited.

[0070] The "marker gene" contained in the excised region can be any gene as long as the marker protein encoded by the gene can be expressed and detected in plant cells, and examples thereof include fluorescent protein genes, luminescent enzyme genes, chromogenic enzyme genes, and drug resistance genes.

[0071] As fluorescent protein genes, for example, GFP (green fluorescent protein) gene, YFP (yellow fluorescent protein) gene, RFP (red fluorescent protein) gene, aequorin gene. As luminescent enzyme genes, for example, luciferase gene can be specifically mentioned. As color developing enzyme genes, for example, β-glucuronidase (GUS) gene, β-galactosidase gene, alkaline phosphatase gene, SEAP gene can be specifically mentioned. As drug resistance genes, for example, kanamycin resistance (NPTII) gene, hygromycin resistance (HPT) gene, tetracycline resistance gene, ampicillin resistance gene, spectinomycin resistance gene, chloramphenicol resistance gene, neomycin resistance gene, herbicide resistance gene (bialaphos resistance gene, glyphosate resistance gene (EPSPS), sulfonylurea resistance gene (ALS)) can be specifically mentioned.

[0072] As shown in the examples described later, the "marker gene" is divided into a 5' region and a 3' region and included in the excised region in order to monitor the circularization of the excised region and the circularized DNA. In addition, the 3' region is arranged in the excised region in such a manner that the 3' region is adjacent to the 3' end of the first recombinase recognition site and the 5' region is adjacent to the 5' end of the second recombinase recognition site. Therefore, by adopting this configuration, when recombination occurs between the first recombinase recognition site and the second recombinase recognition site by utilizing the action of the above-mentioned site-specific recombinase, the 5' region of the marker gene is combined with the 3' region and reconfigured.

[0073] The segmentation of the marker gene is not particularly limited as long as the functional protein can be expressed through the reconfiguration. For example, it can be in the exon of the marker gene or in the intron of the marker gene. From the perspective of the fact that even if the sequence is changed during reconfiguration, the impact is small and the segmentation is easy to design, the above-mentioned marker gene is preferably split into a 5' region and a 3' region in the intron.

[0074] In addition, it is sufficient to configure at least a gene encoding a genome editing system between the 3' region and the 5' region of the marker gene. However, when the terminator region contained in the 3' region of the marker gene and the promoter region contained in the 5' region are too close, there is a tendency to have an adverse effect on the expression of the marker protein. Therefore, the distance between the above-mentioned 3' region and 5' region is preferably more than 2000 bases, and more preferably more than 4000 bases.

[0075] In the excised region of the present invention, a gene encoding a genome editing system is arranged between the 3' region and the 5' region of the above-mentioned marker gene. In the present invention, the "genome editing system" is not particularly limited as long as it is an artificial restriction enzyme system that can change any site on the genomic DNA. As artificial restriction enzyme systems, for example, CRISPR / Cas system, TALEN system, ZFN system, PPR system can be cited.

[0076] The CRISPR / Cas system uses Cas proteins and guide RNAs (gRNA, Single-guide RNA (SgRNA)) as nucleases (RGN; RNA-guided nucleases). The system can be introduced into cells, the guide RNA binds to the target site, and the Cas protein induced by the binding site cuts the DNA (for example, CRISPR-Cas9 (U.S. Patent No. 8697359, International Publication No. 2013 / 176772), CRISPR-Cpf1 (Zetsche B. et al., Cell, 163 (3): 759-71, (2015)).

[0077] In addition, an artificial enzyme complex obtained by adding a deaminase as a deaminase to the system after removing the nuclease activity from the CRISPR / Cas system can also be used as the genome editing system of the present invention (Target-AID (K. Nishida et al., Targeted nucleotide editing using hybrid prokaryotic and vertical adaptive immune systems, Science, DOI: 10.1126 / science.aaf8729, (2016))).

[0078] The TALEN system uses an artificial nuclease (TALEN), which contains not only a DNA cleavage domain (e.g., a FokI domain) but also a DNA binding domain of a transcription activator-like (TAL) effector (e.g., U.S. Pat. No. 8,470,973, U.S. Pat. No. 8,586,363). By introducing the system into cells, the TALEN sandwiches the DNA binding domain and binds to the target site, thereby cutting the DNA. The DNA binding domain that binds to the target site can be designed according to a known scheme (e.g., Zhang, Feng et.al. (2011) Nature Biotechnology 29 (2)).

[0079] The ZFN system uses an artificial nuclease (ZFN) comprising a nucleic acid cleavage domain conjugated to a DNA binding domain containing a zinc finger array (e.g., U.S. Patent Nos. 6,265,196, 8,524,500, 7,888,121, and European Patent No. 1,720,995). By introducing the system into cells, the ZFN sandwiches the DNA binding domain and binds to the target site, thereby cutting the DNA. The DNA binding domain that binds to the target site can be designed according to a known scheme.

[0080] As the PPR system, for example, PPR (pentatricopeptiderepeat) fused with a nuclease domain can be used (Nakamura et al., Plant Cell Physiol 53: 1171-1179 (2012)).

[0081] Among these genome editing systems, since nucleic acids (guide RNAs) are used in the identification of target sites, CRISPR / Cas systems are preferred from the viewpoint that target sites can be selected more freely and their preparation is also simple. It should be noted that the length of the guide RNA used in the CRISPR / Cas system is at least 15, 16, 17, 18, 19, and 20 bases. As the upper limit of the preferred base length, it is 30 or less, more preferably 25 or less, further preferably 22 or less, and most preferably 20 or less. The Cas protein may include one or more nuclear localization signals (NLS). In addition, the Cas protein is preferably a type II CRISPR enzyme, for example, a Cas9 protein. The Cas9 protein is Streptococcus pneumoniae (S.pneumoniae), Streptococcus pyogenes (S.pyogenes) Cas9, Streptococcus thermophilus (S.thermophilus) Cas9, and may include mutant Cas9 from these organisms, and may be a homolog or ortholog of Cas9.

[0082] In the excised region of the present invention, between the 3' region and the 5' region of the above-mentioned marker gene, in addition to the gene encoding the genome editing system, other exogenous genes may also be included. There is no particular limitation on the "exogenous gene", and examples thereof include: plant hormone biosynthesis genes, replication promoting factor genes, and cell death suppressing factor genes.

[0083] As plant hormone biosynthesis genes, specifically, ipt gene, iaaM gene, iaaH gene, rol (ro1A, rolB, rolC) gene, etc. can be listed. As genes that promote the formation of adventitious embryos, WSU gene, BBM gene, AGL15 gene, Lec1 gene, etc. can be listed. As replication promoting factor genes, specifically, APS gene, ct-ars1 gene, etc. can be listed. As cell death suppressing genes, specifically, ACCd gene, Bax-I gene, NaGH gene, etc. can be listed.

[0084] In the "DNA construct" of the present invention, in addition to the above-mentioned excised region, other genes may be further included as long as a gene encoding the above-mentioned site-specific recombinase is also configured on the outside of at least one side of the region. As "other genes", there are no particular restrictions, and examples thereof include: a replication origin (mutant replication origin (Ri-ori) from a Ri plasmid, etc.) that enables the DNA construct of the present invention to replicate in a host other than a plant cell (e.g., Escherichia coli), and a marker gene (NPTIII gene, etc.) that functions in the above-mentioned host.

[0085] It should be noted that in the present invention, not only the coding region of protein or RNA can be appropriately added to each gene contained in the DNA construct, but also the region controlling its expression (promoter, enhancer, insulator, terminator, poly-A tailing signal, etc.) can be appropriately added. As a "promoter", it can be a DNA that can function in plant cells and be constitutively expressed, or a DNA that can be induced to express in a specific tissue or a specific developmental stage of a plant. For example, the cauliflower mosaic virus (CaMV) 35S promoter, E12-35Sω promoter, the promoter of the nopaline synthase gene (Pnos), the ubiquitin promoter from corn, the actin promoter from rice, the PR protein promoter from tobacco, the ADH promoter, and the RuBisco promoter. The "terminator" may be a sequence that can terminate transcription caused by the above-mentioned promoter and has a poly-A tailing signal, and examples thereof include the terminator of the heat shock protein (HSP) gene, the terminator of the nopaline synthase (NOS) gene, the terminator of the octopine synthase (OCS) gene, and the CaMV 35S terminator.

[0086] In addition, in the "DNA construct" of the present invention, when recombination occurs using the above-mentioned site-specific recombinase, the scope is not only between the recombinase recognition sites, but also may involve the surrounding regions. Therefore, it is preferred that the 3' terminal site of the 5' region of the above-mentioned marker gene is further configured at the 5' end of the first recombinase recognition site, and the 5' terminal site of the 3' region of the above-mentioned marker gene is further configured at the 3' end of the second recombinase recognition site. In this case, the length of the 3' terminal site of the above-mentioned 5' region and the 5' terminal site of the above-mentioned 3' region is not particularly limited, and is preferably 10 bases or more, more preferably 50 bases or more, further preferably 80 bases or more, and more preferably 100 bases or more.

[0087] The form of the "DNA construct" of the present invention is not particularly limited as long as it can be expressed in plant cells into which the configured gene has been introduced, and examples thereof include: pUC series (pUC57, pUC18, pUC19, pUC9, etc.), pAL series (pAL51, pAL156, etc.), pBI series (pBI121, pBI101, pBI221, pBI2113, pBI101.2, etc.), pPZP series, pSMA series, intermediate vector series (pLGV23Neo, pNCAT, etc.), cauliflower mosaic virus (CaMV), bean golden mosaic virus (BGMV), and tobacco mosaic virus (TMV).

[0088] When the DNA construct of the present invention is introduced into plant cells by the Agrobacterium method as shown in the Examples described below, the construct preferably further comprises a right border sequence (RB) and a left border sequence (LB) derived from the T-DNA sequence of Agrobacterium. It should be noted that, in this case, the excised region and the gene encoding the site-specific recombinase are arranged in the transfer region sandwiched by the RB and LB.

[0089] In addition, from the viewpoint of improving the formation of the above-mentioned transfer region in Agrobacterium and promoting the transfer of this region to plant cells, it is preferred that the 5' end of RB is adjacent to the superdrive (OD) sequence. In addition, LB can be configured multiple (for example, 2). In addition, the 3' end of RB and the 5' end of LB can be adjacent to the telomere sequence respectively (refer to Chiurazzi M. et al., Plant Molecular Biology, 1994, Vol. 26, pp. 923-934, Teo CH. et al., The Plant Journal, 2011, Vol. 68, pp. 28-39).

[0090] In addition, for those skilled in the art, DNA construct of the present invention can be prepared using suitable known methods. For example, as shown in the embodiments described later, it is possible to prepare by cutting off a purified gene cassette with a suitable restriction enzyme and connecting with a restriction enzyme site or a multiple cloning site as a suitable carrier of a skeleton. In addition, DNA construct of the present invention can also be prepared using methods such as In-Fusion cloning, TA cloning, double cross-over recombination. In addition, for the base sequence of the gene encoded in the DNA construct of the present invention, in order to express their translation product efficiency well in the plant cell introduced, it is possible to optimize the codons that are suitable for the cell.

[0091] (Method for producing genome-edited plant cells)

[0092] The method for producing genome-edited plant cells of the present invention is a method comprising the following steps.

[0093] (1) a step of introducing the DNA construct of the present invention into plant cells; and

[0094] (2) A step of screening, using the expression of the marker gene as an indicator, cells obtained in the above step into which the DNA construct has been introduced and into which the excised region has been circularized.

[0095] As shown in the examples described later, according to this method, cells in which the above-mentioned excised region has been circularized, that is, cells in which the gene encoding the genome editing system contained in the region has not been introduced into the plant genome, can be screened, and further plant cells in which only the target gene has been changed can be obtained.

[0096] In the method of the present invention, the "plant" as the object of genome editing is a seed plant including angiosperms and gymnosperms, and angiosperms include monocots and dicots. As monocots, for example, Gramineae, Liliaceae, Musaceae, Bromeliaceae, and Orchidaceae can be listed. As dicots, for example, Cruciferae, Leguminosae, Solanaceae, Cucurbitaceae, Convolvulaceae, Rosaceae, Moraceae, Malvaceae, Asteraceae, Amaranthaceae, and Polygonaceae can be listed. In addition, as gymnosperms, for example, pine, fir, ginkgo, and cycad can be listed.

[0097] The "plant cells" introduced into the DNA construct of the present invention include not only the cells in the plant mentioned above, but also cultured cells from the plant. It further includes plant cells in various forms, for example, leaf slices, seeds, stem tips of seed embryos, stem tips of tuber buds, suspension culture cells, protoplasts, callus, immature embryos, pollen, etc.

[0098] For those skilled in the art, the "introduction" of the DNA construct of the present invention into plant cells can be carried out using an appropriate known method, for example, Agrobacterium methods such as Agrobacterium infiltration method, gene gun methods such as iPB (in planta Particle Bombardment) method, electroporation method, PEG-calcium phosphate method, liposome method, microinjection method, whisker method, plasma method, laser injection method. It should be noted that the iPB method is disclosed in, for example, Japanese Patent Application Laid-Open No. 2017-205104 and Japanese Patent Application Laid-Open No. 2017-205103.

[0099] The plant cells into which the DNA construct of the present invention has been inserted can be screened by using the expression of the above-mentioned marker gene as an index to introduce the DNA construct and the cells into which the circularization of the above-mentioned excised region has occurred. For those skilled in the art, "screening" can be appropriately performed according to the type of the marker gene. For example, when the marker gene is a fluorescent protein gene, its expression can be detected by a fluorescence microscope to screen the cells. In addition, the difference in fluorescence intensity can also be utilized to screen by a cell sorter, etc. In the case of using a luminescent enzyme gene, the cells can be screened by adding a luminescent substrate to the cells and measuring the luminescence with a luminescence photometer, thereby detecting its expression. In the case of using a chromogenic enzyme gene, the cells can be screened by adding a chromogenic substrate to the cells and observing whether there is coloration, thereby detecting its expression. In the case of using a drug-resistant gene, the cells can be screened by culturing the cells with a culture medium (selective culture medium) containing each agent.

[0100] In addition, in the present invention, when a DNA construct further comprising a plant hormone biosynthesis gene is used as the above-mentioned foreign gene, the following method for producing a genome-edited plant can also be adopted.

[0101] A method for producing a genome-edited plant, the method comprising the following steps (1) to (3).

[0102] (1) a step of introducing the DNA construct of the present invention further comprising a plant hormone biosynthesis gene into a plant cell;

[0103] (2) a step of screening, using the expression of the marker gene as an indicator, cells obtained in the above step into which the DNA construct has been introduced and into which the excised region has been circularized; and

[0104] (3) A step of culturing the cells obtained in the above step to generate plant tissues, and screening plant tissues that have undergone morphological changes using the morphological changes of the plant tissues caused by the expression of the plant hormone biosynthesis gene on the above DNA construct as an indicator.

[0105] Steps (1) and (2) in the method are as described above. In step (3), plant tissues into which the DNA construct of the present invention has been introduced and into which the above-mentioned excised region has been circularized can be screened by using the morphological changes of the plant tissues caused by the expression of the plant hormone biosynthesis gene as an index. It should be noted that there is no particular limitation on the method for culturing plant cells to achieve the generation of plant tissues, and those skilled in the art can use the known culture medium shown in the examples described later to appropriately carry out the method.

[0106] In addition, for those skilled in the art, the "screening" in step (3) can also be appropriately performed according to the type of plant hormone biosynthesis gene. For example, when the plant hormone biosynthesis gene is the ipt gene, the formation of adventitious buds or the formation of callus can be used as an index to screen plant tissues. In the case of the iaaM gene and the iaaH gene, the formation of adventitious roots or the formation of callus can be used as an index to screen plant tissues. In the case of the ipt gene, the iaaM gene and the iaaH gene, the formation of adventitious roots or the formation of callus can be used as an index to screen plant tissues. In the case of the rol gene, the formation of hairy roots or the formation of callus can be used as an index to screen plant tissues. In the case of the AGL15 gene, the formation of adventitious embryos can be used as an index to screen plant tissues. In addition, in the case of the BBM gene, the WSU gene or the Lec1 gene, the formation of callus can be used as an index to screen plant tissues.

[0107] In addition, for those skilled in the art, the confirmation that the sequence of the target gene in the plant cells obtained by such screening has been changed can be carried out using a known method. For example, sequencing method, PCR method, CAPS method, RFLP method, Southern blotting method, etc. can also be used to confirm. In addition, whether there is genome editing in the target gene can also be confirmed by analyzing the RNA, amount, molecular weight, etc. expressed by the gene. For example, RT-PCR method and Northern blot hybridization method can also be used to confirm. In addition, it is also possible to confirm by analyzing the protein, amount, molecular weight, etc. expressed by the target gene. For example, Western blotting, immunostaining, ELISA method, RIA, and dot immunobinding assay can be used.

[0108] In addition, it has long been known that somatic cells of plants have differentiation totipotency, and methods for regenerating plants from plant cells and plant tissues (callus tissue, etc.) have been established for various plants (for example, see "Transformation Protocol [Plant Edition]" by Tabei Yutaka, Kagaku Dojin Co., Ltd., published on September 20, 2012). Therefore, for example, by regenerating plants from plant cells or plant tissues obtained by the method of the present invention, plants in which the sequence of the target gene has been altered can be obtained.

[0109] Example

[0110] Hereinafter, the present invention will be described in more detail based on the examples, but the present invention is not limited to the following examples. In addition, this example was carried out using the experimental materials and methods shown below. It should be noted that, below, the reagents without the manufacturer's name are reagents manufactured by Wako Pure Chemical Industries, Ltd.

[0111] (Plant preparation and cultivation)

[0112] The transient assay used Nicotiana benthamiana, a plant that has no immune system against viruses and is therefore commonly used in infection experiments such as Agrobacterium infiltration.

[0113] In the infection experiment based on the immersion method, SR1 of tobacco (N. tabacum) was used. The genome of SR1 is alloamphiploid (2n=24), with N. sylvestris (forest tobacco) (2n=12: SS) and N. tometosiformis (tuberculous tobacco) (2n=12: TT) as ancestors. The SR1 seeds used in this example were provided by JT (Japan Tobacco Co., Ltd.).

[0114] Add 1 ml of 70% ethanol to the seeds of SR1, centrifuge at 6000 rpm, and discard the supernatant. Add 1 ml of sterile solution (10-fold diluted Haiter), stir for 10 minutes, and then discard the supernatant. In a clean workbench, add 1 ml of sterile water, stir, and then discard the supernatant. Repeat this operation 3 times. Discard the floating seeds, inoculate them on agar medium, and place them in a high temperature chamber under light for 2 to 3 weeks. Transfer the germinated seeds to a 200 ml conical beaker in order, and further transfer the grown seeds to a jam jar. The leaves of the plant body about 2 months later are used for infection experiments.

[0115] (Culture medium and antibiotics used)

[0116] LB medium used a medium in which 10 g of Bacto tryptone, 5 g of Bacto yeast extract, and 10 g of NaCl were fixed to 1000 ml with DW, adjusted to pH 7.2, and sterilized with an autoclave (121° C., 20 minutes). In the case of agar medium, the total amount was adjusted to 200 ml, and 3 g of Bacto Ager was added after pH adjustment, and sterilized with an autoclave (121° C., 20 minutes). When antibiotics were added to agar medium, they were added just before spreading on a culture dish.

[0117] For MS medium, 1 bag of Murashige & Skoog medium mixed salts (manufactured by Nippon Pharmaceutical Co., Ltd.), MURASHIGE & SKOOG MODIFIED VITAMIN SOLUTION (1000×), 1 ml of MP Biomedicals and 30 g of sucrose were fixed to 1000 ml with DW, adjusted to pH 5.8 with 1 M potassium hydroxide, divided into small packages of 200 ml, 0.6 g of gellan gum was added, and sterilized using an autoclave (121° C., 20 minutes).

[0118] When antibiotics or acetosyringone were added, they were added just before spreading on the culture dish. The antibiotics were adjusted to 100 mg / l of ampicillin, 50 mg / l of kanamycin, 20 mg / l of streptomycin, 100 mg / l of carbenicillin, and 200 mg / l of cefotaxime. The concentration of acetosyringone was adjusted to 50 mg / l.

[0119] When adding plant hormones, they were added before adjusting the pH so as to have the following concentrations.

[0120] Redifferentiation medium: naphthaleneacetic acid (NAA) 0.1 mg / l, 6-benzyladenine (BA) 1.0 mg / l

[0121] NAM medium: 1-naphthylacetamide (NAM) 1.0 mg / l.

[0122] (Agroinfiltration)

[0123] Collect a single colony in LB medium (Rifampicin 25mg / L, Kanamycin 50mg / L), and culture with 2-3ml of liquid LB medium at 28°C and 150-200rpm for 18 hours. Add LB medium to the cultured Agrobacterium solution and culture at 28°C and 150-200rpm for 24 hours. Centrifuge the culture at 3000g for 10 minutes, collect the bacteria, and resuspend in an infiltration buffer equal to the culture. Centrifuge again at 3000g for 10 minutes, collect the bacteria, and resuspend in an infiltration buffer equal to half the amount of the culture. Adjust OD to 0.3 and add acetosyringone to 200μM. Add the infiltration solution to a syringe and inject it from the back of the leaves of Nicotiana benthamiana.

[0124] (Conversion)

[0125] Transformation of Escherichia coli (JM101) and Agrobacterium (LBA4504) was carried out using the heat shock method. 1 ng of DNA was added to the competent cells and placed on ice for 20 minutes. Heat shock was performed at 42 ° C for 30 seconds using a heating block and then immediately inserted into ice. Then, after adding 5 times the amount of liquid LB medium of the competent cells, in the case of Escherichia coli, incubated at 37 ° C for 1 hour, and in the case of Agrobacterium, incubated at 28 ° C for 2 hours. After incubation, the bacterial solution was spread on the LB medium containing appropriate antibiotics and spread with a cell spreader. Escherichia coli was incubated at 37 ° C for about 12 hours, and Agrobacterium was incubated at 28 ° C for 48 hours to obtain colonies.

[0126] (Infection experiment using the immersion method on SR1 tobacco)

[0127] The Agrobacterium transformed with the vector was cultured in LB medium with kanamycin added at 28°C for 48 hours with shaking to prepare an infection solution. Fully grown leaves were cut from sterile seedlings and cut into leaves of about 1 cm square in a culture dish with sterile water added, avoiding the thick leaf veins. The leaves were added to a 50ml FALCON tube with 27ml sterile water, and 3ml of the infection solution was added and stirred thoroughly. The leaves were immersed in the infection solution for 10 minutes. The leaves were taken out onto sterile wipes (KIMTOWEL) and the excess bacterial solution was absorbed. Planted in MS redifferentiation medium supplemented with acetosyringone, and co-cultured at 28°C in complete darkness for 48 hours. About 16 to 25 co-cultured leaves were planted per culture dish on MS medium supplemented with carbenicillin and cefotaxime, and cultured in complete darkness for 1 week. After 1 week, culture was carried out at 25°C, 16 hours of light / 8 hours of darkness. Then, the culture medium was replaced every week for subculturing.

[0128] (Agarose electrophoresis)

[0129] In agarose electrophoresis of DNA, Tris-acetate-EDTA (TAE) electrophoresis buffer (50×) (manufactured by CosmoBio) was diluted 50 times with DW to prepare an electrophoresis buffer. As an agarose gel, a 1% agarose gel prepared by adding 1% Agarose L03 (manufactured by Takara Bio) to the buffer, heating and dissolving it, and solidifying it in a gel tray was used.

[0130] (Gel Extraction)

[0131] After agarose electrophoresis, DNA was extracted from the gel using FastGene Gel / PCR Extraction Kit (manufactured by Nippon Genetics) according to the attached instruction manual.

[0132] (Restriction enzyme treatment)

[0133] All restriction enzyme treatments were performed using enzymes manufactured by Takara Bio, Inc., according to the attached instructions.

[0134] (Fusion Reaction)

[0135] Fusion (In Fusion) reaction is a reaction that can combine these DNAs when there is a homologous sequence of 15bp at the two DNA ends. For cloning based on fusion reaction, PrimeSTAR Max (manufactured by Takara Bio) was used to perform PCR according to the attached instructions, and In Fusion HD Cloning Kit (manufactured by Takara Bio) was used to react the PCR product with the vector linearized by restriction enzyme treatment according to the attached instructions. The vector circularized by fusion reaction was transformed into Escherichia coli, and the vector was confirmed by colony PCR.

[0136] The basic procedure of PCR using Prime STAR MAX is as follows.

[0137] [Table 1]

[0138]

[0139] (Colony PCR)

[0140] Using Emerald Amp (manufactured by Takara Bio), the transformed Escherichia coli colonies were collected with the tip of a 2 μl pipette tip according to the attached instructions, and PCR was performed.

[0141] The basic procedure of PCR using Emerald Amp is shown below.

[0142] [Table 2]

[0143]

[0144] (Genome Purification)

[0145] The reaction was carried out using Plant DNA Isolation Reagent (manufactured by Takara Bio) according to the attached instruction manual.

[0146] (Genomic PCR)

[0147] The total genome was adjusted to 50 ng / μl and used as a template. PCR was performed using Ex-Taq (manufactured by Takara Bio) according to the attached instruction manual.

[0148] The basic procedure is shown below.

[0149] [Table 3]

[0150]

[0151] (Blunt-end cloning)

[0152] Cloning was performed using Mighty Cloning Reagent Set (manufactured by Takara Bio) according to the attached instructions. The attached BAP-treated pUC118 was used as the cloning vector.

[0153] (CAPS analysis)

[0154] CAPS (Cleaved Amplified Polymorphic Sequence) analysis is performed by amplifying PDS3 as a target sequence using Prime STARMAX. In PDS3, the sequence that is cut by the restriction enzyme BlnI is located just before the PAM sequence. Therefore, when a mutation is introduced into the recognition sequence of the restriction enzyme, PDS3 cutting by BlnI cannot be performed, and therefore, mutants can be detected by whether the restriction enzyme does not cut.

[0155] (Sequence Analysis)

[0156] DNA sequencing was performed using Big Dye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) according to the instructions attached. Then, ethanol precipitation was performed, and after dissolution with formamide, sequencing was performed according to the instructions of ABI3130 sequencer. Analysis was performed using Finch TV.

[0157] (Example 1) Switch on GFP vector

[0158] In order to prepare genome-edited plants, the present inventors have conceived a method of transiently expressing foreign genes such as artificial restriction enzyme genes that cause mutations without introducing them into the plant genome. Figure 2 and 3 The method for expressing artificial restriction enzymes and the like in plant cells (genome editing system) and the DNA construct used in the method are shown.

[0159] Then, in order to verify the gene that can cut out the circular DNA and transiently express the circular DNA before the DNA construct is introduced into the plant genome, the following Figure 4 Switch on GFP vector as shown.

[0160] The main feature of the Switch on GFP vector is that the gfp used as a reporter gene is segmented and introduced. That is, by using the Agrobacterium method of this vector, the T-DNA between LB and RB in this vector is introduced into plants, and the intcre in the T-DNA is transiently expressed. Then, it is cut off by the recombination between loxPs using this enzyme, and circularization occurs, and the result is that the segmented gfp gene is reconfigured, and the GFP encoded by this gene is expressed. Therefore, by detecting the expression of this GFP, the generation of circular DNA and its stability can be confirmed. It should be noted that "intcre" and "intron cre" refer to the Cre recombinase gene in which an intron is inserted in the first half of the coding part.

[0161] Then, the Switch on GFP vector designed in this way was prepared as follows. First, a T-DNA region having MCS (multiple cloning site), RB, OD and LB×2 was synthesized and cloned into pUC57. Then, nptIII and Ri-Ori of the pRI201 vector were amplified by PCR using the following primers (1) and (2) and inserted into the EcoRV site.

[0162] We synthesized lox intron GFP in which a KOR1 intron from Arabidopsis thaliana containing a 34 bp loxP sequence was introduced into the inner side of the gfp coding region. The integration position of the KOR1 intron was determined considering the consensus region of plant introns (ag / / gtaagt――――tgcaag / / g). The following two types of KOR1 introns from Arabidopsis thaliana containing a 34 bp loxP sequence were used.

[0163] lox-intron(KOR1)01 (Serial number: 1)

[0164] GTAAGTCTTCTTTTCCTTTACTCTTTACAGAAATGGTAATCTCAGATATAGTAAataacttcgtataatgtatgctatacgaagttatTGGATAAGATCCAAAAATGACACTTTTAACCAAGATTGTACGAAGATCTTTTTAAACTCCATTTTTTATTTTGACATCTAAATTGGATTTAACTCGGCCTTGCTGTATTTTGGCAG

[0165] lox-intron(KOR1)02 (Serial number: 2)

[0166] GTAAGTCTTCTTTTCCTTTACTCTTTACAGAAATGGTAATCTCAGATATAGTAATGGATAAGATCCAAAAATGACACTTTTAACCAAataacttcgtataatgtatgctatacgaagttatGATTGTACGAAGATCTTTTTAAACTCCATTTTTTATTTTGACATCTAAATTGGATTTAACTCGGCCTTGCTGTATTTTGGCAG

[0167] In the above two sequences, capital letters represent the sequence of the KOR1 intron from Arabidopsis thaliana (171 bp), and lowercase letters represent the loxP sequence (34 bp).

[0168] By using restriction enzyme cleavage and fusion reaction of PCR amplified fragments, Figure 4 The introduction of the Switch on vector backbone shown above into each restriction enzyme site in MCS is outlined below.

[0169] lox intron Gfp

[0170] The restriction enzyme sites of lox intron Gfp were divided into two parts and introduced. The part from the 35S promoter to the end of the intron was amplified by PCR using the following primers (3) and (4), and the SmaI site was introduced. In addition, the part from the beginning of the intron to the HST (heat shock protein terminator) was amplified by PCR using the following primers (7) and (8), and the Kpn site was introduced.

[0171] intron cre

[0172] The intron cre containing the 35S promoter and HST obtained by gene synthesis was amplified using the following primers (5) and (6), and the SmaI site was introduced together with the upstream part of the lox intron Gfp.

[0173] In addition, as described later, when the following genes were inserted into the Switch on GFP vector, the following was performed.

[0174] a-ipt、35S-ipt

[0175] The a-ipt having a promoter from the Agrobacterium pO22 system provided by Hiroetsu Ihiko of Akita Prefectural University was amplified using the following primers (13) and (14), and the EcoRI site was introduced. In addition, the 35S-ipt having a 35S promoter was introduced into the same site using the following primers (9) and (10).

[0176] iaaH、iaaM

[0177] When iaaH having a 35S promoter and HSP was introduced into a-ipt, the following primers (15) and (16) were used for amplification. When 35S-ipt was introduced, the following primers (11) and (12) were used for amplification, and EcoRI sites were introduced. The following primers (17) and (18) were used to amplify iaaM having the same promoter and terminator, and a HindIII site was introduced.

[0178] SgRNA (Single-guide RNA) of Cas9 and PDS3

[0179] Cas9 with the PCubi ubiquitin promoter from parsley and the Pea3A terminator from soybean, and SgRNA PDS3 with the AtU-6 promoter from Arabidopsis thaliana, provided by Mr. Seiichi Toki of the National Research and Development Corporation Agrobioscience Research Institute (now: National Agricultural / Food Technology Agency), were amplified using the following primers (19) and (20), and the NotI site was introduced.

[0180] It should be noted that the genes inserted in this way are all optimized for the codon usage frequency in the tobacco when synthesized. In addition, the sequence of the above-mentioned primers is shown below, and the positional relationship of these sequences is shown in Figure 6 .

[0181] Insertion of Ri-Ori nptIII into EcoRV site

[0182] Primer (1) Ri-NPT-F

[0183] 5'AGCTCGGCACAAGATGATCCTACAAGGTAG 3'

[0184] (Sequence number: 3, Tm: 59.2℃).

[0185] Primer (2) Ri-NPT-R

[0186] 5'AAAGAGCGTTTAGATGTTGCCATGTTTTAC 3'

[0187] (Sequence number: 4, Tm: 53.7℃).

[0188] Insertion of lox intron Gfp into SmaI site

[0189] Primer (3) lox-GUS-F

[0190] 5'GGATCCGAATTCCCCGTCCCCAGATTAGCC 3'

[0191] (Sequence number: 5, Tm: 63.3℃).

[0192] Primer (4) Out-SmaI (GF-I)-R

[0193] 5'ACTTCCTGCAGGCCCCTGCCAAAATACAGC 3'

[0194] (Sequence number: 6, Tm: 61.9℃).

[0195] Insertion of Intron Cre into SmaI site

[0196] Primer (11) lox-iaaH-F

[0197] 5'GTCCCCAGATTAGCCTTTTCA 3'

[0198] (Sequence number: 7, Tm: 48.6℃).

[0199] Primer (6) Out-SmaI (HSP-T)-R

[0200] 5'ACTTCCTGCAGGCTTATCTTTAATCAT 3'

[0201] (Sequence number: 8, Tm: 56.5℃).

[0202] Insertion of lox intron Gfp into KpnI site

[0203] Primer (7) Out-KpnI (IP)-F (end)

[0204] 5'GATAGTTTAAACTGGGTAAGTCTTCTTTTC 3'

[0205] (Sequence number: 9, Tm: 52.4℃).

[0206] Primer (8) Out-KpnI (HSP-T)-R

[0207] 5'AAGCTTGCGGCCGCCGCTTATCTTTAATCAT 3'

[0208] (Sequence number: 10, Tm: 57.8°C).

[0209] Insertion of a-Ipt and iaaH into EcoRI site

[0210] Primer (9) lox-ipt-F

[0211] 5'GCTTGGATCCGAATTGTCCCCAGATTAGCC 3'

[0212] (Sequence number: 11, Tm: 60.6℃).

[0213] Primer (10) lox-ipt-R

[0214] 5'GGCTAATCTGGGGACCTTATCTTTAATCAT 3'

[0215] (Sequence number: 12, Tm: 55.1℃).

[0216] Primer (11) lox-iaaH-F

[0217] 5'GTCCCCAGATTAGCCTTTTCA 3'

[0218] (Sequence number: 7, Tm: 48.6℃).

[0219] Primer (12) lox-iaaH-R

[0220] 5'TGGGGACGGGGAATTCTTATCTTTAATCAT 3'

[0221] (Serial number: 13, Tm: 55.0℃).

[0222] Insertion of 35S-ipt and iaaH into EcoRI site

[0223] Primer (13) lox-ipt-F

[0224] 5'GCTTGGATCCGAATTGTCCCCAGATTAGCC 3'

[0225] (Sequence number: 11, Tm: 60.6℃).

[0226] Primer (14) lox-SmaI (HSP-T)-R

[0227] 5'CTTATCTTTAATCATATTCCA 3'

[0228] (Sequence number: 14, Tm: 38.8℃).

[0229] Primer (15) lox-SmaI (HSP-T / ipt)-F

[0230] 5'ATGATTAAAGATAAGCAACGAAGGTAATGG 3'

[0231] (Sequence number: 15, Tm: 52.4℃).

[0232] Primer (16) lox-EcoRI(a-ipt-T)-R

[0233] 5'TTATCCTGCAGGCCCACGAATATCCGTGAC 3'

[0234] (Sequence number: 16, Tm: 60.6℃).

[0235] Insertion of iaaM into HindIII site

[0236] Primer (17) Out-HindIII (35S-P)-F

[0237] 5'GCGCGGCCGCAAGCTGTCCCCAGATTAGCC 3'

[0238] (Sequence number: 17, Tm: 67.4℃).

[0239] Primer (18) lox-HindIII (HSP-T)-R

[0240] 5'ATTCGGATCCAAGCCTCTTATCTTTAATCAT 3'

[0241] (Sequence number: 18, Tm: 52.4°C).

[0242] Insertion of Cas9 and PDS3 into the NotI site of sgRNA

[0243] Primer (19) lox-NotI (cas9-P)-F

[0244] 5'GATGGTACCGCGGCCCTAGCAACGATTGTA 3'

[0245] (Sequence number: 19, Tm: 61.9℃).

[0246] Primer (20) lox-NotI (SgRNA-T)-R

[0247] 5'GGACAGCTTGCGGCCCAACTTTGTACAAGA 3'

[0248] (Sequence number: 20, Tm: 60.6℃).

[0249] (Example 2) Verification of the effect of Switch on GFP vector based on transient analysis

[0250] When verifying whether circular DNA was generated by the Agrobacterium method using the Switch on GFP vector, first, we confirmed whether the splicing of the gfp gene with the loxP-introduced intron occurred normally in plant cells and GFP was expressed. Figure 7 Two lox intron GFP vectors with different loxP sequence positions and a GFP vector as a control were infiltrated into Nicotiana benthamiana by agroinfiltration.

[0251] As a result, if Figure 8 and Fig. 9 As shown, GFP fluorescence was observed, confirming that splicing of the inserted intron occurred normally and the lox intron GFP gene was functional.

[0252] Next, to verify whether circular DNA was generated by Agrobacterium tumefaciens using the Switch on GFP vector, Fig.10 The two switch on GFP vectors and the control GFP vector were again infiltrated into Nicotiana benthamiana by agroinfiltration, and GFP fluorescence was observed.

[0253] The results are as follows Fig.11 and 12 As shown, GFP fluorescence was detected, confirming that circular DNA was generated by the Agrobacterium method using the Switch on GFP vector. However, the fluorescence intensity when the Switch on GFP vector was introduced was about one-tenth of that of the control.

[0254] Then, if Fig.13 As shown in FIG. 1 , the Switch on GFP vector into which ipt and iaaH were introduced was used for Agrobacterium infiltration, and GFP fluorescence observation was performed. Fig.14 and 15 As shown, the fluorescence intensity of the Switchon GFP vector was increased to 45% of the control by inserting ipt and iaaH.

[0255] In addition, the Switch on GFP vector was used for Agrobacterium infiltration, and GFP fluorescence observation and circular DNA detection based on genomic PCR were performed on days 7 and 35 after infection. Fig.16 As shown, GFP fluorescence could also be observed on day 35 after infection, and Fig.17 As shown, the results of genomic PCR showed that circular DNA was maintained.

[0256] The above results confirmed that circular DNA was excised by the Agrobacterium infiltration method using the Switch on GFP vector. Furthermore, it was found that the excised circular DNA was maintained until the 35th day.

[0257] It was also clarified that the expression of GFP was improved by inserting ipt and iaaH into the Switch on GFP vector. The reason for this improvement has not been determined, but the inventors speculate as follows. It is believed that the expression of GFP was poor due to the adjacent state of the terminator (Ter) and the promoter (35SP), but the insertion of ipt and iaaH eliminated this state, thereby improving the expression of GFP. In addition, the expression of the inserted ipt gene may have improved the expression of GFP by promoting the effect of the hormone of biosynthesis.

[0258] (Example 3) Genome editing using the Switch on GFP vector

[0259] By using the Switch on GFP vector, we verified whether it is possible to change the target gene (genome editing) as proposed above without introducing it into the plant genome.

[0260] This time, the PDS (phytoene desaturase) gene was selected as the target of genome editing. In addition, the target sequence in genome editing was set to the third exon of the gene (PDS3) (refer to Fig.18 ).

[0261] Then, when attempting to edit the genome of this gene, we first performed sequencing analysis to determine the sequence of the PDS3 gene of SR1 tobacco (N. tabacum). Fig.18 PDS3 was amplified using the primer sets (1) and (2) shown in the figure. Then, the blunt-end was cloned into pUC118 and colony PCR was performed. The results were as follows: Fig.19 As shown, 1 or 2 bands were obtained.

[0262] Next, plasmids were extracted from each of the four colonies that obtained one or two bands, and sequencing analysis was performed. As a result, two sequences with different homologies were obtained. This is presumably because the genome of SR1 is a heterodiploid (2n=24) with N. sylvestris (2n=12: SS) and N. tometosiformis (2n=12: TT). In fact, the result of sequencing one band showed that the obtained sequence had high homology with N. sylvestris. In addition, the result of sequencing two bands showed that they had high homology with N. tometosiformis.

[0263] Based on the above results, the results of cloning into pUC118 and analyzing the PDS3 gene by colony PCR showed that when one band was detected, it was from the genome of N. sylvestris, and when two bands were detected, it was from N. tometosiformis.

[0264] Next, we tried mutation introduction using the Switch on GFP vector. It should be noted that the CRISPR / Cas9 system was introduced into the Switch on GFP vector for mutation introduction. That is, DNA encoding Cas9 and SgRNA for PDS3 was introduced into the above vector. In addition, iaaM was introduced to improve the callus formation ability in hormone-free medium, and a Fig. 20 The switch on GFP vector was used for mutation introduction. Next, an infection experiment was performed on tobacco (SR1) using the immersion method to attempt mutation introduction based on Cas9.

[0265] As a result, if Fig.21 As shown in Figure 2, callus tissue can be induced from leaves of SR1 into which the Switch on GFP vector has been introduced. In addition, two callus tissues were randomly sampled from two experimental plots on days 39 and 45 after infection, and the callus tissues were randomly sampled from two experimental plots on days 39 and 45 after infection. Fig.18 PDS3 was amplified by PCR using primers (1) and (2) shown in FIG. 1 . Then, the amplified fragment was subjected to CAPS analysis to detect the introduction of mutations. The results confirmed that Fig. 22 As shown, in one callus in each experimental area, a mutation was introduced into the target sequence PDS3.

[0266] In addition, use Fig.18 The fragment amplified by primers (1) and (2) was blunt-ended and cloned into pUC118 using the Mighty Cloning Regent Set. The colonies obtained by this cloning were screened by blue-white screening and using Fig.18The insertion of the amplified fragment was confirmed by colony PCR using primers (3) and (4) shown above. Then, the reaction solution of colony PCR was treated with BlnI to confirm that a mutation was introduced into the target sequence (refer to Fig.23 and 24 ). In addition, sequencing analysis was performed on the clones that were not cut, and the results are shown in Table 4 below, confirming substitution or short deletion of the DNA sequence.

[0267] [Table 4]

[0268]

[0269] In the sequences of Table 4, "-" indicates a site deleted compared with the wild type (WT), and bases expressed in lower case letters indicate sites substituted by the wild type (WT).

[0270] As described above, the results of CAPS analysis and sequencing analysis indicate that the genome editing system can be expressed in plant cells and mutations can be introduced into the target gene using the Switch on GFP vector.

[0271] It should be noted that Fig.18 The sequences of the primers (1) to (4) shown and the primers used in the above sequencing analysis of the uncut clones are as follows.

[0272] Blunt-end cloning of PDS3

[0273] Primer (1) NtPDS (1866-1892SG) F

[0274] 5'ACATATAGGGGTTGCACTCTTCTAAGG 3'

[0275] (Sequence number: 27, Tm: 54.4℃).

[0276] Primer (2) NtPDS (2993-3017c) R

[0277] 5'CCCAGTCTCATACCAATCTCCATCA 3'

[0278] (Sequence number: 28, Tm: 53.9℃).

[0279] Colony PCR of PDS3

[0280] Primer (3) PDS3-F2 (Affrc)

[0281] 5'GTATTGTCATCAACTGGTTGATTATCTGAGTACC 3'

[0282] (Serial number: 29, Tm: 57.0℃).

[0283] Primer (4) PDS3-R2 (Affrc)

[0284] 5'CTTTCCATATCTTTTACCTAATATGCTG 3'

[0285] (Sequence number: 30, Tm: 50.3℃).

[0286] Sequencing analysis of PDS3

[0287] PUC M4

[0288] 5'GTTTTCCCAGTCACGAC 3'

[0289] (Sequence number: 31, Tm: 43.2℃).

[0290] PUC RV

[0291] 5'CAGGAAACAGCTATGAC 3'

[0292] (Sequence number: 32, Tm: 40.8℃).

[0293] (Example 4) Preparation of genome-edited individuals by introduction of the Switch on GFP vector

[0294] Using the Switch on GFP vector, we conducted infection experiments on SR1 tobacco plants by the Agrobacterium immersion method and screened for recombinant individuals with circular DNA. In addition, we studied the plant hormone genes introduced into T-DNA and culture conditions in order to improve the screening effect and promote cell proliferation during infection.

[0295] Specifically, if Fig.25 As shown in the figure, three Cas9 mutation-introduced Switch on GFP vectors with a combination of altered plant hormone genes were prepared and used. It should be noted that by introducing the auxin precursor synthesis gene iaaM into the vector with iaaH, auxin synthesis in hormone-free medium was promoted. In addition, without introducing iaaM, MS medium to which NAM (naphthylacetamide), an analog of auxin precursor, was added was used to study the conditions for promoting auxin synthesis. More specifically, Fig.25 Tobacco leaves introduced with construct A were cultured in MS medium, tobacco leaves introduced with construct B were cultured in MS medium or MS NAM medium, and tobacco leaves introduced with construct C were cultured in MS medium or MS NAM medium.

[0296] Infection experiments were conducted on 20 leaves each under the above five culture conditions, and callus tissues were obtained in the amount of 18 leaves (6 leaves in the MS medium of construct A, 2 leaves in the MS medium of construct B, 5 leaves in the MS NAM medium of construct B, and 5 leaves in the MS medium of construct C). It should be noted that no difference in callus formation ability due to the combination of plant hormone genes in the vector or the presence or absence of NAM in the MS medium could be confirmed.

[0297] In addition, if Fig.26 As shown, GFP fluorescence was observed in 5 of the 18 callus-organized leaves (2 leaves in the MS medium of construct A, 2 leaves in the MS NAM medium of construct B, and 1 leaf in the MS medium of construct C).

[0298] In addition, the callus-forming parts of these leaves were sampled and genomes were extracted using Fig. 27 PCR analysis was performed using the primer sets shown. The results were as follows: Fig.28 As shown, gfp (circular DNA) and Cas9 were detected. In addition, the results shown in Example 3 also detected mutation introduction by CAPS analysis.

[0299] It should be noted that Fig.28 The sequences of primers (1) to (4) are as follows.

[0300] Detection of gfp (circular DNA)

[0301] Primer (1) pRI-GFP F

[0302] 5'CACTGTTGATACATATGGTGAGCAAGGGCG 3'

[0303] (Sequence number: 33, Tm: 59.2℃).

[0304] Primer (2) pRI-GFP R

[0305] 5'CTTCATCTTCATAAGTTACTTGTACAGCTC 3'

[0306] (Sequence number: 34, Tm: 53.7℃).

[0307] Detection of Cas9

[0308] Primer (3) FFCas9-113F

[0309] 5'CCGATAGGCACTCTATCAAG 3'

[0310] (Serial number: 35, Tm: 48.0℃).

[0311] Primer (4) FFCas9-640R

[0312] 5'CAGAGAGGATAGCCTTAGCA 3'

[0313] (Serial number: 36, Tm: 48.0℃).

[0314] (Example 5) Preparation of Genome Edited Individuals by Switch on GFP Vector Introduction 2

[0315] As in Example 4, Fig.25 The mutation of the construct shown in B was introduced into the Switch on GFP vector and infection was carried out. As a result of the infection experiment on 16 leaves each, 29 calli were obtained using MS medium. In addition, GFP fluorescence was detected in 12 of the 29 calli, and the calli in which GFP fluorescence was detected were screened. In addition, among the 12 calli screened by GFP fluorescence, mutation introduction was detected in 3 calli by CAPS analysis. Mutation-introduced calli that were considered to have no random insertion into the genome were obtained.

[0316] (Comparative Example 1) Preparation of genome-edited individuals by introduction of a Switch on GFP vector (without a Cre cassette)

[0317] Use with Fig.25 The construct shown in B but without the Cre recombinase expression cassette (intcre) outside was introduced into the Switch on GFP vector, and infection was carried out by the same method as in Example 4. As a result of the infection experiment on 20 leaves each, 40 calli were obtained using MS medium. However, among the 40 calli, no calli with GFP fluorescence were obtained. In addition, among the 40 calli, no calli with mutation introduction detected by CAPS analysis were obtained.

[0318] According to the results shown in the above examples and comparative examples, in the present invention, since the DNA excised by Cre recombinase is circularized, GFP fluorescence can be expressed. Therefore, it can be seen that screening callus using this fluorescence as an indicator is effective for obtaining mutation-introduced callus.

[0319] Industrial Applicability

[0320] As described above, according to the present invention, the sequence of the target gene can be changed in plant cells without introducing exogenous genes such as coding genome editing systems into the genome, which is advantageous in terms of safety. In addition, according to the present invention, the genome editing system can be stably expressed for a certain period of time, so that genome editing can be performed with high efficiency. Therefore, the present invention is useful in crop breeding, production of useful materials, variety improvement, functional analysis of target genes, etc.

Claims

1. A DNA construct, which is a DNA construct for expressing a genome editing system in a plant cell, It comprises a region to be excised which is sandwiched between a first recombinase recognition site located on the 5' side and a second recombinase recognition site located on the 3' side. The first recombinase recognition site and the second recombinase recognition site are oriented in the same direction. A gene encoding a site-specific recombinase that specifically recognizes the first and second recombinase recognition sites is arranged outside at least one side of the excised region, The excised region includes a gene encoding the genome editing system and a marker gene divided into a 5' region and a 3' region in an intron, the 3' region of the marker gene is adjacent to the 3' end of the first recombinase recognition site, the 5' region of the marker gene is adjacent to the 5' end of the second recombinase recognition site, and the gene encoding the genome editing system is arranged between the 3' region and the 5' region of the marker gene, and When introduced into plant cells, the site-specific recombinase is expressed to excise the excised region and circularize it, so that the 5' region and the 3' region are combined with the recombinase recognition site sandwiched therebetween, thereby enabling the expression of the marker gene. in, The site-specific recombinase is Cre recombinase, The first and second recombinase recognition sites are loxP sequences, The DNA construct further comprises a right border sequence (RB) and a left border sequence (LB) from the T-DNA sequence of Agrobacterium, and the excised region and the gene encoding the site-specific recombinase are arranged in the transfer region sandwiched by the RB and LB.

2. The DNA construct according to claim 1, wherein The marker gene is a fluorescent protein gene, a luminescent enzyme gene, a color developing enzyme gene or a drug resistance gene.

3. The DNA construct according to claim 1, wherein In the excised region, a foreign gene is further included between the 3' region and the 5' region of the marker gene.

4. The DNA construct according to claim 3, wherein The exogenous gene is a plant hormone biosynthesis gene.

5. A method for producing genome-edited plant cells, the method comprising the following steps (1) to (3): (1) A step of introducing the DNA construct according to any one of claims 1 to 4 into a plant cell; (2) a step of screening, using the expression of the marker gene as an indicator, cells obtained in the step into which the DNA construct has been introduced and into which the excised region has been circularized; and (3) Further screening cells in which the sequence of the target gene is altered from the cells screened by the above steps.

6. A method for producing a genome-edited plant, the method comprising the following steps (1) to (4): (1) A step of introducing the DNA construct according to claim 4 into a plant cell; (2) a step of screening, using the expression of the marker gene as an indicator, cells obtained in the step for cells into which the DNA construct has been introduced and into which the excised region has been circularized; (3) culturing the cells obtained in the above step to generate plant tissues, and screening plant tissues that have undergone morphological changes using the morphological changes of the plant tissues caused by the expression of the plant hormone biosynthesis gene on the DNA construct as an indicator; and (4) Further screening plant tissues in which the sequence of the target gene is altered from the plant tissues screened by the above steps.

Images