DNA cleavage agent

Abstract

The present invention describes a Defluviimonas sp. 20V17 New bacterial nucleases of the CRISPR‑Cas9 system, and their use to form strictly specific double-strand breaks in DNA molecules. This nuclease has unusual properties and can be used as a tool for introducing changes at strictly defined sites in the genomic DNA sequences of unicellular and multicellular organisms. Thus, the present invention increases the versatility of available CRISPR‑Cas9 systems, which enables the use of Cas9 nucleases from various organisms for cutting genomic DNA or plasmid DNA at a large number of specific sites and under a variety of conditions.

Description

Technical Field

[0001] The present invention relates to biotechnology for cutting DNA and editing the genomes of various organisms, and in particular to new Cas nucleases of the CRISPR-Cas system. This technology may be used in gene therapy for hereditary human diseases in the future, as well as for editing the genomes of other organisms. Background Art

[0002] Modification of DNA sequences is one of the hot issues in biotechnology today. Editing and modifying the genomes of eukaryotes and prokaryotes, as well as manipulating DNA in vitro, requires the targeted introduction of double-strand breaks within the DNA sequence.

[0003] To solve this problem, the following technologies are currently used: artificial nuclease systems containing zinc finger-type domains, TALEN systems, and bacterial CRISPR-Cas systems. The first two technologies require laborious optimization of the nuclease amino acid sequence for recognizing specific DNA sequences. In contrast, when it comes to the CRISPR-Cas system, the structure that recognizes the DNA target is not a protein, but a short guide RNA. The cutting of a specific DNA target does not require the synthesis of nucleases or their genes from scratch, but is accomplished by using guide RNAs that are complementary to the target sequence. This makes the CRISPR Cas system a convenient and effective means for cutting various DNA sequences. This technology allows the use of guide RNAs of different sequences to cut DNA simultaneously at several regions. This method is also used to modify several genes in eukaryotes at the same time.

[0004] By its nature, the CRISPR-Cas system is a prokaryotic immune system that can introduce breaks into viral genetic material with high specificity (Mojica FJM et al. Intervening sequences of regularly spaced prokaryotic repeats derive from foreign genetic elements / / Journal ofmolecular evolution. – 2005. – Volume 60 – Issue 2 – Pages 174-182). The abbreviation CRISPR-Cas stands for "clustered regularly spaced short palindromic repeats and CRISPR-associated genes" (Jansen R. et al. Identification of genes that are associated with DNA repeats in prokaryotes / / Molecularmicrobiology. – 2002. – Volume 43 – Issue 6 – Pages 1565-1575). All CRISPR-Cas systems consist of a CRISPR box and genes encoding various Cas proteins (Jansen R. et al., Molecular microbiology. – 2002. – Volume 43 – Issue 6 – Pages 1565-1575). The CRISPR box consists of a spacer region and repeated palindromic repeats each having a unique nucleotide sequence (Jansen R. et al., Molecular microbiology. - 2002. - Vol. 43 - No. 6 - Pages 1565-1575). The transcription of the CRISPR box is then processed for it, resulting in the formation of a guide crRNA, which together with the Cas protein forms an effector complex (Brouns SJJ et al. Small CRISPR RNAs guide antiviral defense in prokaryotes / / Science. - 2008. - Vol. 321 - No. 5891 - Pages 960-964). Due to the complementary pairing between crRNA and the target DNA site (which is called the protospacer), the Cas nuclease recognizes the DNA target and introduces a break therein with high specificity.

[0005] CRISPR-Cas systems with a single effector protein are grouped into six different types (types I-VI), depending on the Cas protein included in the system. Type II CRISPR-Cas9 systems are characterized by their simple composition and activity mechanism, i.e., their function requires the formation of an effector complex consisting of only one Cas9 protein and two short RNAs as follows: crRNA and tracer RNA (tracrRNA). The tracer RNA complementarily pairs with the crRNA region derived from the CRISPR repeats to form the secondary structure necessary for the binding of the guide RNA to the Cas effector. The Cas9 effector protein is an RNA-dependent DNA endonuclease with two nuclease domains (HNH and RuvC), which introduce breaks into the complementary strands of the target DNA, thus forming double-stranded DNA breaks (Deltcheva E. et al. CRISPR RNA maturation by trans-encoded small RNA and host factor RNaseIII / / Nature. - 2011. – Vol. 471 – No. 7340 – p. 602).

[0006] To date, several CRISPR-Cas nucleases that can introduce double-strand breaks into DNA in a targeted and specific manner are known. One of the main characteristics that limits the use of the CRISPR-Cas system is the PAM sequence, which flanks the DNA target from the 3' end and whose presence is required for the DNA to be correctly recognized by the Cas9 nuclease. Various CRISPR-Cas proteins have different PAM sequences, which limits the potential for using nucleases at any DNA region. The use of CRISPR-Cas proteins with new and various PAM sequences is necessary to enable modification of any DNA region both in vitro and in the genome of living organisms. Modification of the eukaryotic genome also requires the use of small-sized nucleases to provide AAV-mediated delivery of the CRISPR-Cas system into cells.

[0007] Although many techniques for cutting DNA and modifying genomic DNA sequences are known, there is still a need for new and efficient means for modifying DNA in various organisms and at strictly specific sites of DNA sequences. The present invention provides many of the properties necessary to solve this problem. Summary of the invention

[0008] The purpose of the present invention is to provide new methods for modifying genomic DNA sequences of unicellular or multicellular organisms using the CRISPR-Cas9 system. Current systems are of limited use due to the specific PAM sequence that must be present at the 3' end of the DNA region to be modified. The search for new Cas9 enzymes with other PAM sequences will expand the range of available means for forming double-strand breaks at desired strictly specific sites in DNA molecules of various organisms. To address this issue, the authors made a Defluviimonas sp. The invention is characterized in that the type II CRISPR nuclease DfCas9 of 20V17 can be used to introduce targeted modifications into the genome of both the above-mentioned organisms and other organisms. The invention is characterized in that it has the following basic characteristics: (a) a short PAM sequence that is different from other known PAM sequences; (b) a relatively small size of the characterized DfCas9 protein, which is 1079 amino acid residues (aar).

[0009] The problem is solved by using a protein comprising an amino acid sequence of SEQ ID NO: 1, or an amino acid sequence having at least 95% identity with the amino acid sequence of SEQ ID NO: 1 and differing from SEQ ID NO: 1 only in non-conservative amino acid residues, to form a double-strand break in a DNA molecule located immediately before the nucleotide sequence 5'-NN(G / A)NA(C / T)N-3' in the DNA molecule. In some embodiments of the invention, this use is characterized in that the double-strand break is formed in the DNA molecule at a temperature of 35°C to 37°C and in the presence of Mn2+ ions. In a preferred embodiment of the invention, this use is characterized in that the Mn2+ ion concentration is greater than 5 mM.

[0010] The problem is further solved by providing a method for generating a double-strand break in a genomic DNA sequence of a unicellular organism or a multicellular organism directly adjacent to the sequence 5'-NN(G / A)NA(C / T)N-3', the method comprising introducing into at least one cell of the organism an effective amount of: a) a protein comprising the amino acid sequence of SEQ ID NO: 1 or a nucleic acid encoding the protein comprising the amino acid sequence of SEQ ID NO: 1, and b) a guide RNA comprising a sequence that forms a duplex with a nucleotide sequence of a genomic DNA region of the organism directly adjacent to the nucleotide sequence 5'-NN(G / A)NA(C / T)N-3' and interacts with the protein after duplex formation, or a DNA sequence encoding the guide RNA, wherein the interaction between the protein and the guide RNA and the nucleotide sequence 5'-NN(G / A)NA(C / T)N-3' results in the formation of a double-strand break in the genomic DNA sequence directly adjacent to the sequence 5'-NN(G / A)NA(C / T)N-3'. In some embodiments of the present invention, the method is characterized in that it further comprises introducing an exogenous DNA sequence simultaneously with the guide RNA.

[0011] A mixture of crRNA and tracer RNA (tracrRNA) that can form a complex with the target DNA region and the DfCas9 protein can be used as a guide RNA. In a preferred embodiment of the present invention, a hybrid RNA constructed based on crRNA and tracer RNA can be used as a guide RNA. The method for constructing a hybrid guide RNA is known to technicians (Hsu PD et al., DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol. 2013 Sep; 31 (9): 827-32). One of the methods for constructing a hybrid RNA has been disclosed in the examples below.

[0012] The present invention can be used for cutting target DNA in vitro, and can also be used to modify the genome of some living organisms. The genome can be modified in a direct way, i.e., by cutting the genome at the corresponding site, and by inserting exogenous DNA sequences through homologous repair.

[0013] Any region of double-stranded or single-stranded DNA from the genome of an organism other than that used for administration (or a composition between these regions and with other DNA fragments) can be used as an exogenous DNA sequence, wherein the region (or a composition of regions) is expected to be integrated into the double-strand break site in the target DNA induced by the DfCas9 nuclease. In some embodiments of the present invention, a double-stranded DNA region from the genome of an organism used to introduce the DfCas9 protein, but further modified by mutation (substitution of nucleotides) and insertion or deletion of one or more nucleotides, can be used as an exogenous DNA sequence.

[0014] The technical result of the present invention is to increase the versatility of available CRISPR-Cas9 systems to enable the use of Cas9 nucleases for cleaving genomic DNA or plasmid DNA at a large number of specific sites and under specific conditions. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 . Defluviimonas sp. Schematic representation of the CRISPR locus in .

[0016] Figure 2 . Development of a system for cleavage of DNA restricted to the sequence NN(G / A)NA(C / T)N.

[0017] Figure 3 . Schematic representation of the interaction between the guide RNA and a region of the target DNA.

[0018] Figure 4 . Dependence of DNA cleavage reaction efficiency on the presence of ions.

[0019] Figure 5 . Examination of protein activity in cleaving various DNA targets.

[0020] Figure 6 . In vitro cleavage reaction of DNA fragments of human grin2b gene.

[0021] Figure 7 . Effect of ion concentration on the efficiency of DNA cleavage reactions.

[0022] Figure 8 . Selection of sgRNA sequences.

[0023] Fig. 9 Alignment of the initial parts of the Cas9 protein sequences from Staphylococcus aureus (SaCas9), Campylobacter jejuni (CjCas9), and DfCas9 organisms. Non-conserved regions of the sequences are underlined. DETAILED DESCRIPTION

[0024] As used in the description of the present invention, the terms "includes" and "including" should be interpreted to mean "including the like". The terms are not intended to be interpreted as "consisting only of". Unless defined separately, technical and scientific terms in this application have typical meanings generally accepted in scientific and technical literature.

[0025] As used herein, the term "percent homology of two sequences" is equivalent to the term "percent identity of two sequences". The identity of a sequence is determined based on a reference sequence. Algorithms for sequence analysis are known in the art, such as BLAST described in Altschul et al., J. Mol. Biol., 215, pp. 403-10 (1990). For the purposes of the present invention, in order to determine the identity and similarity levels between nucleotide sequences and amino acid sequences, a comparison of nucleotide sequences and amino acid sequences can be used, which is performed using a gapped alignment with standard parameters using the BLAST software package provided by the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / blast). The percent identity of two sequences is determined by the number of positions of identical amino acids in the two sequences, taking into account the number of gaps to be entered for the best comparison of the two sequences by alignment and the length of each gap. The percent identity is equal to the number of identical amino acids at a given position divided by the total number of positions multiplied by 100, taking into account the sequence alignment.

[0026] The term "specifically hybridizes" refers to the association between two single-stranded nucleic acid molecules or sufficiently complementary sequences that allow such hybridization under predetermined conditions commonly used in the art.

[0027] phrase" tight "Double-strand break positioned before the nucleotide PAM sequence" means that the double-strand break in the target DNA sequence is made at a distance of 0 to 25 nucleotides before the nucleotide PAM sequence.

[0028] The exogenous DNA sequence introduced simultaneously with the guide RNA is expected to refer to a DNA sequence specifically prepared for the specific modification of the double-stranded target DNA at the break site determined by the specificity of the guide RNA. This modification can be, for example, the insertion or deletion of certain nucleotides at the break site in the target DNA. The exogenous DNA can be a DNA region from a different organism, or a DNA region from an organism identical to the target DNA.

[0029] A protein comprising a specific amino acid sequence is intended to refer to a protein having an amino acid sequence consisting of the amino acid sequence and other sequences that may be linked to the amino acid sequence by peptide bonds. Examples of other sequences may be nuclear localization signals (NLS), or other sequences that provide increased functionality to the amino acid sequence.

[0030] The exogenous DNA sequence introduced simultaneously with the guide RNA is expected to refer to a DNA sequence specifically prepared for the specific modification of the double-stranded target DNA at the break site determined by the specificity of the guide RNA. This modification can be, for example, the insertion or deletion of certain nucleotides at the break site in the target DNA. The exogenous DNA can be a DNA region from a different organism, or a DNA region from an organism identical to the target DNA.

[0031] The effective amount of protein and RNA introduced into a cell is intended to refer to the amount of such protein and RNA, which, when introduced into the cell, is capable of forming a functional complex, i.e., a complex that specifically binds to the target DNA and generates a double-strand break therein at a site determined by the guide RNA and the PAM sequence on the DNA. The efficiency of this process can be evaluated by analyzing the target DNA isolated from the cell using conventional techniques known to the skilled person.

[0032] Proteins and RNA can be delivered to cells by various techniques. For example, a protein can be delivered as a DNA plasmid encoding a gene for the protein, an mRNA for translation of the protein in the cytoplasm, or a ribonucleoprotein complex comprising the protein and a guide RNA. Delivery can be performed by various techniques known to the skilled person.

[0033] Nucleic acids encoding components of the system can be introduced into cells directly or indirectly by transfection or transformation of cells by methods known to the skilled artisan, by the use of recombinant viruses, by manipulation of cells such as DNA microinjection, and the like.

[0034] The RNA complex consisting of the nuclease and guide RNA and, if desired, exogenous DNA, can be delivered by transfecting the complex into the cell or by mechanically introducing the complex into the cell, such as by microinjection.

[0035] The nucleic acid molecule encoding the protein to be introduced into the cell can be integrated into the chromosome, or can be an extrachromosomal replicating DNA. In some embodiments, in order to ensure that the protein gene is effectively expressed by the DNA introduced into the cell, it is necessary to modify the sequence of the DNA according to the cell type so that the codons are optimized for expression, because the unequal frequencies of occurrence of synonymous codons in the coding regions of the genomes of various organisms. Codon optimization is necessary to increase expression in animal, plant, fungal or microbial cells.

[0036] In order for a protein having a sequence with at least 95% identity to the amino acid sequence of SEQ ID NO: 1 to function in a eukaryotic cell, it is necessary for the protein to finally reach the nucleus of such a cell. Therefore, in some embodiments of the present invention, a protein having a sequence with at least 95% identity to the amino acid sequence of SEQ ID NO: 1 and further modified at one or both ends by adding one or more nuclear localization signals is used to form a double-strand break in the target DNA. For example, a nuclear localization signal from the SV40 virus can be used. In order to provide effective delivery to the nucleus, the nuclear localization signal can be separated from the main protein sequence by a spacer sequence, which is described, for example, in Shen B et al. "Generation of gene-modified mice via Cas9 / RNA- mediated gene targeting", Cell Res. 2013 May; 23(5): 720-3. Further, in other embodiments, different nuclear localization signals or alternative methods for delivering the protein to the nucleus can be used.

[0037] The present invention includes Defluviimonas sp . The use of a protein from 20V17 organisms for introducing double-strand breaks into DNA molecules at strictly specified locations, which is homologous to the previously characterized Cas9 protein. There are many advantages to using CRISPR nucleases to introduce targeted modifications into the genome. First, the specificity of the activity of the system is determined by the crRNA sequence, which allows the use of one type of nuclease for all target loci. Second, the technology enables the delivery of several guide RNAs complementary to different gene targets into cells at once, making it possible to modify several genes at once.

[0038] For the biochemical characterization of the Cas9 protein from Defluviimonas sp. 20V17 bacteria, the CRISPR locus encoding the main system components (genes for DfCas9, cas1, cas2 proteins as well as the CRISPR cassette and guide RNA) was cloned into the single-copy bacterial vector pACYC184. The effector RNA complex, consisting of Cas9 and the crRNA / tracrRNA duplex, requires the presence of a PAM (pro-spacer alignment motif) on the DNA target for recognition and subsequent hydrolysis of the DNA, plus crRNA spacer-pro-spacer complementarity. (Mojica FJM et al. Short motif sequences determine the targets of the prokaryotic CRISPR defence system / / Microbiology. – 2009. – Vol. 155 – No. 3 – pp. 733-740). The PAM is a strictly defined sequence of a few nucleotides that in type II systems is positioned adjacent to or a few nucleotides away from the 3' end of the pro-spacer on the off-target strand. In the absence of a PAM, hydrolysis of the DNA bonds with the formation of double-strand breaks does not occur. The need for the presence of a PAM sequence on the target increases the specificity of recognition, but at the same time imposes restrictions on the choice of the target DNA region where the breaks are introduced.

[0039] To determine the sequence of the guide RNA for the CRISPR-Cas9 system, Escherichia coli carrying the generated DfCas9_pacyc184 construct was performed. E. coli ) RNA sequencing of DH5α bacteria. The sequencing showed that the system's CRISPR box was actively transcribed, as was the tracer RNA ( Figure 1 ). Analysis of crRNA and tracrRNA sequences allowed considering their potential to form secondary structures recognized by the DfCas9 nuclease.

[0040] Further, the authors used bacterial PAM screening to determine the PAM sequence of the DfCas9 protein. To determine the PAM sequence of the DfCas9 protein, E. coli DH5α cells carrying the DfCas9_pacyc184 plasmid were transformed with a plasmid library containing the spacer sequence 5'-TAGACCTTCGGGATCATGTCGATCATGATC-3' of the CRISPR box of the DfCas9 system, flanked by random seven-letter sequences from the 5' or 3' end. Plasmids carrying sequences corresponding to the PAM sequence of the DfCas9 system were subjected to degradation under the action of a functional CRISPR-Cas system, while the remaining library plasmids were effectively transformed into the cells, conferring resistance to the antibiotic ampicillin. After transformation and incubation of the cells on plates containing antibiotics, the colonies were washed off the agar surface and DNA was extracted from them using the Qiagen PlasmidPurification Midi kit. The region containing the randomized PAM sequence was amplified by PCR from an isolated plasmid library and then subjected to high-throughput sequencing on the Illumina platform. The resulting reads were analyzed by comparing the efficiency of transforming the plasmids with unique PAMs included in the library into cells carrying DfCas9_pacyc184 or control cells carrying the empty vector pacyc184. The results were analyzed using bioinformatics methods. Therefore, the PAM of the DfCas9 system can be identified, which is the three-letter sequence 5'-NN(G / A)NA(C / T)N-3'( Figure 2 ).

[0041] In order to develop a system for cutting DNA in vivo and in vitro, it is necessary to obtain all the components that are part of the effector DfCas9 complex: guide RNA and DfCas9 nuclease. Determining the guide RNA sequence by RNA sequencing enables the synthesis of crRNA and tracrRNA molecules in vitro. Synthesis was performed using the NEB HiScribe T7 RNA synthesis kit.

[0042] To cleave a DNA target restricted from the 3' end to the sequence NN(G / A)NA(C / T)N, a guide RNA of the following sequence was used:

[0043] and

[0044] .

[0045] The first 20 nucleotides included in the crRNA sequence complement the corresponding sequence on the DNA target and provide its specific recognition by the DfCas9 nuclease. If a different DNA target needs to be cut, this 20-letter spacer sequence can be modified ( Figure 3 ).

[0046] In order to obtain the recombinant DfCas9 protein, its gene was cloned into the plasmid pET21a. Escherichia coli Rosetta cells were transformed by the resulting plasmid DfCas9_pET21a. The cells carrying the plasmid were grown to an optical density of OD600=0.6, and then the expression of the DfCas9 gene was induced by adding IPTG to a concentration of 1mM. The cells were incubated at 25°C for 4 hours, after which they were lysed. The recombinant protein was purified in two stages as follows: by affinity chromatography (Ni-NTA) and by protein size exclusion on a Superdex 200 column. The resulting protein was concentrated using an Amicon 30 kDa filter. Thereafter, the protein was frozen at -80°C and used for in vitro reactions.

[0047] As target DNA, a double-stranded DNA fragment of 378 base pairs (bp) in length was used, which carried a protospacer sequence at a distance of about 30 bp from the 3' end, limited to the corresponding PAM sequence determined in experiments on bacteria: NN(G / A)NA(C / T)N.

[0048] DNA target sequence:

[0049] .

[0050] The presence of divalent ions is required for the activity of the nuclease domain of the Cas9 protein. In this regard, in vitro reactions for cutting DNA targets are performed in the presence of magnesium salts, manganese salts, calcium salts, and zinc salts. The in vitro reactions for cutting DNA targets are performed under the following conditions:

[0051] 1x Tris-HCl buffer, pH = 7.9 (at 25°C)

[0052] 400 nM DfCas9

[0053] 20 nM DNA target

[0054] 2 µM crRNA

[0055] 2 µM tracrRNA

[0056] 1 mM salt of the corresponding ion

[0057] The total reaction volume was 20 µl, the reaction time was 30 min, and the incubation temperature was 37°C.

[0058] The reaction products were applied to a 1.5% agarose gel and subjected to electrophoresis. If cleavage of the DNA target was successful, the fragment was broken into two parts, one of which (about 325 bp long) formed a distinguishable band on the gel ( Figure 4 The results of the experiments revealed that the DfCas9 protein requires manganese ions rather than magnesium ions for its activity, an unusual property of the Cas9 nucleases characterized so far.

[0059] To confirm the importance of different DfCas9 PAM sequences, experiments were performed on in vitro cleavage of DNA targets similar to those used previously, but containing point (single nucleotide) mutations in the PAM sequence 5′- AAAAACG -3′ ( Figure 5 ).

[0060] The experimental results confirmed that the DfCas9 enzyme is able to introduce double-strand breaks in DNA sequences limited to the PAM sequence NN(G / A)NA(C / T)N starting from the 3' end. Substitutions at PAM positions 3, 5, and 6 are critical for the DfCas9 effector complex and prevent efficient cutting of target DNA.

[0061] Additionally, experiments were performed to find the optimal temperature for DfCas9 activity: it was found to be 35-37 °C, which opens up the prospect of using DfCas9 in human cells.

[0062] The following exemplary embodiments of the method are given for the purpose of disclosing the characteristics of the invention and should not be construed as limiting the scope of the invention in any way.

[0063] Example 1. Testing the activity of DfCas9 protein in cleaving various DNA targets

[0064] To test the ability of DfCas9 to recognize different DNA sequences flanked by the motif 5'-NN(G / A)NA(C / T)N-3', in vitro cleavage experiments of a DNA target from the human grin2b gene sequence were performed (see Table 1).

[0065] Table 1. DNA targets isolated from the human grin2b gene.

[0066] DNA Target PAM attttctctcattctgcaga gcaaata tctaagacaggttacgtgat gtagatc aatgaaaggagataaggtcc ttgaatt caccttttattgccttgttc aaggatt ggcattgctgtcatcctcgt gggcact ttgcagtatctagcctcttc taagaca

[0067] The reaction of in vitro DNA cleavage was performed under similar conditions as in the previous experiment. Guide crRNA was synthesized for each target sequence. A fragment of the human grin2b gene of approximately 760 bp in size was used as DNA target:

[0068] .

[0069] Sequences flanked by a DNA region corresponding to the PAM sequence 5'-NN(G / A)NA(C / T)N-3' from the 3' end were selected as DNA targets. Only two of the six selected sequences were efficiently cleaved by the DfCas9 protein: DNA fragments of appropriate size cleaved by the effector complex were visible on the gel ( Figure 6 ). The selectivity in cutting different targets can be explained by the different efficiencies of DfCas9 recognition of different secondary DNA structures or other reasons. The selectivity of DfCas9 in cutting different targets may increase the specificity of the protein in cutting the genome of eukaryotic cells.

[0070] Therefore, DfCas9 combined with guide RNA is a new means for cleaving double-stranded DNA restricted to the sequence 5'-NN(G / A)NA(C / T)N-3', with a characteristic temperature range of activity from 35°C to 37°C.

[0071] Example 2. Effect of Mn2+ ion concentration on nuclease functionality

[0072] To test the effect of Mn2+ ions on the nuclease activity of DfCas9, experiments were performed in vitro to cut double-stranded DNA fragments containing a target DNA sequence limited to the PAM sequence AAAAAC with a consensus sequence 3'-NN(G / A)NA(C / T)-5'. The reaction was performed using 1x CutSmart buffer (NEB), a target DNA concentration of 20 nM, and a trRNA / crRNA concentration of 2 μM.

[0073] As DNA target, we used

[0074] .

[0075] Reactions using tracrRNA:

[0076] and

[0077] .

[0078] Figure 7 It was shown that an increase in MnCl2 concentration from 5 mM to 10 mM resulted in more efficient cleavage of the DNA target, while a further increase in divalent ion concentration did not affect the reaction efficiency. Thus, efficient DfCas9 activity requires the presence of manganese ions at concentrations of 10 mM or higher.

[0079] Example 3. Use of hybrid guide RNA for cleavage of DNA targets

[0080] sgRNA is a form of guide RNA that is a fusion of tracrRNA (tracer RNA) and crRNA. To select the best sgRNA, we constructed three variants of this sequence that differed in the length of the tracrRNA-crRNA duplex. RNA was synthesized in vitro and experiments were performed on it to cleave DNA targets ( Figure 8 Shown are reactions of DNA cleavage by DfCas9 using various sgRNA variants).

[0081] The selected sgRNA3 was as efficient as the native tracrRNA and crRNA sequences, cleaving more than 50% of the DNA targets.

[0082] When modifying the sequence that directly pairs with the DNA target, this sgRNA variant can be used to cleave any other target DNA.

[0083] The following RNA sequence was used as hybrid RNA:

[0084] 1-sgRNA1 24DR:

[0085] 2 - sgRNA2 18DR

[0086]

[0087] 3 - sgRNA3 30DR

[0088]

[0089] 4 - Control (without RNA)

[0090] 5 - Positive control (using crRNA+trRNA to cleave target)

[0091] Bold indicates a 20-nucleotide sequence that provides pairing with the target DNA (variable portion of the sgRNA). The experiment used a control sample without RNA and a positive control, which was target cleavage using crRNA+trRNA.

[0092] The reaction was carried out under the following conditions: the concentration of the DNA sequence containing PAM (AAAACG) was 20 nM, the protein concentration was 400 nM, and the RNA concentration was 2 μM; the incubation time was 30 minutes and the incubation temperature was 37°C.

[0093] After modification of the sequence that directly pairs with the DNA target, this hybrid RNA variant can be used to cleave any other target DNA.

[0094] Example 4. From Defluviimonas sp.Cas9 proteins from closely related organisms

[0095] To date, CRISPR-Cas9 enzymes have not been used in Defluviimonas The Cas9 protein from Staphylococcus aureus, which is comparable in size, has 21% identity with DfCas9, and the Cas9 from Campylobacter jejuni has 28% identity with DfCas9 (the degree of identity was calculated using BLASTp software with default parameters).

[0096] The DfCas9 protein is therefore significantly different in its amino acid sequence from other Cas9 proteins studied to date.

[0097] Those skilled in the art of genetic engineering will appreciate that the DfCas9 protein sequence variants obtained and characterized by the applicant can be modified without changing the function of the protein itself (e.g., by directed mutagenesis of amino acid residues that do not directly affect functional activity (Sambrook et al., Molecular Cloning: A Laboratory Manual, (1989), CSH Press, pp. 15.3-15.108)). In particular, the skilled person will recognize that non-conservative amino acid residues can be modified without affecting the residues responsible for protein functionality (determining protein function or structure). Examples of such modifications include replacing non-conservative amino acid residues with homologous amino acid residues. Some regions containing non-conservative amino acid residues are shown in Fig. 9 In some embodiments of the present invention, a protein comprising an amino acid sequence having at least 95% identity to the amino acid sequence of SEQ ID NO: 1 and differing from SEQ ID NO: 1 only in non-conserved amino acid residues can be used to form a double-stranded break in a DNA molecule located immediately before the nucleotide sequence 5'-NN(G / A)NA(C / T)N-3' in the DNA molecule. Homologous proteins can be obtained by mutagenesis (e.g., site-directed or PCR-mediated mutagenesis) of the corresponding nucleic acid molecule, followed by testing the encoded modified Cas9 protein for preservation of its function according to the functional assays described herein.

[0098] Embodiment 5. The DfCas9 system described in the present invention can be used to modify the genomic DNA sequence of multicellular organisms including eukaryotic organisms in combination with guide RNA. In order to introduce the DfCas9 system in a complex with guide RNA into the cells (all cells or a portion of cells) of the organism, various methods known to technicians can be applied. For example, the method for delivering the CRISPR-Cas9 system to the cells of the organism has been disclosed in sources (Liu C et al., Delivery strategies of the CRISPR-Cas9 gene-editing system for therapeutic applications. J Control Release. 2017 Nov 28; 266: 17-26; Lino CA et al., Delivering CRISPR: a review of the challenges and approaches. Drug Deliv. 2018 Nov; 25 (1): 1234-1257), and in the sources further disclosed in these sources.

[0099] For efficient expression of the DfCas9 nuclease in eukaryotic cells, it is desirable to optimize the codons of the amino acid sequence of the DfCas9 protein by methods known to the skilled person (e.g., IDT codon optimization tool).

[0100] For the effective activity of DfCas9 nuclease in eukaryotic cells, it is necessary to import protein into the nucleus of eukaryotic cells. This can be accomplished by using a nuclear localization signal (Lanford et al., Cell, 1986, 46: 575–582) from SV40 T antigen, which is connected to the DfCas9 sequence by the spacer sequence described in Shen B et al. "Generation of gene-modified mice via Cas9 / RNA- mediated gene targeting", Cell Res. 2013 May; 23 (5): 720-3, or without a spacer sequence. Therefore, the complete amino acid sequence of the nuclease to be transported inside the nucleus of eukaryotic cells will be the following sequence: MAPKKKRKVGIHGVPAA-DfCas9- KRPAATKKAGQAKKKK (hereinafter referred to as DfCas9 NLS). At least two methods can be used to deliver a protein with the above amino acid sequence.

[0101] Gene delivery is achieved by preparing a plasmid carrying the DfCas9 NLS gene under the control of a promoter (e.g., a CMV promoter) and a sequence encoding a guide RNA under the control of a U6 promoter. As target DNA, a DNA sequence flanked by 3'-NN(G / A)NA(C / T)-5' is used, for example, the sequence of the human grin2b gene:

[0102]

[0103] Therefore, the crRNA expression cassette is as follows:

[0104]

[0105] The U6 promoter sequence is indicated in bold followed by the sequence required for target DNA recognition, while the direct repeat sequence is highlighted in uppercase letters.

[0106] The tracer RNA expression cassette is as follows:

[0107]

[0108] Bold indicates the U6 promoter sequence, followed by the sequence encoding the tracer RNA.

[0109] Use Lipofectamine 2000 reagent (Thermo Fisher Scientific), plasmid DNA is purified and transfected into human HEK293 cells. Make cell incubation 72 hours, after this use genomic DNA purification column (Thermo Fisher Scientific) by it to extract genomic DNA. Analyze target DNA site by sequencing on Illumina platform, in order to determine due to directional double-strand break, then for its repair, and the insertion / deletion number in the DNA that occurs in target site.

[0110] Amplification of the target fragment is performed using primers flanking the putative site of break introduction, for example, for the grin2b gene locus mentioned above the following primers are used:

[0111]

[0112] After amplification, samples were prepared according to the Ultra II DNA Library Prep Kit for Illumina (NEB) reagent sample preparation protocol for high-throughput sequencing. Sequencing was then performed on the Illumina platform, 300 cycles, direct read. Sequencing results were analyzed by bioinformatics methods. Insertions or deletions of several nucleotides in the target DNA sequence were considered as cut detections.

[0113] Delivery was performed as riboplexes by incubating recombinant DfCas9 NLS with guide RNA in CutSmart buffer (NEB). Recombinant protein was produced by bacterial production cells by purifying them via affinity chromatography (NiNTA, Qiagen) and size exclusion (Superdex200).

[0114] Protein was mixed with RNA at a 1:2:2 ratio (DfCas9 NLS: crRNA: tracrRNA), and the mixture was incubated at room temperature for 10 minutes before transfection into cells.

[0115] Next, the DNA extracted therefrom is analyzed for insertion / deletion at the target DNA site (as described above).

[0116] Compared with previously characterized Cas9 proteins, the Cas9 proteins from deep-sea bacteria characterized in the present invention Defluviimonas sp. 20V17 The DfCas9 nuclease has many advantages. For example, DfCas9 has a relatively simple three-letter PAM that is different from other known Cas nucleases, which is required for the system to work. Most of the currently known Cas nucleases that can introduce double-strand breaks into DNA have multi-letter complex PAMs, which limit the choice of sequences suitable for cutting. Among the Cas nucleases that recognize short PAMs studied so far, only DfCas9 can recognize sequences limited to 5'-NN(G / A)NA(C / T)N-3' nucleotides.

[0117] The second advantage of DfCas9 is the relatively small protein size (1079 aar). So far, it is one of the few small-sized proteins studied that has a simple PAM sequence and is active at 37°C. The unusual property of DfCas9 is that it requires the presence of manganese ions to successfully cut the DNA target. This property can be used to regulate the activity of the Cas9 complex.

[0118] Although the present invention has been described with reference to the disclosed embodiments, it will be appreciated by those skilled in the art that the specific embodiments described in detail are provided for the purpose of illustrating the present invention and should not be interpreted as limiting the scope of the present invention in any way. It should be understood that various changes can be made without departing from the spirit of the present invention. <110> JSC "BIOCAD" <120> DNA cleavage agent <130> 417254 <150> RU 2018141534 <151> 2018-11-26 <160> 2 <170> BiSSAP 1.3.6 <210> 1 <211> 1079 <212> PRT <213> Defluviimonas <220> <223> Protein homologous to Cas9 <400> 1 Met Tyr Arg Phe Ala Phe Asp Leu Gly Thr Asn Ser Leu Gly Trp Ala 1 5 10 15 Val Tyr Arg Leu Thr Asn Asp Thr Arg Pro Ala Ser Ile Glu Arg Thr 20 25 30 Gly Val Arg Ile Phe Pro Asn Gly Arg Asp Pro Gln Ser Lys Glu Ser 35 40 45 Asn Ala Ala Gly Arg Arg Met Pro Arg Gly Ala Arg Arg Arg Gln Asp 50 55 60 Arg Ser Leu Gly Arg Arg Lys Arg Leu Leu Asp Asp Leu Ile Gly Phe 65 70 75 80 Gly Leu Leu Pro Ser Asp Ala Asp Ala Arg Ser Ala Val Phe Ala Ala 85 90 95 Asn Pro Ile Glu Ala Arg Ala Arg Ala Ala Arg Glu Gln Val Ala Leu 100 105 110 Glu Gln Leu Gly Arg Ala Leu Trp His Met Ser Lys His Arg Gly Phe 115 120 125 Lys Ser Asn Arg Arg Ala Asp Lys Asp Ala Asp Glu Lys Gly Lys Ile 130 135 140 Ala Ile Ala Ser Ala Ala Leu Leu Glu Arg Leu Arg Ala Asp Gly His 145 150 155 160 Pro Thr Tyr Gly Ala Phe Leu His Ala Arg Leu Val Arg Gly Glu Gly 165 170 175 Thr Arg Ile Arg Pro Ala Gly Asp Gly Ala Lys Leu Ser Tyr Glu Phe 180 185 190 Tyr Pro Thr Arg Ala Leu Leu Glu Ala Glu Phe Asp His Ile Trp Ala 195 200 205 Ile Gln Ala Gly Phe His Pro Ser Leu Thr Glu Ala Met His Glu Arg 210 215 220 Leu Arg Asp Thr Ile Phe Phe Gln Arg Pro Leu Arg Pro Val Arg Pro 225 230 235 240 Gly Lys Cys Thr Phe Phe Pro Asp Gln Asp Arg Leu Pro Arg Trp His 245 250 255 Pro Ala Ala Gln Glu Phe Leu Ile Leu Ser Gln Leu Asn His Leu Arg 260 265 270 Ile Val Asp Asp Gln Gly Glu Gln Pro Leu Asp Ile Thr Ala Arg Asp 275 280 285 Leu Val Ala Arg Thr Leu Met Ala Gly Thr Lys Leu Ser Trp Ser Gly 290 295 300 Leu Lys Lys Thr Leu Lys Leu Pro Ser Gln Ala Glu Phe Asn Leu Glu 305 310 315 320 Lys Gly Gly Leu Lys Glu Leu Ala Arg Asn Asp Val Ala Ala Arg Leu 325 330 335 Leu Gly Asp Thr Lys Lys Pro Gly Pro Leu Ala Thr Leu Trp Pro Thr 340 345 350 Leu Asp Ser Ala Thr Gln Glu Glu Ile Leu Trp Gln Ile Ser Glu Val 355 360 365 Ala Asp Pro Glu Glu Leu Ile Cys Trp Leu Met Glu Arg Leu Gly Leu 370 375 380 Ser Arg Glu Val Ala Glu Arg Val Glu Lys Ile Pro Leu Pro Asp Gly 385 390 395 400 His Leu Arg Phe Cys Lys Thr Ala Thr Gln Ala Ile Val Glu Lys Leu 405 410 415 Arg Cys Asp Val Ile Pro Tyr Asp Glu Ala Val Arg Arg Ala Pro Leu 420 425 430 Leu Gly Gly Ala Gly Leu Asp His Ser Asp Phe Gln Ala Glu Glu Gly 435 440 445 Val Asp Thr Leu Pro Pro Tyr Asn Arg Leu Pro Val Leu Gln Arg Met 450 455 460 Ile Gly Asn Gly Thr Ser Asp Pro Lys Asp Thr Asp Leu Leu Arg Tyr 465 470 475 480 Gly Arg Ile Thr Asn Pro Thr Val His Ile Ala Leu Gly Gln Phe Arg 485 490 495 Arg Val Met Asn Ala Leu Ile Ala Glu Tyr Gly Lys Pro Ala Gln Val 500 505 510 Val Ile Glu Ala Thr Arg Asp Met Ala Lys Ser Ala Glu Glu Leu Asn 515 520 525 Lys Ile Glu Lys Thr Ile Arg Asp Asn Glu Lys Arg Asn Asp Arg Trp 530 535 540 Arg Ala Glu Leu Gln Lys Ala Gly Leu Leu Val Glu Gly Ala Arg Ile 545 550 555 560 Gly Asp Arg Phe Leu Arg Met Arg Leu Trp Glu Glu Ile Gly Arg Gly 565 570 575 Pro Ala Asp Arg Leu Cys Pro Tyr Thr Gly Arg Pro Ile Ala Leu His 580 585 590 Gln Leu His Ser Asp Glu Ile Glu Ile Asp His Ile Leu Pro Phe Glu 595 600 605 Gln Thr Phe Asp Asp Ser Pro Ala Asn Lys Ser Leu Cys Phe Arg Asp 610 615 620 Ala Asn Arg Arg Lys Gly Lys Leu Ser Pro Ala Ala Ala Ala Asp Arg 625 630 635 640 Gln Pro Asp Phe Phe Asp Leu Ala Ala Ile Ile Gly Arg Thr Lys His 645 650 655 Leu Pro Ala Asn Lys Ala Trp Arg Phe Leu Pro Gly Ala Met Glu Lys 660 665 670 Trp Glu Glu Thr Arg Gly Phe Glu Asp Arg Gln Leu Asn Ala Thr Gly 675 680 685 Tyr Leu Ala Arg Val Val Arg Ala Tyr Thr Glu Ala Leu Phe Pro Lys 690 695 700 Thr Asp Ala Glu Gly Lys Arg Arg Ser His Val Trp Val Leu Pro Gly 705 710 715 720 Arg Met Thr Ala Met Leu Arg His Arg Trp Gly Leu Asn Leu Gly Asp 725 730 735 His Asn Arg Lys Ser Arg Asp Asp His Arg His His Ala Ile Asp Ala 740 745 750 Ala Val Val Gly Val Ile Asp Arg Arg Met Val Gln Val Leu Gln Thr 755 760 765 His Ala Arg Asn Leu Gly Val Glu Arg Leu Asp Arg Val Leu Pro Ala 770 775 780 Pro Pro Glu Pro Phe Glu Gly Phe Arg Asp Ala Val Leu Ala Ala Val 785 790 795 800 Glu Lys Val Asn Val Ser His Arg Ala Gln His Gly Ser Ile Asp Pro 805 810 815 Thr Asp Pro Ser Gln Thr Ser Gly Arg Leu His Glu Asp Thr Val Phe 820 825 830 Gly Leu Val Arg Asp Val Pro Glu Asn Gln Ala Glu Arg Thr Ile Gly 835 840 845 Asn Val Val Val Arg Lys Pro Ile Thr Gly Leu Thr Glu Lys Glu Ile 850 855 860 Gly Gln Val Arg Asp Val Lys Met Arg Leu Ser Leu Gln Asp Ala Thr 865 870 875 880 Ser Leu Ala Arg Asp Lys Ser Leu Pro Glu Ala Glu Arg Lys Lys Arg 885 890 895 Leu Pro Glu Ala Leu Ala Lys Trp Val Gln Glu Thr Gly His Arg Lys 900 905 910 Leu Arg Ile Leu Lys Pro Glu Ala Gly Val Arg Pro Val His Asp Arg 915 920 925 Asp Gly Lys Pro Tyr Lys Trp Leu Val Pro Gly Glu Ile Ser Trp Leu 930 935 940 Asp Ile Leu Glu Ala Pro Asp Gly Thr Trp Phe Gln His Ala Thr Asp 945 950 955 960 Ile Trp Ala Ala Asn Ser Gly Gly Ala Glu Pro Trp Asn Val Ala His 965 970 975 Pro Ser Ala Arg Phe Ile Met Arg Val His Lys Asn Asp Thr Ile Gln 980 985 990 Val Phe Asp Trp Asp Asp Arg Asn Lys Cys Val Val Glu Gly Ser Asn 995 1000 1005 Gln Ile Lys Arg Ile Val Arg Leu Glu Pro Ser Ala Asn Arg Met Arg 1010 1015 1020 Leu Val Gly Ile Asn Asp Ala Gly Lys Phe Asp Glu Arg His Asn Glu 1025 1030 1035 1040 Pro Asn Asp Pro Phe Arg Trp Asp Leu Ala Thr Ile Ser Lys Leu Lys 1045 1050 1055 Leu Arg Arg Ala Arg Arg Val Arg Ile Asp Glu Leu Gly Arg Val His 1060 1065 1070 Thr Ile Pro His Gly Thr Val 1075 <210> 2 <211> 3240 <212> DNA <213> Defluviimonas <400> 2 atgtatcgtt tcgctttcga cctcggaacc aactcccttg gctgggccgt ctatcgcttg 60 accaatgaca cgcggcccgc ttccattgaa aggacagggg tgaggatctt cccaaacggt 120 cgggatccac agtcgaagga gtcgaatgcc gctggccgca gaatgccgcg cggcgcaagg 180 cggaggcagg atcgaagcct gggacgaagg aagcggctgc tcgatgacct gatcgggttt 240 ggcctgctgc catcagatgc agatgcccgc agcgcggtct ttgccgcaaa tcccatcgaa 300 gcacgggctc gggccgcgcg cgaacaggtg gctctggaac aacttggccg ggcactctgg 360 cacatgtcga aacatcgcgg tttcaagagc aaccgccgcg ccgacaagga tgcggatgaa 420 aagggcaaga tcgcgatcgc ctcggccgcc cttctagagc gactgagggc agacgggcac 480 ccgacatacg gcgcctttct gcacgcgcgc ctcgtccgag gtgaaggaac gcgcatacgc 540 ccggcaggcg acggcgcaaa gctgtcctac gaattctacc cgacacgcgc tcttctggag 600 gccgagttcg atcacatctg ggccatccaa gcgggcttcc acccgtccct gaccgaagcg 660 atgcacgagc ggctgcgcga caccatcttc tttcagcgcc ccctgcgccc cgtccgtccg 720 gggaaatgca cattcttccc cgatcaggac cggctgccgc gctggcaccc ggccgcacag 780 gagtttctga tcctgtcaca gctcaaccat ttgcgcatcg tcgacgatca aggcgaacag 840 ccactggaca tcaccgcgcg ggatcttgtc gcgcgtacgt tgatggctgg aacaaaactg 900 tcatggtcgg gcctgaaaaa gaccctgaag ctgccgtcac aggccgagtt caacctcgaa 960 aagggcggcc tgaaggagct tgcacggaat gacgtggcgg cacgactgct gggcgatacg 1020 aagaaacccg gaccgctggc gacgctctgg ccgaccctcg acagcgccac gcaagaggaa 1080 atcctgtggc agatatcgga ggtcgcagac ccggaagagc tcatctgctg gcttatggaa 1140 aggctcgggc tttctcgcga ggtggcggaa agggtcgaga agatcccact gccggacggt 1200 cacctgcgtt tctgcaagac agcgacgcag gcgattgtcg aaaaactgcg ctgcgacgtc 1260 attccctatg acgaagccgt ccggcgcgcg cctttgcttg gcggggcgggg gctggaccac 1320 tccgattttc aggccgaa aggcgtcgat accctgccgc cctacaaccg gctgcccgtt 1380 ctacagcgca tgatcggcaa cggaaccagc gatccgaaag acacggacct gctgcgctat 1440 ggccggatca ccaacccgac cgtgcacatc gccttgggcc agttccggcg cgtgatgaat 1500 gcgctgatcg cagaatacgg taagcctgcg caggtcgtca tcgaggccac gcgagacatg 1560 gccaagtcag ccgaggaact gaacaagatc gagaaaacca tccgcgacaa cgaaaaacgc 1620 aatgatcgct ggcgtgccga gcttcagaaa gcggggctgc tggtggaagg cgcgcggatc 1680 ggcgaccggt tcttgaggat gcgcctatgg gaggagattg gcagaggccc ggcagatcgg 1740 ctctgtccct acaccggtcg ccccatcgcg ctgcatcagc tgcattccga cgagatcgag 1800 atcgatcata tcctgccctt cgagcaaacc ttcgacgaca gtccagccaa caagagcctg 1860 tgtttccgcg atgccaaccg ccgcaagggc aagctgtcgc cggctgcagc ggccgaccgg 1920 cagccagact tcttcgatct ggctgccatc atcgggcgca cgaaacacct gcccgccaac 1980 aaggcctggc ggtttctgcc cggtgccatg gaaaaatggg aagagacgcg cggtttcgag 2040 gatcgccagt tgaacgccac cggctatctg gcccgagttg tccgcgccta taccgaggcg 2100 ctgttcccga aaaccgatgc cgagggcaag cgacgcagcc atgtctgggt cctgcccggt 2160 cgcatgaccg cgatgttgcg gcaccgctgg ggtctgaacc tgggcgatca caaccgtaag 2220 tcacgcgacg atcaccgcca ccatgcgatc gacgccgccg tggtgggcgt gatcgaccgg 2280 cggatggtgc aggtgttgca gacccatgcg cggaacctgg gggtggagcg gctggaccgc 2340 gtgttacccg cgccgccaga acccttcgaa ggtttccgcg acgccgtgct ggctgccgtc 2400 gaaaaggtca acgtcagcca tcgtgcgcaa cacggcagca tcgacccaac cgatccatcg 2460 cagaccagcg gcaggctgca tgaggataca gtctttggtc ttgtgcggga tgtgccagag 2520 aaccaggccg agcgcaccat cggcaatgtc gttgtgcgca aacccataac cggcttgacc 2580 gaaaaaaa tcggacaggt gcgcgacgtc aagatgcgcc tcagtctgca ggatgccacc 2640 agtttagccc gcgacaaatc cttgccggag gcagagcgca agaagcgcct gcccgaggcg 2700 ctggcgaaat gggttcagga aaccggccac cgcaaactgc gtatcctgaa gcccgaagct 2760 ggcgttcgcc ccgttcatga ccgtgatggc aagccctaca aatggctggt gccccggtgaa 2820 atctcctggc tcgacatcct agaagcgcct gacggcacat ggtttcagca cgccacagac 2880 atctgggcgg caaactcggg tggggccgag ccctggaacg tcgcgcaccc cagcgcacgt 2940 ttcatcatgc gcgtccacaa gaatgacacc attcaagtgt tcgattggga cgacagaaac 3000 aagtgtgtcg tggaaggaag caaccagatc aagaggatcg tacgcttgga accgagcgcc 3060 aacagaatgc ggctcgtcgg cataaacgac gcaggcaagt ttgacgaacg gcacaacgag 3120 ccaaacgatc ccttccgctg ggatcttgcc acgatcagca aactgaagct ccgccgcgcc 3180 cggcgcgtgc ggatcgacga attggggcgg gttcacacga tcccgcatgg gacagtttag 3240

Claims

1. Use of a protein for forming a double-strand break in a DNA molecule located immediately before the nucleotide sequence 5'-NN(G / A)NA(C / T)N-3' in said DNA molecule, characterized in that The protein consists of the amino acid sequence of SEQ ID NO: 1, wherein the phrase "a double-strand break located immediately before the nucleotide sequence 5'-NN(G / A)NA(C / T)N-3' in the DNA molecule" means that the double-strand break in the DNA sequence is prepared at a distance of 0 to 25 nucleotides before the nucleotide sequence 5'-NN(G / A)NA(C / T)N-3', and the double-strand break is prepared at a temperature of 35° C. to 37° C. and under Mn 2+ In the presence of ions, it is formed in the DNA molecule.

2. A method for generating a double-strand break in a genomic DNA sequence of a unicellular organism or a multicellular organism directly adjacent to the sequence 5'-NN(G / A)NA(C / T)N-3', characterized in that The method comprises introducing the following into at least one cell of the organism: a) a protein consisting of the amino acid sequence of SEQ ID NO: 1 or a nucleic acid encoding the protein consisting of the amino acid sequence of SEQ ID NO: 1, and b) a guide RNA or a DNA sequence encoding the guide RNA, wherein the guide RNA comprises the following sequence, which forms a duplex with a nucleotide sequence of a genomic DNA region of the organism directly adjacent to the nucleotide sequence 5'-NN(G / A)NA(C / T)N-3' and interacts with the protein after duplex formation, wherein the interaction between the protein and the guide RNA and the nucleotide sequence 5'-NN(G / A)NA(C / T)N-3' results in the formation of a double-strand break in the genomic DNA sequence directly adjacent to the sequence 5'-NN(G / A)NA(C / T)N-3', wherein the double-strand break is formed at a temperature of 35°C to 37°C and under Mn 2+ In the presence of ions, it is formed in the DNA molecule.

3. The method according to claim 2, further comprising introducing an exogenous DNA sequence simultaneously with the guide RNA.

Images