Protein with L-proline efflux function and its application

Abstract

The present invention discloses a protein with L-proline efflux function and its application. The method of producing L-proline or hydroxyproline by using protein ThrE is to produce L-proline by enhancing the activity of a polypeptide with L-proline efflux function in an L-proline-producing strain. Alternatively, the activity of a polypeptide with L-proline efflux function in an L-proline-producing host cell is weakened and the activity of proline hydroxylase is enhanced to produce hydroxyproline.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology and bioengineering, and specifically relates to a new use of threonine efflux protein ThrE of Corynebacterium glutamicum as an L-proline efflux protein, and a method for producing L-proline and its derivatives by using protein ThrE. Background Art

[0002] L-proline is a naturally occurring non-essential amino acid for human body, and is widely used in clinic, biomaterials and industry. The production methods of L-proline mainly include chemical method and fermentation method. Since chemical extraction method has serious pollution and high cost, it has gradually lost the market. Microbial fermentation method has become the most widely used method in current industry due to its advantages of low production cost, high production intensity, high specificity and little environmental pollution. At present, commonly used industrial fermentation strains include Corynebacterium and Escherichia, commonly used Escherichia such as Escherichia coli, commonly used Corynebacterium such as Corynebacterium glutamicum, Brevibacterium such as Brevibacterium flavum, Brevibacterium lactofermentus, and some species of Arthrobacter and some species of Microbacterium. And due to the physiological superiority of Corynebacterium glutamicum, it has become the most important production strain in industry to produce products such as amino acids.

[0003] In Corynebacterium, L-proline is mainly produced by catalysis of γ-glutamyl kinase (Glutamate-5-kinase, ProB), glutamate semialdehyde dehydrogenase (Glutamate-semialdehyde dehydrogenase, ProA), and pyrroline-5-carboxylic acid reductase (Pyrroline-5-carboxylic acid reductase, ProC) with glutamate as substrate. The prior art mainly produces L-proline by genetically modifying the key enzymes ProA and ProB in the L-proline synthesis pathway. For example, CN101084312A reported that the 149-position mutation of the ProB protein from Corynebacterium glutamicum can relieve the feedback inhibition of L-proline and increase the yield of L-proline in the engineered strain.

[0004] In the fermentation process, the amino acids synthesized in the microorganism are transported to the extracellular space in time through the transport pathway, which is also very important for promoting the biosynthesis of amino acids. For example, in the production process of lysine, the lysine yield of the engineering strain can be significantly improved by overexpression of the lysine efflux protein LysE (CN1283797C). However, in the production process of L-proline, there is no report on the use of L-proline efflux protein to increase the yield of L-proline. Therefore, there is an urgent need to explore effective L-proline efflux proteins in this field so that the L-proline produced in the cell can be efficiently discharged to the extracellular space to obtain high-yield L-proline engineering bacteria. Summary of the invention

[0005] To overcome the problems of the prior art, the present invention screens the L-proline efflux protein of Corynebacterium glutamicum by the full genome scale membrane transporter inhibition library. Based on this screening, after the present invention screens thrE (Cgl2622, the existing literature confirms that it is the coding gene of threonine efflux protein) gene inhibition, L-proline specific yield decreases significantly. In an L-proline producing bacterium SZCgP1 (Corynebacterium glutamicum ATCC13869 introduces the G149D mutation of ProB protein, the codon is mutated from GGT to GAT, specifically referring to CN101084312A), ThrE is overexpressed, and the extracellular proline concentration in the whole fermentation process is significantly higher than that of the control strain SZCgP1 (pEC-control), and the intracellular proline concentration in the whole fermentation process (particularly the rapid acid production phase) is significantly lower than that of the control strain SZCgP1 (pEC-control). The above results show that ThrE is an L-proline efflux protein.

[0006] One of the objects of the present invention is to provide the use of proline efflux protein in producing L-proline or hydroxyproline.

[0007] Another object of the present invention is to provide a strain for producing L-proline or hydroxyproline.

[0008] Another object of the present invention is to provide a method for producing L-proline or hydroxyproline.

[0009] Another object of the present invention is to provide a method for constructing an L-proline or hydroxyproline producing strain.

[0010] In a first aspect of the present invention, a polypeptide is provided for use as a proline efflux protein in the production of L-proline and hydroxyproline, wherein the polypeptide is:

[0011] A) a polypeptide having an amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2; or

[0012] B) a polypeptide having L-proline efflux activity with some amino acids added or deleted at either or both ends of the polypeptide described in A); or

[0013] C) A polypeptide having L-proline efflux activity and having a homology of greater than 90%, 95%, 96%, 97%, 98% or 99% with the polypeptide described in A), and derived from Corynebacterium.

[0014] In another preferred embodiment, the polypeptide is a polypeptide derived from the polypeptide of the amino acid sequence shown in SEQ ID NO: 1 or 2, which is formed by adding one or several, preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, most preferably 1 amino acid residues to the amino acid sequence shown in SEQ ID NO: 1 or 2 at either or both ends, and has L-proline efflux function.

[0015] In another preferred embodiment, the amino acid sequence of the polypeptide is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0016] In the second aspect of the present invention, a strain for producing L-proline is provided, characterized in that the strain expresses the following polypeptide:

[0017] A) a polypeptide having an amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2; or

[0018] B) a polypeptide having L-proline efflux activity with some amino acids added or deleted at either or both ends of the polypeptide described in A); or

[0019] C) A polypeptide having L-proline efflux activity and having a homology of greater than 90%, 95%, 96%, 97%, 98% or 99% with the polypeptide described in A), and derived from Corynebacterium.

[0020] In another preferred embodiment, the polypeptide is a polypeptide derived from the polypeptide of the amino acid sequence shown in SEQ ID NO: 1 or 2, which is formed by adding one or several, preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, most preferably 1 amino acid residues to the amino acid sequence shown in SEQ ID NO: 1 or 2 at either or both ends, and has L-proline efflux function.

[0021] In another preferred embodiment, the amino acid sequence of the polypeptide is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0022] In another preferred embodiment, the production strain is a bacterium.

[0023] In another preferred embodiment, the production strain is selected from the genus Escherichia or Corynebacterium, preferably Escherichia coli or Corynebacterium glutamicum, further preferably Corynebacterium glutamicum, more specifically Corynebacterium glutamicum ATCC 13032, Corynebacterium glutamicum ATCC13869, Corynebacterium glutamicum B253, Corynebacterium glutamicum ATCC 14067.

[0024] In another preferred embodiment, the glutamate kinase in the production bacteria is not subject to feedback inhibition by L-proline or the feedback inhibition by L-proline is weakened.

[0025] In another preferred embodiment, the activity of glutamate kinase and / or glutamate semialdehyde dehydrogenase and / or pyrroline-5-carboxylate reductase in the production bacteria is enhanced.

[0026] In a third aspect of the present invention, a method for producing L-proline is provided, the method comprising: culturing the aforementioned production strain to produce L-proline.

[0027] In another preferred embodiment, the method further comprises the step of separating L-proline from the fermentation broth.

[0028] In a fourth aspect of the present invention, a method for constructing an L-proline producing strain is provided, the method comprising enhancing the activity of the following polypeptides having L-proline efflux function in the strain:

[0029] A) a polypeptide having an amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2; or

[0030] B) a polypeptide having L-proline efflux activity with some amino acids added or deleted at either or both ends of the polypeptide described in A); or

[0031] C) A polypeptide having L-proline efflux activity and having a homology of greater than 90%, 95%, 96%, 97%, 98% or 99% with the polypeptide described in A), and derived from Corynebacterium.

[0032] In another preferred embodiment, the polypeptide is a polypeptide derived from the amino acid sequence polypeptide shown in SEQ ID NO: 1 or 2, which is formed by adding one or several, preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, most preferably 1 amino acid residues to the amino acid sequence shown in SEQ ID NO: 1 or 2 at either end or both ends, and has L-proline efflux function.

[0033] In another preferred embodiment, the amino acid sequence of the polypeptide is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0034] In another preferred embodiment, the production strain is a bacterium.

[0035] In another preferred embodiment, the production strain is selected from the genus Escherichia or Corynebacterium, preferably Escherichia coli or Corynebacterium glutamicum, further preferably Corynebacterium glutamicum, more specifically Corynebacterium glutamicum ATCC 13032, Corynebacterium glutamicum ATCC13869, Corynebacterium glutamicum B253, Corynebacterium glutamicum ATCC 14067.

[0036] In another preferred embodiment, the glutamate kinase in the production bacteria is not subject to feedback inhibition by L-proline or the feedback inhibition by L-proline is weakened.

[0037] In another preferred embodiment, the activity of glutamate kinase and / or glutamate semialdehyde dehydrogenase and / or pyrroline-5-carboxylate reductase in the production bacteria is enhanced.

[0038] In a fifth aspect of the present invention, a host cell is provided, wherein the activity of a polypeptide having an L-proline efflux function in the host cell is weakened, and the polypeptide having an L-proline efflux function activity is:

[0039] A) a polypeptide having an amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2; or

[0040] B) a polypeptide having L-proline efflux activity with some amino acids added or deleted at either or both ends of the polypeptide described in A); or

[0041] C) A polypeptide having L-proline efflux activity and having a homology of greater than 90%, 95%, 96%, 97%, 98% or 99% with the polypeptide described in A), and derived from Corynebacterium.

[0042] In another preferred embodiment, the host cell is selected from the genus Escherichia or Corynebacterium, preferably Escherichia coli or Corynebacterium glutamicum, further preferably Corynebacterium glutamicum, more specifically Corynebacterium glutamicum ATCC 13032, Corynebacterium glutamicum ATCC13869, Corynebacterium glutamicum B253, Corynebacterium glutamicum ATCC 14067.

[0043] In another preferred embodiment, the glutamate kinase in the host cell is not subject to feedback inhibition by L-proline or the feedback inhibition by L-proline is weakened.

[0044] In another preferred embodiment, the activity of proline hydroxylase in the host cell is enhanced.

[0045] In another preferred embodiment, the proline hydroxylase is trans-proline-4-hydroxylase, and its nucleotide sequence is shown in SEQ ID NO:5.

[0046] In another preferred embodiment, the activity of glutamate kinase and / or glutamate semialdehyde dehydrogenase and / or pyrroline-5-carboxylate reductase in the production bacteria is enhanced.

[0047] In the sixth aspect of the present invention, a method for producing hydroxyproline such as trans-4-hydroxy-L-proline is provided, the method comprising: culturing the above host cell to produce hydroxyproline such as trans-4-hydroxylated-L-proline.

[0048] In another preferred embodiment, the method further comprises the step of separating hydroxyproline such as trans-4-hydroxy-L-proline from the fermentation broth.

[0049] In a seventh aspect of the present invention, a method for constructing a strain producing hydroxyproline such as trans-4-hydroxy-L-proline is provided, characterized in that the method comprises:

[0050] (1) weakening the activity of the following polypeptides having L-proline efflux function in the strain, wherein the polypeptides having L-proline efflux function activity are:

[0051] A) a polypeptide having an amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2; or

[0052] B) a polypeptide having L-proline efflux activity with some amino acids added or deleted at either or both ends of the polypeptide described in A); or

[0053] C) a polypeptide having an L-proline efflux activity and having a homology of greater than 90%, 95%, 96%, 97%, 98% or 99% with the polypeptide described in A), and derived from Corynebacterium;

[0054] (2) Releasing the feedback inhibition of L-proline on glutamate kinase or weakening the feedback inhibition of L-proline.

[0055] (3) Introducing the gene encoding proline hydroxylase into the strain obtained in step (2).

[0056] In another preferred embodiment, the activity of glutamate kinase and / or glutamate semialdehyde dehydrogenase and / or pyrroline-5-carboxylic acid reductase in the production bacteria is enhanced. In another preferred embodiment, the proline hydroxylase is trans-proline-4-hydroxylase, and its nucleotide sequence is shown in SEQ ID NO:5.

[0057] Beneficial effects of the present invention:

[0058] 1. The present invention has been found through screening that the threonine efflux protein ThrE is an L-proline efflux protein of Corynebacterium glutamicum. L-proline producing bacteria SZCgP1 and SZCgP3 are constructed on the basis of Corynebacterium glutamicum ATCC13869 and ATCC13032 strains, and ThrE is overexpressed in these two strains, which can increase the L-proline production by 1.57 times and 2.56 times, respectively. Therefore, it can be used for bacterial fermentation to produce L-proline in practice, which is convenient for promotion and application, and has important industrial application value.

[0059] 2. The present invention also uses ThrE in the production of hydroxyproline such as trans-4-hydroxy-L-proline. Knocking out the thrE gene significantly reduces the yield of extracellular L-proline byproducts, increases the ratio of hydroxyproline such as trans-4-hydroxy-L-proline to L-proline, and helps to obtain higher purity hydroxyproline such as trans-4-hydroxy-L-proline. Knocking out the thrE gene is of great significance to the production of hydroxyproline products such as trans-4-hydroxy-L-proline.

[0060] 3. The present invention provides a new idea for constructing a hydroxyproline-producing strain, that is, knocking out the L-proline efflux protein of the strain to increase the concentration of intracellular L-proline. The increased intracellular L-proline can serve as a substrate for hydroxyproline, thereby converting intracellular L-proline into hydroxyproline under the action of proline hydroxylase, which has a reference significance for constructing a higher-yield hydroxyproline-producing strain in the art. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Figure 1 .pCas9gRNA-ccdB plasmid map;

[0062] Figure 2 .pEC-thrE1 plasmid map;

[0063] Figure 3 .pEC-thrE2 plasmid map. DETAILED DESCRIPTION

[0064] The technical scheme of the present invention will be further described in detail below in conjunction with specific embodiments. It should be understood that the following embodiments are only exemplary descriptions and explanations of the present invention and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are included in the scope that the present invention is intended to protect.

[0065] Unless otherwise specified, the raw materials and reagents used in the following examples are commercially available or can be prepared by known methods. The experimental methods in the following examples without specifying specific conditions are usually carried out according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer.

[0066] Definition and explanation:

[0067] The term "polypeptide having L-proline efflux function" used herein refers to a protein or polypeptide that can efflux intracellular L-proline to the extracellular space, which may be the protein described in Sequence 1 or Sequence 2, or a protein or polypeptide obtained by mutating Sequence 1 or Sequence 2 and still having L-proline efflux function.

[0068] As used herein, the terms "protein," "polypeptide," and "peptide" are used interchangeably and have the meanings commonly understood by those of ordinary skill in the art. They are used interchangeably herein and refer to amino acid polymers of any length. The polymer may be linear or branched, it may contain modified amino acids, and it may be interrupted by non-amino acids. The term also includes amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component).

[0069] The term "fusion protein" used herein refers to a protein obtained by fusing the mutant protein with a protein tag. The protein tag may be located at the N-terminus of the mutant protein or at the C-terminus of the mutant protein. There may also be an intervening amino acid residue between the mutant protein and the protein tag, specifically, there may be less than 10 intervening amino acid residues.

[0070] Term " host cell " herein means to be easy to comprise the polypeptide with L-proline efflux functional activity of the present disclosure, polynucleotide of encoding polypeptide or any cell type of transformation, transfection, transduction etc.Term " recombinant microorganism " contains the host cell that is different from parental cell after importing transcription initiation element or recombinant expression vector, and recombinant host cell is specifically realized by transformation.For example, be applicable to host cell of the present invention and include but not limited to Escherichia, Corynebacterium, preferably Escherichia coli or Corynebacterium glutamicum, more preferably Corynebacterium glutamicum, more specifically Corynebacterium glutamicum ATCC13032, Corynebacterium glutamicum ATCC13869, Corynebacterium glutamicum B253, Corynebacterium glutamicum ATCC 14067.

[0071] The term "transformation" herein has the meaning generally understood by those skilled in the art, i.e., the process of introducing exogenous DNA into a host. The method of transformation includes any method of introducing nucleic acid into a cell, including but not limited to electroporation, calcium phosphate precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method.

[0072] The host cells herein can be cultured according to conventional methods in the art, including but not limited to well plate culture, shake flask culture, batch culture, continuous culture and fed-batch culture, etc., and various culture conditions such as temperature, time and pH value of the culture medium can be appropriately adjusted according to actual conditions.

[0073] As used herein, the terms "comprising," "having," "including," or "containing" are intended to be inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0074] As used herein, "about" means that a value includes the standard deviation of error for the device or method being employed to determine the value.

[0075] As used herein, the definition of "or" is only alternatives and "and / or", but unless it is explicitly stated that there are only alternatives or the alternatives are mutually exclusive, the term "or" in a claim means "and / or".

[0076] The selected / optional / preferred "numerical range" used herein includes both the numerical endpoints at both ends of the range and all the natural numbers covered between the numerical endpoints relative to the aforementioned numerical endpoints.

[0077] As used herein, the terms "wild-type" and "naturally occurring" refer to an object that can be found in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism, can be isolated from a source in nature and has not been intentionally modified by humans in the laboratory is naturally occurring.

[0078] The term "amino acid mutation" or "nucleotide mutation" used herein includes "substitution, duplication, deletion or addition of one or more amino acids or nucleotides". In the present invention, the term "mutation" refers to a change in a nucleotide sequence or an amino acid sequence. In a specific embodiment, the term "mutation" refers to "substitution".

[0079] The term "native state" as used herein refers to the activity of a polypeptide in a microorganism in an unmodified state, ie, the activity in the natural state.

[0080] The term "having L-proline efflux activity" used herein is the same or similar to the meaning commonly understood by those skilled in the art, and refers to the amino acid sequence of a certain fragment being a part of the amino acid sequence of a complete protein or polypeptide, and having the same or similar function or activity as the complete protein or polypeptide. Specifically, in the present invention, it refers to any amino acid fragment having L-proline efflux function obtained from the ThrE protein of the present invention.

[0081] Those skilled in the art know that it is more important to find sites that can achieve the desired purpose when mutating wild-type polypeptides to enhance activity. Therefore, based on the teachings of the present invention, those skilled in the art will mutate the amino acid sequence shown in sequence 1 or 2, and detect the relevant activity of the mutant. In addition, it is not difficult for those of ordinary skill in the art to know that changing a few amino acid residues in certain regions of the polypeptide, such as non-important regions, will not substantially change the biological activity. For example, the sequence obtained by appropriately replacing certain amino acids will not affect its activity (see Watson et al., Molecular Biology of The Gene, Fourth Edition, 1987, The Benjamin / Cummings Pub. Co. P224). Therefore, those of ordinary skill in the art can implement such replacements and ensure that the resulting molecules still have the desired biological activity.

[0082] Therefore, it is obvious that further mutations can be made to the L-proline efflux protein of the present invention to obtain further mutants that still have the corresponding functions and activities. For example, it is well known to those skilled in the art that adding or reducing a number of amino acid residues, such as preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, and most preferably 1 amino acid residue at either end of the polypeptide will not affect the function of the obtained mutant. For example, for the convenience of purification, technicians often carry a 6×His tag at either end of the obtained protein, and this protein has the same function as the protein without the 6×His tag. Therefore, the present invention should include conservative mutations obtained on the basis of the present invention.

[0083] The term "conservative mutation" refers to a mutation that can maintain the normal function of a protein. A representative example of a conservative mutation is a conservative substitution.

[0084] As used in the present disclosure, the term "conservative substitution" refers to replacing an amino acid residue with an amino acid residue with a similar side chain. Families of amino acid residues with similar side chains have been defined in the art, and include amino acids with basic side chains (e.g., lysine, arginine, and histidine), acidic side chains (e.g., aspartic acid and glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, and cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan), β-branched chains (e.g., threonine, valine, and isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, and histidine).

[0085] As used in the present disclosure, "conservative substitutions" generally exchange an amino acid at one or more sites in a protein. Such substitutions may be conservative. Exemplary substitutions that are considered conservative substitutions include substitutions of Ala to Ser or Thr, substitutions of Arg to Gln, His or Lys, substitutions of Asn to Glu, Gln, Lys, His or Asp, substitutions of Asp to Asn, Glu or Gln, substitutions of Cys to Ser or Ala, substitutions of Gln to Asn, Glu, Lys, His, Asp or Arg, substitutions of Glu to Gly, Asn, Gln, Lys or Asp, substitutions of Gly to Pro, substitutions of His to Asn, Lys, Gln, Arg or Tyr. Conservative mutations include substitutions of Ile to Leu, Met, Val or Phe, substitutions of Leu to Ile, Met, Val or Phe, substitutions of Lys to Asn, Glu, Gln, His or Arg, substitutions of Met to Ile, Leu, Val or Phe, substitutions of Phe to Trp, Tyr, Met, Ile or Leu, substitutions of Ser to Thr or Ala, substitutions of Thr to Ser or Ala, substitutions of Trp to Phe or Tyr, substitutions of Tyr to His, Phe or Trp, and substitutions of Val to Met, Ile or Leu. In addition, conservative mutations also include naturally occurring mutations caused by individual differences, strains, species differences, etc. from which genes are derived.

[0086] The term "corresponding to" as used herein has the meaning generally understood by those of ordinary skill in the art. Specifically, "corresponding to" means that after two sequences are aligned for homology or sequence identity, a position in one sequence corresponds to a specified position in another sequence. Thus, for example, with respect to "the amino acid residue corresponding to position 40 of the amino acid sequence shown in SEQ ID NO. 1", if a 6×His tag is added to one end of the amino acid sequence shown in SEQ ID NO. 1, then the position corresponding to position 40 in the resulting mutant may be position 46 of the amino acid sequence shown in SEQ ID NO. 1.

[0087] In a specific embodiment, the homology or sequence identity may be greater than 90%, preferably greater than 95%, more preferably 96%, 97%, 98%, or 99%.

[0088] Methods for determining sequence homology or identity known to those of ordinary skill in the art include, but are not limited to: Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, AM and Griffin, HG, ed., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987 and Sequence Analysis Primer, Gribskov, M. and Devereux, J., ed., Stockton Press, New York, 1991 and Carillo, H. and Lipman, D., SIAM J. Applied Math., 48:1073 (1988). The preferred method for determining identity is to obtain the largest match between the sequences tested. Methods for determining identity are compiled in publicly available computer programs. Preferred computer program methods for determining the identity between two sequences include, but are not limited to, the GCG program package (Devereux, J. et al., 1984), BLASTP, BLASTN and FASTA (Altschul, S, F. et al., 1990). The BLASTX program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al., NCBI NLM NIH Bethesda, Md. 20894; Altschul, S. et al., 1990). The well-known Smith Waterman algorithm can also be used to determine identity.

[0089] Unless defined otherwise or clearly indicated by the context, all technical and scientific terms in the present disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which the present disclosure belongs.

[0090] Example 1: Screening of L-proline efflux protein of Corynebacterium glutamicum in Corynebacterium glutamicum ATCC13869 The inventors screened L-proline efflux protein of Corynebacterium glutamicum through a whole genome scale membrane transporter inhibition library. The cas9 gene of the pCas9 (LIU, Jiao, et al. Development of a CRISPR / Cas9 genome editing toolbox for Corynebacterium glutamicum. Microbial cell factories, 2017, 16.1: 205.) plasmid was subjected to D10A and H840A mutations, and the Bsa I restriction site in the plasmid backbone was removed to obtain the pdCas9 plasmid; then from the pnCas9 (D10A)-AID-gRNA-ccdB TS(WANG, Yu, et al. Expanding targeting scope, editing window, and base transition capability of base editing in Corynebacterium glutamicum. Biotechnology and bioengineering, 2019, 116: 3016-3029) The gRNA-ccdB expression cassette was amplified on the plasmid and cloned to the same position of pdCas9 to obtain a CRISPRi plasmid pdCas9gRNA-ccdB that can be efficiently constructed. Its sequence is shown in SEQ ID NO: 3. The inhibition efficiency of the system can reach 96%. Based on the above ingenious design, when inhibiting the target gene, it is only necessary to design a 20bp sgRNA target DNA binding region, synthesize 2 24bp complementary primers, anneal into double strands, and construct an inhibitory plasmid of the target gene through Golden Gate cloning. The inventors also constructed a control plasmid pdCas9gRNA-control without a 20bp positioning sequence. The protein sequence of the whole genome scale of Corynebacterium glutamicum ATCC13869 was predicted for membrane transporter in the TransportDB database to obtain 397 membrane transporters of the whole genome scale; then the inhibition plasmids of 397 membrane transporter genes were constructed based on the CRISPRi system, and the inhibition library plasmid and the control plasmid were respectively introduced into an L-proline production bacterium SZCgP1 (Corynebacterium glutamicum ATCC13869 introduced the G149D mutation of the proB gene, and the codon mutated from GGT to GAT, specifically referring to CN101084312A), and the inhibition library strain was obtained; finally, the L-proline specific yield of all strains was evaluated by 96-well plate fermentation, and the gene whose L-proline specific yield decreased after inhibition was a possible L-proline efflux protein gene. Based on the above screening, the inventor screened thrE (Cgl2622, which has been confirmed as an L-threonine efflux protein in the literature) gene inhibition, and the L-proline specific yield decreased significantly. The primers for constructing the CRISPRi plasmid of the thrE gene were thrE-F and thrE-R (Table 1). The control strain was SZCgP1 (pdCas9gRNA-control), the inhibitory plasmid of the thrE gene was pdCas9gRNA-thrE, and the inhibitory strain of the thrE gene was SZCgP1 (pdCas9gRNA-thrE).

[0091] Table 1

[0092] Primers Nucleotide sequence SEQ ID NO. thrE-F TTCACACTGCTCGAACTTGTACCT 6 thrE-R AAACAGGTACAAGTTCGAGCAGTG 7

[0093] In order to further confirm the effect of thrE gene inhibition on L-proline production, a 24-well deep-well plate was used for fermentation evaluation. The seed culture medium composition was (g / L): glucose, 5g / L; yeast powder, 1g / L; soy peptone, 3g / L; urea, 3g / L; succinic acid, 0.5g / L; K2HPO4·3H2O, 1g / L; MgSO4·7H2O, 0.1g / L; biotin, 0.01mg / L; vitamin B1, 0.1mg / L; MOPS, 20g / L. The fermentation medium composition is: glucose, 80g / L; yeast powder, 1g / L; soy peptone, 1g / L; NaCl, 1g / L; ammonium sulfate, 1g / L; urea, 6g / L; K2HPO4·3H2O, 1g / L; MgSO4·7H2O, 0.45g / L; FeSO4·7H2O, 0.05g / L; biotin, 0.4mg / L; vitamin B1, 0.1mg / L; MOPS, 40g / L; initial pH 7.2. First, the strain was inoculated into a seed medium containing 15μg / ml chloramphenicol and cultured for 8h. The culture was inoculated as a seed into a 24-well plate containing 15μg / ml chloramphenicol and 0.03mM IPTG fermentation medium. The medium liquid volume was 800μl, and the inoculation volume was controlled at the initial OD 600 0.03 (detected by microplate reader), cultured at 30℃ for 21h, the plate shaker speed was 800rpm, each strain was replicated 3 times, and OD was detected after the fermentation. 600 The detection method of L-proline is as follows: dilute to a suitable concentration with 3% (W / V) sulfosalicylic acid; take 1 mL of the diluent, add 1 mL of acid ninhydrin (1.25 g of ninhydrin dissolved in 30 mL of glacial acetic acid and 20 mL of 6M H3PO4, heated at 70°C to dissolve) and 1 mL of glacial acetic acid, react in a boiling water bath at 100°C for 45 minutes; after cooling, measure the OD 520 A standard curve was drawn using L-proline at a concentration of 0-100 mg / L, and the concentration of the sample to be tested was calculated based on the standard curve. The results are shown in Table 2. After the thrE gene expression was inhibited, the L-proline production and specific yield of the strain decreased by 63% and 49%, respectively.

[0094] Table 2 Effects of thrE gene expression inhibition on L-proline yield and specific yield

[0095]

[0096] Example 2. Identification of L-proline efflux protein of Corynebacterium glutamicum in Corynebacterium glutamicum ATCC13869

[0097] (1) Construction of knockout, complementation and overexpression strains of thrE gene in SZCgP1 strain

[0098] The inventors constructed knockout mutants based on CRISPR / Cas9 genome editing technology. Using pCas9 (LIU, Jiao, et al. Development of a CRISPR / Cas9 genome editing toolbox for Corynebacterium glutamicum. Microbial cell factories, 2017, 16.1: 205.) plasmid as template, cas9-1 / cas9-2 as primers, and introducing the operator lacO mutation on the primers (TGTGTGGAATTGTGAGCG GATA ACAATTTCA CACA mutates to TGTTGGAATTGTGAGCG CTC ACAATTTCACACA) and RBS mutation (AA AGG AGTTGAGA Mutation to AAAGG CACCCGAT ), amplify the fragment containing cas9; then use pnCas9(D10A)-AID-gRNA-ccdB TS (WANG, Yu, et al. Expanding targeting scope, editing window, and base transition capability of base editing in Corynebacterium glutamicum. Biotechnology and bioengineering, 2019, 116: 3016-3029) plasmid as a template, gRNA-1 / gRNA-2 as primers, amplify the plasmid backbone fragment containing the gRNA-ccdB expression cassette and the temperature-sensitive replication origin. The above two fragments were cloned and connected by the one-step recombination kit of Novozyme to obtain the pCas9gRNA-ccdB plasmid that can be efficiently constructed. The plasmid map is shown in Figure 1The sequence is shown in SEQ ID NO: 4. According to the reported genome sequence of Corynebacterium glutamicum ATCC13869, the ATCC13869 genome was used as a template, and thrE-1 / thrE-2 and thrE-3 / thr E-4 were used as primers to amplify the upstream and downstream homology arms respectively; the pCas9gRNA-ccdB plasmid was used as a template, and cas9-3 / cas9-4, cas9-5 / cas9-6, gRNA-3 / gRNA-4 were used as primers to amplify three plasmid backbone fragments, and a 20 bp gRNA target DNA binding region was introduced at the same time; the above five fragments were cloned and connected by a one-step recombination kit of Novazon to obtain the pCas9gRNA-thrE plasmid. The competent SZCgP1 strain was prepared, and about 2 μg of pCas9gRNA-thr E plasmid was electroporated, and 1 mL of TSB medium preheated at 46°C was added, heat-shocked at 46°C for 6 min, incubated at 30°C for 3 h, and coated on TSB plates supplemented with 15 μg / mL chloramphenicol and 0.05 mM IPTG, cultured for 2 days, and the correct mutant verified by PCR and sequencing was named SZCgP2 strain.

[0099] The overexpression plasmid was constructed as follows: thrE was overexpressed on the pEC-ccdB plasmid, a derivative plasmid of the pEC-XK99E plasmid, and the pEC-ccdB plasmid was digested with Bsa I; based on the reported genome sequence of Corynebacterium glutamicum ATCC13869, the ATCC13869 genome was used as a template, and the thrE1 gene fragment was amplified with thrE-5 / thrE-6. The amino acid sequence of the protein encoded by the thrE1 gene is shown in SEQ ID NO: 1. The above two fragments were cloned and connected by a one-step recombination kit of Novazonics to obtain the pEC-thrE1 plasmid. The plasmid map is shown in Figure 2 As shown. At the same time, a control plasmid pEC-control without any gene cloned on the plasmid was constructed. The pEC-thrE1 plasmid was transformed into the SZCgP2 strain to obtain the complemented strain SZCgP2 (pEC-thrE1); the pEC-thrE1 and pEC-control plasmids were transformed into SZCgP1, respectively, to obtain the overexpression strain and control strains SZCgP1 (pEC-thrE1) and SZCgP1 (pEC-control).

[0100] Table 3

[0101]

[0102]

[0103] (2) Shake flask fermentation to determine the intracellular and extracellular L-proline concentrations of thrE knockout, complementation, and overexpression strains

[0104] In order to further confirm whether the thrE gene is an L-proline efflux protein, shake flask fermentation was used to determine the intracellular and extracellular L-proline concentrations of knockout, complemented and overexpression strains. The composition of the seed culture medium was (g / L): glucose, 5g / L; yeast powder, 1g / L; soy peptone, 3g / L; urea, 3g / L; succinic acid, 0.5g / L; K2HPO4·3H2O, 1g / L; MgSO4·7H2O, 0.1g / L; biotin, 0.01mg / L; vitamin B1, 0.1mg / L; MOPS, 20g / L. The fermentation medium composition is: glucose, 80g / L; yeast powder, 1g / L; soy peptone, 1g / L; NaCl, 1g / L; ammonium sulfate, 1g / L; urea, 6g / L; K2HPO4·3H2O, 1g / L; MgSO4·7H2O, 0.45g / L; FeSO4·7H2O, 0.05g / L; biotin, 0.4mg / L; vitamin B1, 0.1mg / L; MOPS, 40g / L; initial pH 7.2. First, the strain was inoculated into the seed medium and cultured for 8h. The culture was inoculated as a seed into a 250mL triangular flask of the fermentation medium. The medium liquid volume was 25mL. 25μg / ml kanamycin and 0.05mM IPTG were added as needed. The inoculation amount was controlled at the initial OD 600 0.1 (determined by spectrophotometer), cultured at 30℃ for 21h, shaker speed at 2200rpm, three replicates for each strain, and OD was measured during the fermentation process. 600 , intracellular L-proline concentration and extracellular L-proline concentration.

[0105] The method for determining the concentration of L-proline inside and outside the cell is as follows: 400 μL of silicone oil is added to a 1.5 mL centrifuge tube in advance, 400 μL of fermented bacterial liquid is quickly drawn and slowly added, and centrifuged at 4°C, 12000 rpm for 10 min. The supernatant is the extracellular sample. The bacterial sediment at the bottom of the centrifuge tube is cut off and placed in a 1.5 mL centrifuge tube. An appropriate amount of 3% sulfosalicylic acid is added according to the amount of the bacterial cell, boiled at 100°C for 20 min, and centrifuged at 12000 rpm for 10 min. The supernatant is the intracellular sample. The L-proline detection method is the same as shown in Example 1, and the intracellular L-proline concentration is converted according to the volume of Corynebacterium glutamicum reported in the literature.

[0106] The results of the determination of intracellular and extracellular L-proline concentrations of each strain during the fermentation process are shown in Tables 4 and 5. The extracellular L-proline concentration of the thrE gene knockout strain SZCgP2 was significantly lower than that of the starting strain SZCgP1 throughout the fermentation process, and the intracellular L-proline concentration was slightly higher than that of the starting strain SZCgP1 in the early stage of fermentation (3-9h); the extracellular L-proline concentration of the complement strain SZCgP2 (pEC-thrE1) was significantly higher than that of the starting strain SZCgP1 throughout the fermentation process, and the intracellular L-proline concentration was significantly lower than that of the starting strain during the rapid acid production period (3-15h). The extracellular L-proline concentration of the overexpression strain SZCgP1 (pEC-thrE1) was significantly higher than that of the control strain SZCgP1 (pEC-control) throughout the fermentation process, and the intracellular L-proline concentration was significantly lower than that of the control strain SZCgP1 (pEC-control) during the entire fermentation process (especially the rapid acid production period). The above results indicate that ThrE is a proline efflux protein. Overexpression of ThrE in the SZCgP1 strain can increase the production of L-proline. The extracellular L-proline production of the overexpression strain SZCgP1 (pEC-thrE1) increased by 1.57 times compared with the control strain SZCgP1 (pEC-control) with an empty plasmid at 21h, indicating that overexpression of L-proline efflux protein genes is of great significance in the transformation of L-proline production strains.

[0107] Table 4 Intracellular L-proline concentrations of thrE gene knockout, complementation and overexpression strains in Corynebacterium glutamicum ATCC13869

[0108]

[0109] Table 5 Extracellular L-proline concentrations of thrE gene knockout, complementation and overexpression strains in Corynebacterium glutamicum ATCC13869

[0110]

[0111]

[0112] Example 3. Application of L-proline efflux protein in Corynebacterium glutamicum ATCC13032 strain for L-proline production

[0113] First, an L-proline producing bacterium SZCgP3 was constructed based on the Corynebacterium glutamicum ATCC13032 strain, that is, the G149K mutation of the proB gene was introduced, and the codon was mutated from GGT to AAG (see CN101084312A). The construction of the ThrE overexpression strain is similar to that of the Corynebacterium glutamicum 13869 strain. ThrE was overexpressed on the pEC-ccdB plasmid, a derivative plasmid of the pEC-XK99E plasmid, and the pEC-ccdB plasmid was digested with Bsa I. The genome of Corynebacterium glutamicum ATCC13032 was used as a template, and the thrE2 gene fragment was amplified with thrE-5 / thrE-6. The amino acid sequence of the protein encoded by the thrE2 gene is shown in SEQ ID NO: 2. The above two fragments were cloned and connected by a one-step recombination kit of Novazon to obtain the pEC-thrE2 plasmid. The plasmid map is shown in Figure 3 As shown. pEC-thrE2 and pEC-control plasmids were transformed into SZCgP3 respectively to obtain overexpression strains and control strains SZCgP3 (pEC-thrE2) and SZCgP3 (pEC-control). Shake flask fermentation evaluated the extracellular L-proline production of the above strains, and the fermentation method was the same as shown in Example 2. The results are shown in Table 6. Overexpression of ThrE in Corynebacterium glutamicum SZCgP3 can increase L-proline production. Overexpression strain SZCgP3 (pEC-thrE2) increased by 2.56 times in 21h relative to the control bacteria SZCgP3 (pEC-control) into which an empty plasmid was introduced, further indicating that overexpression of L-proline efflux protein gene in Corynebacterium glutamicum is of great significance in L-proline production.

[0114] Table 6 Extracellular L-proline production of thrE gene overexpression strains in Corynebacterium glutamicum ATCC13032

[0115]

[0116] Example 4. Application of L-proline efflux protein in hydroxyproline production

[0117] First, a plasmid expressing trans-proline-4-hydroxylase was constructed, and an expression plasmid pEC-mip4h expressing trans-proline-4-hydroxylase as shown in patent CN201710661945.1 was artificially synthesized based on the pEC-XK99E plasmid, wherein the sequence of trans-proline-4-hydroxylase is shown in SEQ ID NO: 5. The pEC-mip4h and pEC-XK99E control plasmids were transformed into SZCgP1 and SZCgP2 strains, respectively, to obtain overexpression strains and control strains SZCgP1 (pEC-mip4h) and SZCgP1 (pEC-XK99E), as well as SZCgP2 (pEC-mip4h) and SZCgP2 (pEC-XK99E).

[0118] The components of the seed culture medium are (g / L): glucose, 5g / L; yeast powder, 1g / L; soy peptone, 3g / L; urea, 3g / L; succinic acid, 0.5g / L; K2HPO4·3H2O, 1g / L; MgSO4·7H2O, 0.1g / L; biotin, 0.01mg / L; vitamin B1, 0.1mg / L; MOPS, 20g / L. The fermentation medium composition is: glucose, 80g / L; yeast powder, 1g / L; soy peptone, 1g / L; NaCl, 1g / L; ammonium sulfate, 1g / L; urea, 6g / L; K2HPO4·3H2O, 1g / L; MgSO4·7H2O, 0.45g / L; FeSO4·7H2O, 0.2g / L; biotin, 0.4mg / L; vitamin B1, 0.1mg / L; MOPS, 40g / L; initial pH 7.2. First, the strain was inoculated into the seed medium and cultured for 8h. The culture was inoculated as seeds into a 24-well plate containing 800μl of fermentation medium. The inoculation amount was controlled at the initial OD 600 The pH value was 0.1 (detected by microplate reader), cultured at 30℃ for 18h, the plate shaker speed was 800rpm, and each strain was replicated 3 times. After the fermentation, the OD value was detected. 600, trans-4-hydroxy-L-proline and L-proline yields. The detection method of trans-4-hydroxy-L-proline refers to the national standard GB / T 9695.23-2008, and the detection method of L-proline is the same as that shown in Example 1. The results are shown in Table 7. The strain that does not express trans-proline-4-hydroxylase cannot produce trans-4-hydroxy-L-proline. Knocking out the L-proline efflux protein thrE gene will significantly reduce the yield of extracellular L-proline byproducts, increase the ratio of trans-4-hydroxy-L-proline to L-proline, and help obtain a higher purity of trans-4-hydroxy-L-proline yield. It is expected that further strengthening the activity of trans-proline-4-hydroxylase will allow the L-proline synthesized in the strain to be quickly converted into trans-4-hydroxy-L-proline. Knocking out the L-proline efflux protein thrE gene will also reduce the efflux of L-proline to the extracellular space, while also increasing the production of trans-4-hydroxy-L-proline. Therefore, knocking out the L-proline efflux protein thrE is of great significance to the production of trans-4-hydroxy-L-proline.

[0119] Table 7 Effect of thrE gene knockout on extracellular trans-4-hydroxy-L-proline and L-proline production

[0120]

[0121] Hydroxyproline has four natural stereoisomers, namely trans-4-hydroxy-L-proline, cis-4-hydroxy-L-proline, trans-3-hydroxy-L-proline, and cis-3-hydroxy-L-proline. Those skilled in the art are aware that these four different hydroxyprolines are obtained by directly catalyzing L-proline with the corresponding trans-proline-4-hydroxylase, cis-proline-4-hydroxylase, trans-proline-3-hydroxylase, and cis-proline-3-hydroxylase. Prior art literature has also reported that different hydroxyprolines can be produced by overexpressing different proline hydroxylases based on L-proline production strains (Zhang F, Liu H, Zhang T, Pijning T, Yu L, Zhang W, Liu W, Meng X. Biochemical and genetic characterization of fungal proline hydroxylase in echinocandin biosynthesis. Appl Microbiol Biotechnol.2018Sep;102(18):7877-7890.Chen K,PangY,Zhang B,Feng J,Xu S,Wang X,Ouyang P.Process optimization for enhanced production of cis-4-hydroxy-L-proline by engineered Escherichia coli.MicrobCell Fact.2017Nov 22;16(1):210. Mori H, Shibasaki T, Yano K, Ozaki A. Purification and cloning of a proline 3-hydroxylase, a novel enzyme which hydroxylates freeL-proline to cis-3-hydroxy-L-proline. J Bacteriol. 1997 Sep; 179(18):5677-83.).Therefore, for those skilled in the art, in this example, it is demonstrated that knocking out the L-proline efflux protein ThrE can increase the intracellular L-proline concentration, and overexpressing trans-proline-4-hydroxylase on the basis of the strain can increase the trans-4-hydroxy-L-proline production. It is obvious to those skilled in the art that overexpressing different proline hydroxylases on the basis of knocking out the L-proline efflux protein ThrE can increase the corresponding hydroxyproline production, that is, knocking out the L-proline efflux protein is of great significance to the production of the above four types of hydroxyproline.

[0122] The above is an explanation of the embodiments of the present invention. However, the present invention is not limited to the above embodiments. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention. Sequence Listing <110> Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences <120> Protein with L-proline efflux function and its application <160> twenty three <170> SIPOSequenceListing 1.0 <210> 1 <211> 489 <212> PRT <213> Corynebacterium glutamicum <400> 1 Met Leu Ser Phe Ala Thr Leu Arg Gly Arg Ile Ser Thr Val Asp Ala 1 5 10 15 Ala Lys Ala Ala Pro Pro Pro Ser Pro Leu Ala Pro Ile Asp Leu Thr 20 25 30 Asp His Ser Gln Val Ala Gly Val Met Asn Leu Ala Ala Arg Ile Gly 35 40 45 Asp Ile Leu Leu Ser Ser Gly Thr Ser Ser Asn Ser Asp Thr Lys Val Gln 50 55 60 Val Arg Ala Val Thr Ser Ala Tyr Gly Leu Tyr Tyr Thr His Val Asp 65 70 75 80 Ile Thr Leu Asn Thr Ile Thr Ile Phe Thr Asn Ile Gly Val Glu Arg 85 90 95 Lys Met Pro Val Asn Val Phe His Val Val Gly Lys Leu Asp Thr Asn 100 105 110 Phe Ser Lys Leu Ser Glu Val Asp Arg Leu Ile Arg Ser Ile Gln Ala 115 120 125 Gly Ala Thr Pro Pro Glu Val Ala Glu Lys Ile Leu Asp Glu Leu Glu 130 135 140 Gln Ser Pro Ala Ser Tyr Gly Phe Pro Val Ala Leu Leu Gly Trp Ala 145 150 155 160 Met Met Gly Gly Ala Ile Ala Val Leu Leu Gly Gly Gly Trp Gln Val 165 170 175 Ser Leu Ile Ala Phe Ile Thr Ala Phe Thr Ile Ile Ser Thr Thr Ser 180 185 190 Phe Leu Gly Lys Lys Gly Leu Pro Thr Phe Phe Gln Asn Val Val Gly 195 200 205 Gly Phe Ile Ala Thr Leu Pro Ala Ser Ile Ala Tyr Ser Leu Ala Leu 210 215 220 His Phe Gly Leu Glu Ile Lys Pro Ser Gln Ile Ile Ala Ser Gly Ile 225 230 235 240 Val Val Leu Leu Ala Gly Leu Thr Leu Val Gln Ser Leu Gln Asp Gly 245 250 255 Ile Thr Gly Ala Pro Val Thr Ala Ser Ala Arg Phe Phe Glu Thr Leu 260 265 270 Leu Phe Thr Gly Gly Ile Val Ala Gly Val Gly Leu Gly Ile Gln Leu 275 280 285 Ser Glu Ile Leu His Val Met Leu Pro Ala Met Glu Ser Ala Ala Ala 290 295 300 Pro Asn Tyr Ser Ser Thr Phe Ala Arg Ile Ile Ala Gly Gly Val Thr 305 310 315 320 Ala Ala Ala Phe Ala Val Gly Cys Tyr Ala Glu Trp Ser Ser Val Ile 325 330 335 Ile Ala Gly Leu Thr Ala Leu Met Gly Ser Ala Phe Tyr Tyr Leu Phe 340 345 350 Val Val Tyr Leu Gly Pro Val Ser Ala Ala Ala Ile Ala Ala Thr Ala 355 360 365 Val Gly Phe Thr Gly Gly Leu Leu Ala Arg Arg Phe Leu Ile Pro Pro 370 375 380 Leu Ile Val Ala Ile Ala Gly Ile Thr Pro Met Leu Pro Gly Leu Ala 385 390 395 400 Ile Tyr Arg Gly Met Tyr Ala Thr Leu Asn Asp Gln Thr Leu Met Gly 405 410 415 Phe Thr Asn Ile Ala Val Ala Leu Ala Thr Ala Ser Ser Leu Ala Ala Ala 420 425 430 Gly Val Val Leu Gly Glu Trp Ile Ala Arg Arg Leu Arg Arg Pro Pro 435 440 445 Arg Phe Asn Pro Tyr Arg Ala Phe Thr Lys Ala Asn Glu Phe Ser Phe 450 455 460 Gln Glu Glu Ala Glu Gln Asn Gln Arg Arg Gln Arg Lys Arg Pro Lys 465 470 475 480 Thr Asn Gln Arg Phe Gly Asn Lys Arg 485 <210> 2 <211> 489 <212> PRT <213> Corynebacterium glutamicum <400> 2 Met Leu Ser Phe Ala Thr Leu Arg Gly Arg Ile Ser Thr Val Asp Ala 1 5 10 15 Ala Lys Ala Ala Pro Pro Pro Ser Pro Leu Ala Pro Ile Asp Leu Thr 20 25 30 Asp His Ser Gln Val Ala Gly Val Met Asn Leu Ala Ala Arg Ile Gly 35 40 45 Asp Ile Leu Leu Ser Ser Gly Thr Ser Asn Ser Asp Thr Lys Val Gln 50 55 60 Val Arg Ala Val Thr Ser Ala Tyr Gly Leu Tyr Tyr Thr His Val Asp 65 70 75 80 Ile Thr Leu Asn Thr Ile Thr Ile Phe Thr Asn Ile Gly Val Glu Arg 85 90 95 Lys Met Pro Val Asn Val Phe His Val Val Gly Lys Leu Asp Thr Asn 100 105 110 Phe Ser Lys Leu Ser Glu Val Asp Arg Leu Ile Arg Ser Ile Gln Ala 115 120 125 Gly Ala Thr Pro Pro Glu Val Ala Glu Lys Ile Leu Asp Glu Leu Glu 130 135 140 Gln Ser Pro Ala Ser Tyr Gly Phe Pro Val Ala Leu Leu Gly Trp Ala 145 150 155 160 Met Met Gly Gly Ala Val Ala Val Leu Leu Gly Gly Gly Trp Gln Val 165 170 175 Ser Leu Ile Ala Phe Ile Thr Ala Phe Thr Ile Ile Ala Thr Thr Ser 180 185 190 Phe Leu Gly Lys Lys Gly Leu Pro Thr Phe Phe Gln Asn Val Val Gly 195 200 205 Gly Phe Ile Ala Thr Leu Pro Ala Ser Ile Ala Tyr Ser Leu Ala Leu 210 215 220 Gln Phe Gly Leu Glu Ile Lys Pro Ser Gln Ile Ile Ala Ser Gly Ile 225 230 235 240 Val Val Leu Leu Ala Gly Leu Thr Leu Val Gln Ser Leu Gln Asp Gly 245 250 255 Ile Thr Gly Ala Pro Val Thr Ala Ser Ala Arg Phe Phe Glu Thr Leu 260 265 270 Leu Phe Thr Gly Gly Ile Val Ala Gly Val Gly Leu Gly Ile Gln Leu 275 280 285 Ser Glu Ile Leu His Val Met Leu Pro Ala Met Glu Ser Ala Ala Ala 290 295 300 Pro Asn Tyr Ser Ser Thr Phe Ala Arg Ile Ile Ala Gly Gly Val Thr 305 310 315 320 Ala Ala Ala Phe Ala Val Gly Cys Tyr Ala Glu Trp Ser Ser Val Ile 325 330 335 Ile Ala Gly Leu Thr Ala Leu Met Gly Ser Ala Phe Tyr Tyr Leu Phe 340 345 350 Val Val Tyr Leu Gly Pro Val Ser Ala Ala Ala Ile Ala Ala Thr Ala 355 360 365 Val Gly Phe Thr Gly Gly Leu Leu Ala Arg Arg Phe Leu Ile Pro Pro 370 375 380 Leu Ile Val Ala Ile Ala Gly Ile Thr Pro Met Leu Pro Gly Leu Ala 385 390 395 400 Ile Tyr Arg Gly Met Tyr Ala Thr Leu Asn Asp Gln Thr Leu Met Gly 405 410 415 Phe Thr Asn Ile Ala Val Ala Leu Ala Thr Ala Ser Ser Leu Ala Ala Ala 420 425 430 Gly Val Val Leu Gly Glu Trp Ile Ala Arg Arg Leu Arg Arg Pro Pro 435 440 445 Arg Phe Asn Pro Tyr Arg Ala Phe Thr Lys Ala Asn Glu Phe Ser Phe 450 455 460 Gln Glu Glu Ala Glu Gln Asn Gln Arg Arg Gln Arg Lys Arg Pro Lys 465 470 475 480 Thr Asn Gln Arg Phe Gly Asn Lys Arg 485 <210> 3 <211> 11773 <212> Ms <213> Artificial Sequence <400> 3 aattaagctt aaaggagttg agaatggata agaaatactc aataggctta gctatcggca 60 caaatagcgt cggatgggcg gtgatcactg atgaatataa ggttccgtct aaaaagttca 120 aggttctggg aaatacagac cgccacagta tcaaaaaaaa tcttataggg gctcttttat 180 ttgacagtgg agagacagcg gaagcgactc gtctcaaacg gacagctcgt agaaggtata 240 cacgtcggaa gaatcgtatt tgttatctac aggagatttt ttcaaatgag atggcgaaag 300 tagatgatag tttctttcat cgacttgaag agtctttttt ggtggaagaa gacaagaagc 360 atgaacgtca tcctattttt ggaaatatag tagatgaagt tgcttatcat gagaaatatc 420 caactatcta tcatctgcga aaaaaattgg tagattctac tgataaagcg gatttgcgct 480 taatctattt ggccttagcg catatgatta agtttcgtgg tcattttttg attgagggag 540 atttaaatcc tgataatagt gatgtggaca aactatttat ccagttggta caaacctaca 600 atcaattatt tgaagaaaac cctattaacg caagtggagt agatgctaaa gcgattcttt 660 ctgcacgatt gagtaaatca agacgattag aaaatctcat tgctcagctc cccggtgaga 720 agaaaaatgg cttatttggg aatctcattg cttgtcatt gggtttgacc cttaatttta 780 aatcaaattt tgatttggca gaagatgcta aattacagct ttcaaaagat acttacgatg 840 atgatttaga taatttattg gcgcaaattg gagatcaata tgctgatttg ttttggcag 900 ctaagaattt atcagatgct atttacttt cagatatcct aagagtaaat actgaaataa 960 ctaaggctcc cctatcagct tcaatgatta aacgctacga tgaacatcat caagacttga 1020 ctctttaaa agctttagtt cgacaacaac ttccagaaaa gtataaagaa atctttttg 1080 atcaatcaaa aaacggatat gcaggttata ttgatggggg agctagccaa gaagaattttt 1140 ataaatttat caaaccaatt ttagaaaaaa tggatggtac tgaggaatta ttggtgaaac 1200 taaatcgtga agatttgctg cgcaagcaac ggacctttga caacggctct attccccatc 1260 aaattcactt gggtgagctg catgctattt tgagaagaca agaagacttt tatccatttt 1320 taaaagacaa tcgtgagaag attgaaaaaa tcttgacttt tcgaattcct tattatgttg 1380 gtccattggc gcgtggcaat agtcgttttg catggatgac tcggattct gagaaaaca 1440 ttacccatg gattttgaa gaagttgtcg ataaggtgc ttcagctca tcatttattg 1500 aacgcatgac aactttgat aaaaatctc caatgaaa agtactacca aacatagtt 1560 tgctttatga gttattttacg gtttataacg aattgacaaa ggtcaaat gttactgaag 1620 gatgcgaaa accagcattt ctttcaggtg aacagaagaa acccattgtt gatttactct 1680 tcaaaaaaaaaaaagta accgttaagc attaaaaga agattttc aaaaaaatag 1740 aatgttttga tagtgttgaa atttcaggag tgagatag atttaatgct tcattaggta 1800 cctaccatga ttgctaaaa attattaaag aaagattt tttggataat gagaaaatg 1860 Agathatactt Agaggatatt Gttttacat Tgaccttatt Tgagatagg Gagatgattg 1920s aggaagact taaaacatat gctcacct ttgatgataa ggtgatgaa cagcttaac 1980 gtcgccgtta tactggttgg ggacgttttgt ctcgaaaatt gattaatggt attaggata 2040 agcaatctgg caaacaata ttagatttt tgaaatcaga tggttttgcc aatcgcaatt 2100 ttatgcagct gatccatgat gatagtttga catttaaaga agacattcaa aaagcacaag 2160 tgtctggaca aggcgatagt ttacatgaac atattgcaaa tttagctggt agccctgcta 2220 ttaaaaaagg tattttacag actgtaaaag ttgttgatga attggtcaaa gtaatggggc 2280 ggcataagcc agaaaatatc gttattgaaa tggcacgtga aaatcagaca actcaaaagg 2340 gccagaaaaa ttcgcgagag cgtatgaaac gaatcgaaga aggtatcaaa gaattaggaa 2400 gtcagattct taaagagcat cctgttgaaa atactcaatt gcaaaatgaa aagctctatc 2460 tctattatct ccaaaatgga agagacatgt atgtggacca agaattagat attaatcgtt 2520 taagtgatta tgatgtcgat gccattgttc cacaaagttt ccttaaagac gattcaatag 2580 acaataaggt cttaacgcgt tctgataaaa atcgtggtaa atcggataac gttccaagtg 2640 aagaagtagt caaaaagatg aaaaactatt ggagacaact tctaaacgcc aagttaatca 2700 ctcaacgtaa gtttgataat ttaacgaaag ctgaacgtgg aggtttgagt gaacttgata 2760 aagctggttt tatcaaacgc caattggttg aaactcgcca aatcactaag catgtggcac 2820 2880 ttaaagtgat taccttaaaa tctaaattag tttctgactt ccgaaaagat ttccaattct 2940 ataagtacg tgagattaac aattaccatc atgcccatga tgcgtatcta aatgccgtcg 3000 ttggaactgc tttgattaag aaatatccaa aacttgaatc ggagtttgtc tatggtgatt 3060 ataaagttta tgatgttcgt aaaatgattg ctaagtctga gcaagaaata ggcaaagcaa 3120 ccgcaaaata tttcttttac tctaatatca tgaacttctt caaaacagaa attacacttg 3180 caaatggaga gattcgcaaa cgccctctaa tcgaaactaa tggggaaact ggagaaattg 3240 tctgggataa agggcgagat tttgccacag tgcgcaaagt attgtccatg ccccaagtca 3300 atattgtcaa gaaaacagaa gtacagacag gcggattctc caaggagtca attttaccaa 3360 aaagaaattc ggacaagctt attgctcgta aaaaagactg ggatccaaaa aaatatggtg 3420 gttttgatag tccaacggta gcttattcag tcctagtggt tgctaaggtg gaaaaaggga 3480 aatcgaagaa gtaaaaatcc gttaaagagt tactagggat cacaattatg gaagaagtt 3540 cctttgaaa aaatccgatt gactttttag aagctaaagg ataaggaa gttaaaaag 3600 acttaatcat taaactacct aatatagtc tttttgagtt agaaaacggt cgtaaacgga 3660 tgctggctag tgccggagaa ttacaaaag gaatgagct ggctctgcca agcaatg 3720 tgaattttt atatttagct agtcattagt aaagttgaa gggtagtcca gaagataacg 3780 aaaaaaaaaatgtttgtg gagcagcata agcattattt attgagatt attgagcaaa 3840 tcagtgaatt ttctaagcgt gttattttag cagatgccaa tttagataaa gttcttagtg 3900 catataacaa acatagagac aaaccaatac gtgaacaagc agaaaatatt attcatttat 3960 ttacgttgac gatcttgga gctcccgctg cttttaaata tttgataca acaattgatc 4020 gtaaacgata tacgtctaca aaagaagttt tagatgccac tcttatccat caatccatca 4080 ctggtcttta tgaacacgc attgatttga gtcagctagg agtgactga gcttggctgt 4140 tttggcggat gagagaagat ttcagcctg atacagatta atcagaacg cagaagcggt 4200 ctgataaaac agaatttgcc tggcggcagt agcgcggtgg tcccacctga cccatgccg 4260 aactcagaag tgaaacgccg tagcgccgat ggtagtgtgg ggtctgccca tgcgagagta 4320 gggaactgcc aggcatcaaa taaaacgaaa ggctcagtcg aaagactggg cctttcgttt 4380 tatctgttgt ttgtcggtga acgctctcct gagtaggaca aatccgccgg gagcggattt 4440 gaacgttgcg aagcaacggc ccggagggtg gcgggcagga cgcccgccat aaactgccag 4500 gcatcaaatt aagcagaagg ccatcctgac ggatggcctt tttgcgtttc tacaaactct 4560 tttgtttatt tttctaaata cattcaaata tgtatccgct catgagacaa taaccctgat 4620 4680 ttatccctt ttttgcggca ttttgccttc ctgtttttgc tcacccagaa acgctggtga 4740 aagtaaaaga tgctgaagat cagttgggtg cacgagtggg ttacatcgaa ctggatctca 4800 acagcggtaa gatccttgag agttttcgcc ccgaagaacg ttttccaatg atgagcactt 4860 ttgcttctc gctcactgac tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag 4920 ctcactcaaa ggcggtaata cggttatcca cagaatcagg ggataacgca ggaaagaaca 4980 tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt 5040 tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc 5100 gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct 5160 ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg 5220 tggcgctttc tcaatgctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca 5280 agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact 5340 atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta 5400 acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta 5460 actacggcta cactagaagg acagtatttg gtatctgcgc tctgctgaag ccagttacct 5520 tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggtggtt 5580 tttttgtttg caagcagcag attacgcgca gaaaaaaagg atctcaagaa gatcctttga 5640 tcttttctac ggggtctgac gctcagtgga acgaaaactc acgttaaggg attttggtca 5700 tgagattatc aaaaaggatc ttcacctaga tccttttggg gtgggcgaag aactccagca 5760 tgagatcccc gcgctggagg atcatccagc cattcggggt cgttcactgg ttcccctttc 5820 tgatttctgg catagaagaa cccccgtgaa ctgtgtggtt ccgggggttg ctgatttttg 5880 cgagacttct cgcgcaattc cctagcttag gtgaaaacac catgaaacac tagggaaaca 5940 cccatgaaac acccattagg gcagtagggc ggcttcttcg tctagggctt gcatttgggc 6000 ggtgatctgg tctttagcgt gtgaaagtgt gtcgtaggtg gcgtgctcaa tgcactcgaa 6060 cgtcacgtca tttaccgggt cacggtgggc aaagagaact agtgggttag acattgtttt 6120 cctcgttgtc ggtggtggtg agcttttcta gccgctcggt aaacgcggcg atcatgaact 6180 cttggaggtt ttcaccgttc tgcatgcctg cgcgcttcat gtcctcacgt agtgccaaag 6240 gaacgcgtgc ggtgaccacg acgggcttag cctttgcctg cgcttctagt gcttcgatgg 6300 tggcttgtgc ctgcgcttgc tgcgcctgta gtgcctgttg agcttcttgt agttgctgtt 6360 ctagctgtgc cttggttgcc atgctttaag actctagtag ctttcctgcg atatgtcatg 6420 cgcatgcgta gcaacattg tcctgcaact cattcattat gtgcagtgct cctgttacta 6480 gtcgtacata ctcatattta cctagtctgc atgcagtgca tgcacatgca gtcatgtcgt 6540 gctaatgtgt aaaacatgta catgcagatt gctgggggtg caggggcgg agccaccctg 6600 tccatgcggg gtgtggggct tgccccgccg gtacagacag tgagcaccgg ggcacctagt 6660 cgcggatacc cccctaggt atcggacacg taaccctccc atgtcgatgc aaatctttaa 6720 cattgagtac gggtaagctg gcagcatag ccaagctagg cggccaccaa acaccactaa 6780 aaaattaag tccctagaca agaaaccc ccgtgcgagc taccaactca tatgcacggg 6840 ggccacataa cccgaagggg tttcaattga caaccatagc actagctaag acaacgggca 6900 caacacccgc acaactcgc actgcgcaac cccgcacaac atcgggtcta ggtaacactg 6960 agtaacactg aaatagaagt gaacacctct aaggaaccgc aggtcaatga gggttctaag 7020 7080 gctctggcgg ggtgccatag gtggcgcagg gacgaagctg ttgcggtgtc ctggtcgtct 7140 aacggtgctt cgcagtttga gggtctgcaa aactctcact ctcgctgggg gtcacctctg 7200 gctgaattgg aagtcatggg cgaacgccgc attgagctgg ctattgctac taagaatcac 7260 ttggcggcgg gtggcgcgct catgatgttt gtgggcactg ttcgacacaa ccgctcacag 7320 tcatttgcgc aggttgaagc gggtattaag actgcgtact cttcgatggt gaaaacatct 7380 7440 agaactctt gggcgaacgg ttggcacttg caccgcaaca tgctgttgtt cttggatcgt 7500 ccactgtctg acgatgaact caaggcgttt gaggattcca tgttttcccg ctggtctgct 7560 ggtgtggtta aggccggtat ggacgcgcca ctgcgtgagc acggggtcaa acttgatcag 7620 gtgtctacct ggggtggaga cgctgcgaaa atggcaacct acctcgctaa gggcatgtct 7680 caggaactga ctggctccgc tactaaaacc gcgtctaagg ggtcgtacac gccgtttcag 7740 atgttggata tgttggccga tcaaagcgac gccggcgagg atatggacgc tgttttggtg 7800 gctcggtggc gtgagtatga ggttggttct aaaaaacctgc gttcgtcctg gtcacgtggg 7860 gctaagcgtg ctttgggcat tgattacata gacgctgatg tacgtcgtga aatggaagaa 7920 gaactgtaca agctcgccgg tctggaagca ccggaacggg tcgaatcaac ccgcgttgct 7980 gttgctttgg tgaagcccga tgattggaaa ctgattcagt ctgatttcgc ggtaggcag 8040 tacgttctcg attgcgtgga taaggctaag gacgtggccg ctgcgcaacg tgtcgctaat 8100 gaggtgctgg caagtctggg tgtggattcc accccgtgca tgatcgttat ggatgatgtg 8160 gacttggacg cggttctgcc tactcatggg gacgctacta agcgtgatct gaatgcggcg 8220 gtgttcgcgg gtaatgagca gactattctt cgcaccccact aaaagcggca taaaccccgt 8280 tcgatatttt gtgcgatgaa tttatggtca atgtcgcggg ggcaaactat gatgggtctt 8340 gttgttggcg tcccggaaaa cgattccgaa gcccaacctt tcatagaagg cggcggtgga 8400 attttctcc acataagctg gcaatgttgc gacgcaacag gtacagtgta attcatgaga 8460 ccacgcgtgg atccggctta ctaaaagcca gataacagta tgcgtatttg cgcgctgatt 8520 tttgcggtat aagaatatat actgatatgt atacccgaag tatgtcaaaa agaggtatgc 8580 tatgaagcag cgtattacag tgacagttga cagcgacagc tatcagttgc tcaaggcata 8640 tatgatgtca atatctccgg tctggtaagc acaaccatgc agaatgaagc ccgtcgtctg 8700 cgtgccgaac gctggaaagc ggaaaatcag gaagggatgg ctgaggtcgc ccggtttatt 8760 gaaatgaacg gctcttttgc tgacgagaac aggggctggt gaaatgcagt ttaaggttta 8820 cacctataaa agagagagcc gttatcgtct gtttgtggat gtacagagtg atattattga 8880 cacgcccggg cgacggatgg tgatccccct ggccagtgca cgtctgctgt cagataaagt 8940 ctcccgtgaa ctttacccgg tggtgcatat cggggatgaa agctggcgca tgatgaccac 9000 cgatatggcc agtgtgccgg tatccgttat cggggaagaa gtggctgatc tcagccaccg 9060 cgaaaatgac atcaaaaacg ccattaacct gatgttctgg ggaatataag gtctcagttt 9120 tagagctaga aatagcaagt taaaataagg ctagtccgtt atcaacttga aaaagtggca 9180 ccgagtcggt gctttttttc caggcatcaa ataaaacgaa aggctcagtc gaaagactgg 9240 gcctttcgtt ttatctgttg tttgtcggtg aacgctctcc tgagtaggac aaatccgccg 9300 ggagcggatt tgaacgttgc gaagcaacgg cccggagggt ggcgggcagg acgcccgcca 9360 taaactgcca ggcatcaaat taagcaag gccatcctga cggatggcct ttttgcgttt 9420 ctacaaactc tttttgttta tttttctaaa tacattcaaa tatgtatccg ctcatgaatt 9480 aattccgcta gatgacgtgc ggcttcgaaa atctcgtgat ggcaggttgg gcgtcgcttg 9540 gtcggtcatt tcgaagggca ccaataactg ccttaaaaaa attacgcccc gccctgccac 9600 tcatcgcagt actgttgtaa ttcattaagc attctgccga catggaagcc atcacagacg 9660 gcatgaatgaa cctgaatcgc cagcggcatc agcaccttgt cgccttgcgt samaattttg 9720 cccatggtga aaacggggc gaagaagttg tccatattgg ccacgtttaa atcaaaactg 9780 gtgaaactca cccagggatt ggctgagacg aaaaacatat tctcaataaa ccctttaggg 9840 aaataggcca ggttttcacc gtaacacgcc acatcttgcg aatatatgtg tagaaactgc 9900 cggaaatcgt cgtggtattc actccagagc gatgaaaacg tttcagtttg ctcatggaaa 9960 acggtgtaac aagggtgaac actatcccat atcaccagct caccgtcttt cattgccata 10020 cggaactccg gatgagcatt catcaggcgg gcaagaatgt gaataaaggc cggataaaac 10080 ttgtgcttat ttttctttac ggtctttaaa aaggccgtaa tatccagctg aacggtctgg 10140 ttataggtac attgagcaac tgactgaaat gcctcaaaat gttctttacg atgccattgg 10200 gatatatcaa cggtggtata tccagtgatt tttttctcca ttttagcttc cttagctcct 10260 gaaaatctcg tcgaagctcg gcggatttgt cctactcaag ctgatccgac aaaatccaca 10320 cattatccca ggtgtccgga tcggtcaaat acgctgccag ctcatagacc gtatccaaag 10380 catccggggc tgatccccgg cgccagggtg gtttttcttt tcaccagtga gacgggcaac 10440 agctgattgc ccttcaccgc ctggccctga gagagttgca gcaagcggtc cacgtggttt 10500 gccccagcag gcgaaaatcc tgtttgatgg tggttaacgg cgggatataa catgagctgt 10560 cttcggtatc gtcgtatccc actaccgaga tatccgcacc aacgcgcagc ccggactcgg 10620 taatggcgcg cattgcgccc agcgccatct gatcgttggc aaccagcatc gcagtgggaa 10680 cgatgccctc attcagcatt tgcatggttt gttgaaaacc ggacatggca ctccagtcgc 10740 cttcccgttc cgctatcggc tgaatttgat tgcgagtgag atatttatgc cagccagcca 10800 gacgcagacg cgccgagaca gaacttaatg ggcccgctaa cagcgcgatt tgctggtgac 10860 ccaatgcgac cagatgctcc acgcccagtc gcgtaccgtc ttcatgggag aaaataatac 10920 tgttgatggg tgtctggtca gagacatcaa gaaataacgc cggaacatta gtgcaggcag 10980 cttccacagc aatggcatcc tggtcatcca gcggatagtt aatgatcagc ccactgacgc 11040 gttgcgcgag aagattgtgc accgccgctt tacaggcttc gacgccgctt cgttctacca 11100 tcgacaccac cacgctggca cccagttgat cggcgcgaga tttaatcgcc gcgacaattt 11160 gcgacggcgc gtgcagggcc agactggagg tggcaacgcc aatcagcaac gactgtttgc 11220 ccgccagttg ttgtgccacg cggttgggaa tgtaattcag ctccgccatc gccgcttcca 11280 ctttttcccg cgttttcgca gaaacgtggc tggcctggtt caccacgcgg gaaacggtct 11340 gataagagac accggcatac tctgcgacat cgtataacgt tactggtttc acattcacca 11400 ccctgaattg actctcttcc gggcgctatc atgccatacc gcgaaaggtt ttgcaccatt 11460 cgatggtgtc aacgtaaatg ccgcttcgcc ttcgcgcgcg aattgcaagc tgatccgggc 11520 ttatcgactg cacggtgcac caatgcttct ggcgtcaggc agccatcgga agctgtggta 11580 tggctgtgca ggtcgtaaat cactgcataa ttcgtgtcgc tcaaggcgca ctcccgttct 11640 ggataatgtt ttttgcgccg acatcataac ggttctggca aatattctga aatgagctgt 11700 tgacaattaa tcatcggctc gtataatgtg tggaattgtg agcggataac aatttcacac 11760 aggaaacaga att 11773 <210> 4 <211> 11773 <212> DNA <213> Artificial Sequence <400> 4 aattaagctt aaaggcaccc gatatggata agaaatactc aataggctta gatatcggca 60 caaatagcgt cggatgggcg gtgatcactg atgaatataa ggttccgtct aaaaagttca 120 aggttctggg aaatacagac cgccacagta tcaaaaaaaa tcttataggg gctcttttat 180 ttgacagtgg agagacagcg gaagcgactc gtctcaaacg gacagctcgt agaaggtata 240 cacgtcggaa gaatcgtatt tgttatctac aggagatttt ttcaaatgag atggcgaaag 300 tagatgatag tttctttcat cgacttgaag agtctttttt ggtggaagaa gacaagaagc 360 atgaacgtca tcctattttt ggaaatatag tagatgaagt tgcttatcat gagaaatatc 420 caactatcta tcatctgcga aaaaaattgg tagattctac tgataaagcg gatttgcgct 480 taatctattt ggccttagcg catatgatta agtttcgtgg tcattttttg attgagggag 540 atttaaatcc tgataatagt gatgtggaca aactatttat ccagttggta caaacctaca 600 atcaattatt tgaagaaaac cctattaacg caagtggagt agatgctaaaa gcgattcttt 660 ctgcacgatt gagtaaatca agacgattag aaaatctcat tgctcagctc cccggtgaga 720 agaaaaatgg cttatttggg aatctcattg ctttgtcatt gggtttgacc cctaatttta 780 aatcaaattt tgatttggca gaagatgcta aattacagct ttcaaaagat acttacgatg 840 atgatttaga taatttattg gcgcaaattg gagatcaata tgctgatttg tttttggcag 900 ctaagaattt atcagatgct attttacttt cagatatcct aagagtaaat actgaaataa 960 ctaaggctcc cctatcagct tcaatgatta aacgctacga tgaacatcat caagacttga 1020 ctctttaaa agctttagtt cgacaacaac ttccagaaaa gtataaagaa atctttttg 1080 atcaatcaaa aaacggatat gcaggttata ttgatggggg agctagccaa gaagaattttt 1140 ataaatttat caaaccaatt ttagaaaaaa tggatggtac tgaggaatta ttggtgaaac 1200 taaatcgtga agatttgctg cgcaagcaac ggacctttga caacggctct attccccatc 1260 aaattcactt gggtgagctg catgctattt tgagaagaca agaagacttt tatccatttt 1320 taaaagacaa tcgtgagaag attgaaaaaa tcttgacttt tcgaattcct tattatgttg 1380 gtccattggc gcgtggcaat agtcgttttg catggatgac tcggaagtct gaagaaacaa 1440 ttaccccatg gaattttgaa gaagttgtcg ataaaggtgc ttcagctcaa tcatttattg 1500 aacgcatgac aaactttgat aaaaatcttc caaatgaaaa agtactacca aaacatagtt 1560 tgctttatga gtattttacg gtttataacg aattgacaaa ggtcaaatat gttactgaag 1620 gaatgcgaaa accagcattt ctttcaggtg aacagaagaa agccattgtt gatttactct 1680 tcaaaaaaaaaaaagta accgttaagc attaaaaga agattttc aaaaaaatag 1740 aatgttttga tagtgttgaa atttcaggag tgagatag atttaatgct tcattaggta 1800 cctaccatga ttgctaaaa attattaaag aaagattt tttggataat gagaaaatg 1860 Agathatactt Agaggatatt Gttttacat Tgaccttatt Tgagatagg Gagatgattg 1920s aggaagact taaaacatat gctcacct ttgatgataa ggtgatgaa cagcttaac 1980 gtcgccgtta tactggttgg ggacgttttgt ctcgaaaatt gattaatggt attaggata 2040 agcaatctgg caaacaata ttagatttt tgaaatcaga tggttttgcc aatcgcaatt 2100 ttatgcagct gatccatgat gatagtttga cattaaga agacattca aaagcacaag 2160 tgtctggaca aggcgatagt ttacatgaac atttgcaa tttagctgt agccctgcta 2220 ttaaaaaagg tattttacag actgtaaag tgttgatga attggtcaa gtaatggggc 2280 ggcataagcc agaaaatc gttattgaaa tggcacgtga aaatcagaca actcaaagg 2340 gccagaaaaa ttcgcgagag cgtatgaaac gatcgaga aggtatcaa gatttaggaa 2400 gtcagattct taaagagcat cctgttgaaa atactcaatt gcaaaatgaa aagctctatc 2460 tctattatct ccaaaatgga agagacatgt atgtggacca agaattagat attaatcgtt 2520 taagtgatta tgatgtcgat cacattgttc cacaaagttt ccttaaagac gattcaatag 2580 acaataaggt cttaacgcgt tctgataaaa atcgtggtaa atcggataac gttccaagtg 2640 aagaagtagt caaaaagatg aaaaactatt ggagacaact tctaaacgcc aagttaatca 2700 ctcaacgtaa gtttgataat ttaacgaaag ctgaacgtgg aggtttgagt gaacttgata 2760 aagctggttt tatcaaacgc caattggttg aaactcgcca aatcactaag catgtggcac 2820 aaattttgga tagtcgcatg aatactaaat acgatgaaaa tgataaactt attcgagagg 2880 ttaaagtgat taccttaaaa tctaaattag tttctgactt ccgaaaagat ttccaattct 2940 ataaagtacg tgagattaac aattaccatc atgcccatga tgcgtatcta aatgccgtcg 3000 ttggaactgc tttgattaag aaatatccaa aacttgaatc ggagtttgtc tatggtgatt 3060 ataaagttta tgatgttcgt aaaatgattg ctaagtctga gcaagaaata ggcaaagcaa 3120 ccgcaaaata tttcttttac tctaatatca tgaacttctt caaaacagaa attacacttg 3180 caaatggaga gattcgcaaa cgccctctaa tcgaaactaa tggggaaact ggagaaattg 3240 tctgggataa agggcgagat tttgccacag tgcgcaaagt attgtccatg ccccaagtca 3300 atattgtcaa gaaaacagaa gtacagacag gcggattctc caaggagtca attttaccaa 3360 aaagaaattc ggacaagctt attgctcgta aaaaagactg ggatccaaaa aaatatggtg 3420 gttttgatag tccaacggta gcttattcag tcctagtggt tgctaaggtg gaaaaaggga 3480 aatcgaagaa gtaaaaatcc gttaaagagt tactagggat cacaattatg gaagaagtt 3540 cctttgaaaa aaatccgatt gactttttag aagctaaagg atataaggaa gttaaaaaag 3600 acttaatcat taaactacct aaatatagtc tttttgagtt agaaaacggt cgtaaacgga 3660 tgctggctag tgccggagaa ttacaaaaag gaaatgagct ggctctgcca agcaaatatg 3720 tgaattttt atatttagct agtcattatg aaaagttgaa gggtagtcca gaagataacg 3780 aacaaaaaca attgtttgtg gagcagcata agcattattt agatgagatt attgagcaaa 3840 tcagtgaatt ttctaagcgt gttattttag cagatgccaa tttagataaa gttcttagtg 3900 catataacaa acatagagac aaaccaatac gtgaacaagc agaaaatatt attcatttat 3960 ttacgttgac gaatcttgga gctcccgctg cttttaaata ttttgataca acaattgatc 4020 gtaaacgata tacgtctaca aaagaagttt tagatgccac tcttatccat caatccatca 4080 ctggtcttta tgaaacacgc attgatttga gtcagctagg aggtgactga agcttggctg 4140 ttttggcgga tgagagaaga ttttcagcct gatacagatt aaatcagaac gcagaagcgg 4200 tctgataaaa cagaatttgc ctggcggcag tagcgcggtg gtcccacctg accccatgcc 4260 gaactcagaa gtgaaacgcc gtagcgccga tggtagtgtg gggtctgccc atgcgagagt 4320 agggaactgc caggcatcaa ataaaacgaa aggctcagtc gaaagactgg gcctttcgtt 4380 ttatctgttg tttgtcggtg aacgctctcc tgagtaggac aaatccgccg ggagcggatt 4440 tgaacgttgc gaagcaacgg cccggagggt ggcgggcagg acgcccgcca taaactgcca 4500 ggcatcaaat taagcagaag gccatcctga cggatggcct ttttgcgttt ctacaaactc 4560 ttttgtttat ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga 4620 taaatgcttc aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc 4680 cttatccct tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg 4740 aaagtaaaag atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc 4800 aacagcggta agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact 4860 tttgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca 4920 gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac 4980 atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt 5040 ttccataggc tccgcccccc tgacgagcat cacaaaaaatc gacgctcaag tcagaggtgg 5100 cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc 5160 tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc 5220 gtggcgcttt ctcaatgctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc 5280 aagctgggct gtgtgcacga accccgtt cagcccgacc gctgcgcctt atccggtaac 5340 tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt 5400 aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct 5460 aactacggct acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc 5520 ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt 5580 ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg 5640 atcttttcta cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc 5700 atgagattat caaaaaggat cttcacctag atccttttgg ggtgggcgaa gaactccagc 5760 atgagatccc cgcgctggag gatcatccag ccattcgggg tcgttcactg gttcccctt 5820 ctgatttctg gcatagaaga acccccgtga actgtgtggt tccgggggtt gctgattttt 5880 gcgagacttc tcgcgcaatt ccctagctta ggtgaaaaca ccatgaaaca ctagggaaac 5940 acccatgaaa cacccattag ggcagtaggg cggcttcttc gtctagggct tgcatttggg 6000 cggtgatctg gtctttagcg tgtgaaagtg tgtcgtaggt ggcgtgctca atgcactcga 6060 acgtcacgtc atttaccggg tcacggtggg caaagagaac tagtgggtta gacattgttt 6120 tcctcgttgt cggtggtggt gagcttttct agccgctcgg taaacgcggc gatcatgaac 6180 tcttggaggt tttcaccgtt ctgcatgcct gcgcgcttca tgtcctcacg tagtgccaaa 6240 ggaacgcgtg cggtgaccac gacgggctta gcctttgcct gcgcttctag tgcttcgatg 6300 gtggcttgtg cctgcgcttg ctgcgcctgt agtgcctgtt gagcttcttg tagttgctgt 6360 tctagctgtg ccttggttgc catgctttaa gactctagta gctttcctgc gatatgtcat 6420 gcgcatgcgt agcaaacatt gtcctgcaac tcattcatta tgtgcagtgc tcctgttact 6480 agtcgtacat actcatattt acctagtctg catgcagtgc atgcacatgc agtcatgtcg 6540 tgctaatgtg taaaacatgt acatgcagat tgctgggggt gcagggggcg gagccaccct 6600 gtccatgcgg ggtgtggggc ttgccccgcc ggtacagaca gtgagcaccg gggcacctag 6660 tcgcggatac cccccctagg tatcggacac gtaaccctcc catgtcgatg caaatcttta 6720 acattgagta cgggtaagct ggcacgcata gccaagctag gcggccacca aacaccacta 6780 aaaattaata gtccctagac aagacaaacc cccgtgcgag ctaccaactc atatgcacgg 6840 gggccacata acccgaaggg gtttcaattg aaaccatag cactagctaa gacaacgggc 6900 aaacacccg caaactcg cactgcgcaa ccccgcacaa catcgggtct aggtaacact 6960 gagtaacact gaatagaag tgaacacctc taggaaccg caggtcaatg agggttctaa 7020 ggtcactcgc gctagggcgt ggcgtaggca aaacgtcatg tacaagatca ccaatagtaa 7080 ggctctggcg gggtgccata ggtggcgcag ggacgaagct gttgcggtgt cctggtcgtc 7140 taacggtgct tcgcagtttg agggtctgca aaactctcac tctcgctggg ggtcatctct 7200 ggctgaattg gaagtcatgg gcgaacgccg cattgagctg gctattgcta ctaagaatca 7260 cttggcggcg ggtggcgcgc tcatgatgtt tgtgggcact gttcgacaca accgctcaca 7320 gtcatttgcg caggttgaag cgggtattaa gactgcgtac tcttcgatgg tgaaaacatc 7380 7440 cacagactct tgggcgaacg gttggcactt gcaccgcaac atgctgttgt tcttggatcg 7500 tccactgtct gacgatgaac tcaaggcgtt tgaggattcc atgttttccc gctggtctgc 7560 tggtgtggtt aaggccggta tggacgcgcc actgcgtgag cacggggtca aacttgatca 7620 ggtgtctacc tggggtggag acgctgcgaa aatggcaacc tacctcgcta agggcatgtc 7680 tcaggaactg actggctccg ctactaaaac cgcgtctaag gggtcgtaca cgccgtttca 7740 gatgttggat atgttggccg atcaaagcga cgccggcgag gatatggacg ctgttttggt 7800 ggctcggtgg cgtgagtatg aggttggttc taaaaacctg cgttcgtcct ggtcacgtgg 7860 ggctaagcgt gctttgggca ttgattacat agacgctgat gtacgtcgtg aaatggaaga 7920 agaactgtac aagctcgccg gtctggaagc accggaacgg gtcgaatcaa cccgcgttgc 7980 tgttgctttg gtgaagcccg atgattggaa actgattcag tctgatttcg cggttaggca 8040 gtacgttctc gattgcgtgg ataaggctaa ggacgtggcc gctgcgcaac gtgtcgctaa 8100 tgaggtgctg gcaagtctgg gtgtggattc caccccgtgc atgatcgtta tggatgatgt 8160 ggacttggac gcggttctgc ctactcatgg ggacgctact aagcgtgatc tgaatgcggc 8220 ggtgttcgcg ggtaatgagc agactattct tcgcacccac taaaagcggc ataaaccccg 8280 ttcgatattt tgtgcgatga atttatggtc aatgtcgcgg gggcaaacta tgatgggtct 8340 tgttgttggc gtcccggaaa acgattccga agcccaacct ttcatagaag gcggcggtgg 8400 aatttttctc cacataagct ggcaatgttg cgacgcaaca ggtacagtgt aattcatgag 8460 accacgcgtg gatccggctt actaaaagcc agataacagt atgcgtattt gcgcgctgat 8520 ttttgcggta taagaatata tactgatatg tatacccgaa gtatgtcaaa aagaggtatg 8580 ctatgaagca gcgtattaca gtgacagttg acagcgacag ctatcagttg ctcaaggcat 8640 8700 gcgtgccgaa cgctgggaaag cggaaaatca ggaagggatg gctgaggtcg cccggtttat 8760 tgaaatgaac ggctcttttg ctgagagaa caggggctgg tgaaatgcag tttaaggttt 8820 acacctataa aagagagagc cgttatcgtc tgtttgtgga tgtacagagt gatattattg 8880 acacgcccgg gcgacggatg gtgatccccc tggccagtgc acgtctgctg tcagataaag 8940 tctcccgtga actttacccg gtggtgcata tcggggatga aagctggcgc atgatgacca 9000 ccgatatggc cagtgtgccg gtatccgtta tcggggaaga agtggctgat ctcagccacc 9060 gcgaaaatga catcaaaaac gccattaacc tgatgttctg gggaatataa ggtctcagtt 9120 ttagagctag aaatagcaag ttaaaataag gctagtccgt tatcaacttg aaaaagtggc 9180 accgagtcgg tgcttttttt ccaggcatca aataaaacga aaggctcagt cgaaagactg 9240 ggcctttcgt tttatctgtt gtttgtcggt gaacgctctc ctgagtagga caaatccgcc 9300 gggagcggat ttgaacgttg cgaagcaacg gcccggaggg tggcgggcag gacgcccgcc 9360 ataaactgcc aggcatcaaa ttaagcagaa ggccatcctg acggatggcc tttttgcgtt 9420 tctacaaact ctttttgttt atttttctaa atacattcaa atatgtatcc gctcatgaat 9480 taattccgct agatgacgtg cggcttcgaa aatctcgtga tggcaggttg ggcgtcgctt 9540 ggtcggtcat ttcgaagggc accaataact gccttaaaaa aattacgccc cgccctgcca 9600 ctcatcgcag tactgttgta attcattaag cattctgccg acatggaagc catcacagac 9660 ggcatgatga acctgaatcg ccagcggcat cagcaccttg tcgccttgcg tataatattt 9720 gcccatggtg aaaacgggg cgaagaagtt gtccatattg gccacgttta aatcaaaact 9780 ggtgaaactc acccagggat tggctgagac gaaaaacata ttctcaataa accctttagg 9840 gaaatagcc aggttttcac cgtaacacgc cacatcttgc gaatatatgt gtagaaactg 9900 ccggaaatcg tcgtggtatt cactccagag cgatgaaaac gtttcagttt gctcatggaa 9960 aacggtgtaa caagggtgaa cactatccca tatcaccagc tcaccgtctt tcattgccat 10020 acggaactcc ggatgagcat tcatcaggcg ggcaagaatg tgaataaagg ccggataaaa 10080 cttgtgctta ttttcttta cggtctttaa aaaggccgta atatccagct gaacggtctg 10140 gttataggta cattgagcaa ctgactgaaa tgcctcaaaa tgttctttac gatgccattg 10200 ggatatatca acggtggtat atccagtgat ttttttctcc attttagctt ccttagctcc 10260 tgaaaatctc gtcgaagctc ggcggatttg tcctactcaa gctgatccga caaaatccac 10320 acattatccc aggtgtccgg atcggtcaaa tacgctgcca gctcatagac cgtatccaaa 10380 gcatccgggg ctgatccccg gcgccagggt ggtttttctt ttcaccagtg agacgggcaa 10440 cagctgattg cccttcaccg cctggccctg agagagttgc agcaagcggt ccacgtggtt 10500 tgccccagca ggcgaaaatc ctgtttgatg gtggttaacg gcgggatata acatgagctg 10560 tcttcggtat cgtcgtatcc cactaccgag atatccgcac caacgcgcag cccggactcg 10620 gtaatggcgc gcattgcgcc cagcgccatc tgatcgttgg caaccagcat cgcagtggga 10680 acgatgccct cattcagcat ttgcatggtt tgttgaaaac cggacatggc actccagtcg 10740 ccttcccgtt ccgctatcgg ctgaatttga ttgcgagtga gatatttatg ccagccagcc 10800 agacgcagac gcgccgagac agaacttaat gggcccgcta acagcgcgat ttgctggtga 10860 cccaatgcga ccagatgctc cacgcccagt cgcgtaccgt cttcatggga gaaaataata 10920 ctgttgatgg gtgtctggtc agagacatca agaaataacg ccggaacatt agtgcaggca 10980 gcttccacag caatggcatc ctggtcatcc agcggatagt taatgatcag cccactgacg 11040 cgttgcgcga gaagattgtg caccgccgct ttacaggctt cgacgccgct tcgttctacc 11100 atcgacacca ccacgctggc acccagttga tcggcgcgag atttaatcgc cgcgacaatt 11160 tgcgacggcg cgtgcagggc cagactggag gtggcaacgc caatcagcaa cgactgtttg 11220 cccgccagtt gttgtgccac gcggttggga atgtaattca gctccgccat cgccgcttcc 11280 actttttccc gcgttttcgc agaaacgtgg ctggcctggt tcaccacgcg ggaaacggtc 11340 tgataagaga caccggcata ctctgcgaca tcgtataacg ttactggttt cacattcacc 11400 accctgaatt gactctcttc cgggcgctat catgccatac cgcgaaaggt tttgcaccat 11460 tcgatggtgt caacgtaaat gccgcttcgc cttcgcgcgc gaattgcaag ctgatccggg 11520 cttatcgact gcacggtgca ccaatgcttc tggcgtcagg cagccatcgg aagctgtggt 11580 atggctgtgc aggtcgtaaa tcactgcata attcgtgtcg ctcaaggcgc actcccgttc 11640 tggataatgt tttttgcgcc gacatcataa cggttctggc aaatattctg aaatgagctg 11700 ttgacaatta atcatcggct cgtataatgt gtggaattgt gagcgctcac aatttcacac 11760 aggaaacaga att 11773 <210> 5 <211> 807 <212> DNA <213> Artificial Sequence <400> 5 atgttgtcgt acgagagtat cgacctgtat cgcgaggacg ggttcctgtt cgcggacccc 60 cttaccgaaa aggagacaga ccttctacgc gaacaggccg atcgtgagtt tctgcgggat 120 tctcccggcc ggatgttgga gaaggacggt ttcacggtgc gcggggtgca cgggtcgcac 180 gtggtgaaca gcacgttcgc ccggctggta cggcacccaa agatcgtcac accggccacg 240 cagctactgg gtggccccgt atatgtgcac cagttcaaga tcaatgcaaa gaaggcgctg 300 accggcgatg tgtggccctg gcaccaggac tacatcttct ggaaccgggg tgacggaatg 360 cgtcgccccg acgtggtgaa cgtcgccgtc ctgctggatg aggcgaccga tctgaacggt 420 ccactgctcg tcctgcccgg ctcacacaag tgcggctctc tggaagtggc gaggcggacg 480 accgtctgtg gcgacggggc gtggcggtcc gacatctccg cagatctgga ctacgccatc 540 gacgcgccgc tgctgtccaa gctcaccgag actacaaaag tgaccgccat caaagggccg 600 gacgcgccgc tgctgtccaa gctcaccgag actacaaaag tgaccgccat caaagggccg 600 cccggctcga tcctcctctt cgatcccctg ctcgtacacg cctcgggcgt gaacatggct 660 cccggctcga tcctcctctt cgatcccctg ctcgtacacg cctcgggcgt gaacatggct 660 ccctacgatc ggcgcatgat cctcgtcacc tacaaccggg tggacaatcc actcggagag 720 ccctacgatc ggcgcatgat cctcgtcacc tacaaccggg tggacaatcc actcggagag 720 gtgcccagcc ctcgaccgga cttcctcgcc gcccgggaca acacgccggt caggccgctc 780 gtgcccagcc ctcgaccgga cttcctcgcc gcccgggaca acacgccggt caggccgctc 780 gaccccggcg cggaccttct cgcctaa 807 gaccccggcg cggaccttct cgcctaa 807 <210> 6<210> 6 <211> 24<211> 24 <212> DNA<212> DNA <213> 人工序列(Artificial Sequence)<213> Artificial Sequence <400> 6<400> 6 ttcacactgc tcgaacttgt acct 24 ttcacactgc tcgaacttgt acct 24 <210> 7<210> 7 <211> 24<211> 24 <212> DNA<212> DNA <213> 人工序列(Artificial Sequence)<213> Artificial Sequence <400> 7 <400> 7 aaacaggtac aagttcgagc agtg 24 aaacaggtac aagttcgagc agtg 24 <210> 8 <210> 8 <211> 78 <211> 78 <212> DNA <212> DNA <213> 人工序列(Artificial Sequence) <213> Artificial Sequence <400> 8 <400> 8 gcgctcacaa tttcacacag gaaacagaat taattaagct taaaggcacc cgatatggat 60 gcgctcacaa tttcacacag gaaacagaat taattaagct taaaggcacc cgatatggat 60 aagaaatact caataggc 78 aagaaatact caataggc 78 <210> 9 <210> 9 <211> 27 <211> 27 <212> DNA <213> Artificial Sequence <400> 9 tcagtcacct cctagctgac tcaaatc 27 <210> 10 <211> 42 <212> DNA <213> Artificial Sequence <400> 10 gtcagctagg aggtgactga agcttggctg ttttggcgga tg 42 <210> 11 <211> 30 <212> DNA <213> Artificial Sequence <400> 11 ctgtgtgaaa ttgtgagcgc tcacaattcc 30 <210> 12 <211> twenty one <212> DNA <213> Artificial Sequence <400> 12 tcgaagggca ccaataactg c 21 <210> 13 <211> twenty four <212> DNA <213> Artificial Sequence <400> 13 cttttacttt caccagcgtt tctg 24 <210> 14 <211> twenty four <212> DNA <213> Artificial Sequence <400> 14 aacgctggtg aaagtaaaag atgc 24 <210> 15 <211> 45 <212> DNA <213> Artificial Sequence <400> 15 gaatggaacg gatcaaacgg tgaattacac tgtacctgtt gcgtc 45 <210> 16 <211> 43 <212> DNA <213> Artificial Sequence <400> 16 ccgtttgatc cgttccattc gttttagagc tagaaatagc aag 43 <210> 17 <211> twenty three <212> DNA <213> Artificial Sequence <400> 17 caacctgcca tcacgagatt ttc 23 <210> 18 <211> 40 <212> DNA <213> Artificial Sequence <400> 18 aatctcgtga tggcaggttg acggggagcct aagtgaaatg 40 <210> 19 <211> 41 <212> DNA <213> Artificial Sequence <400> 19 ccttggtaaa tgcacggtat gggtcagtga gatcaatcgg g 41 <210> 20 <211> twenty two <212> DNA <213> Artificial Sequence <400> 20 ccataccgtg catttaccaa gg 22 <210> twenty one <211> 40 <212> DNA <213> Artificial Sequence <400> twenty one cagttatattgg tgcccttcga ctttgtggtc ttctttgcgg 40 <210> twenty two <211> 39 <212> DNA <213> Artificial Sequence <400> twenty two acaggccaaa ggagttgaga atgttgagtt ttgcgaccc 39 <210> twenty three <211> 40 <212> DNA <213> Artificial Sequence <400> twenty three ccaagcttgc atgcctgcag ttacctttta ttaccgaatc 40

Claims

1. Use of a polypeptide in the production of L-proline by Corynebacterium glutamicum, characterized in that: The polypeptide is an L-proline efflux protein, and its amino acid sequence is shown in SEQ ID NO:1 or SEQ ID NO:

2. The polypeptide with the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2 is overexpressed in the glutamicum, and glutamate kinase is not subject to L-proline feedback inhibition or L-proline feedback inhibition is weakened.

2. Use of a polypeptide in the production of hydroxyproline by Corynebacterium glutamicum, characterized in that: The polypeptide is an L-proline efflux protein, and its amino acid sequence is shown in SEQ ID NO:1 or SEQ ID NO:

2. The polypeptide with the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2 is knocked out in the glutamicum, and the glutamate kinase is not subject to L-proline feedback inhibition or L-proline feedback inhibition is weakened.

3. An L-proline producing strain, characterized in that: The strain overexpresses a polypeptide having an amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2, the production strain is Corynebacterium glutamicum, and the glutamate kinase in the production bacteria is not subject to L-proline feedback inhibition or the L-proline feedback inhibition is weakened, and the amino acid sequence of the glutamate kinase in the production bacteria undergoes a G149D mutation.

4. The L-proline producing strain according to claim 3, characterized in that The activity of glutamate kinase and / or glutamate semialdehyde dehydrogenase and / or pyrroline-5-carboxylic acid reductase in the production bacteria is enhanced.

5. A method for producing L-proline, characterized in that: The method comprises: culturing the production strain according to claim 3 or 4 to produce L-proline.

6. The method according to claim 5, characterized in that The method further comprises the step of separating L-proline from the fermentation broth.

7. A hydroxyproline producing strain, characterized in that: The L-proline efflux protein with an amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2 is knocked out in the production strain, the production strain is Corynebacterium glutamicum, and proline hydroxylase is overexpressed, and glutamate kinase is not subject to L-proline feedback inhibition or L-proline feedback inhibition is weakened.

8. The hydroxyproline producing strain according to claim 7, characterized in that The amino acid sequence of the glutamate kinase (Glutamate-5-kinase) in the production bacteria has a G149D mutation.

9. The production strain according to claim 8, characterized in that The activities of glutamate kinase, and / or glutamate semialdehyde dehydrogenase, and / or pyrroline-5-carboxylic acid reductase in the production strain are enhanced.

10. The production strain according to any one of claims 7 to 9, characterized in that The proline hydroxylase is trans-proline-4-hydroxylase, and its nucleotide sequence is shown in SEQ ID NO:

5.

11. A method for producing hydroxyproline, characterized in that: The method comprises: culturing the production strain according to any one of claims 7 to 10 to produce hydroxyproline.

12. The method according to claim 11, characterized in that The method further comprises the step of isolating hydroxyproline from the fermentation broth.

Images