Method for preparing nucleic acid oligomers

Abstract

The present invention provides an efficient method for preparing nucleic acid oligomers, that is, a method for efficiently preparing nucleic acids having phosphotriester bonds by oxidizing nucleic acid precursors having phosphotriester bonds. Specifically, the present invention provides a method for preparing a nucleic acid compound having a nucleotide represented by formula (I) at its 5' end by a phosphoramidite method, the method comprising the step of reacting a precursor having a phosphotriester bond represented by formula (II) (the definitions of the substituents of formula (I) and formula (II) are as described in the specification) with an oxidizing solution containing iodine, pyridine and water that has been subjected to a heat treatment.

Description

Technical Field

[0001] This application claims priority to and the benefits of Japanese Patent Application No. 2020-012789, filed on January 29, 2020, the entire contents of which are incorporated herein by reference.

[0002] The present invention relates to a method for preparing nucleic acid oligomers. Background Art

[0003] DNA and RNA as nucleic acid oligomers can be used as DNA probes, RNA probes, antisense, ribozymes, siRNAs, aptamers, and the like, and are useful materials.

[0004] Nucleic acid oligomers can be synthesized by solid phase synthesis, in which phosphoramidites of nucleotides (hereinafter referred to as "amidites") are used as raw materials. The nucleic acid oligomer synthesized by extending the nucleic acid on a solid support through a coupling step, an oxidation step, and a deprotection step is cut from the solid support, and then the protecting group is removed to prepare the desired nucleic acid oligomer. However, the purity of the nucleic acid oligomer synthesized according to this method is not necessarily satisfactory, and the synthesis method is not efficient (see Non-Patent Document 1).

[0005] Prior art literature

[0006] Non-patent literature

[0007] Non-patent document 1: Tetrahedron 69 (2013) 3615-3637 Summary of the invention

[0008] Problems to be solved by the invention

[0009] An object of the present invention is to provide an efficient method for preparing nucleic acid oligomers.

[0010] Means for solving problems

[0011] The inventors of the present application have conducted in-depth research to achieve the above-mentioned purpose, and found that in the synthesis of nucleic acid oligomers, a heat-treated oxidizing solution containing iodine, water and pyridine is used as an oxidizing solution in the oxidation of phosphite, so that nucleic acid oligomers can be efficiently prepared, wherein the phosphite is prepared by a coupling reaction using phosphoramidite. The present invention can provide an efficient method for preparing nucleic acid oligomers.

[0012] The present invention includes the following aspects, but is not limited thereto.

[0013] [1] A method for preparing a nucleic acid compound having a nucleotide represented by formula (I) at its 5′ end by a phosphoramidite method,

[0014] [Chemical formula 1]

[0015]

[0016] (in,

[0017] G 1 and G 2 Each independently represents a protecting group for a hydroxyl group, B a represents a nucleic acid base which may be optionally protected by a protecting group,

[0018] R represents a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group or an OQ' group,

[0019] Q' represents a methylene group of the carbon atom attached to the 4' position of ribose, an ethylene group of the carbon atom attached to the 4' position of ribose, or an ethylidene group of the carbon atom attached to the 4' position of ribose, and

[0020] The bond marked with the symbol * indicates the bond pointing to the 3' terminal side of the nucleic acid),

[0021] The method comprises:

[0022] a step of reacting a precursor having a phosphite triester bond represented by formula (II) with an oxidizing solution containing iodine, pyridine and water which has been heat-treated at 40° C. or higher (hereinafter referred to as “the oxidizing solution of the present invention”);

[0023] [Chemical formula 2]

[0024]

[0025] (in,

[0026] G 1 , G 2 , B a , R and * are the same as defined above).

[0027] [2] The method according to [1], wherein the precursor having a phosphite triester bond is a nucleic acid compound represented by formula (4),

[0028] [Chemical formula 3]

[0029]

[0030] (in,

[0031] G 1 represents a protecting group for a hydroxyl group,

[0032] G 2 are the same or different, each independently representing a protecting group for a hydroxyl group,

[0033] B a Each independently represents the same or different nucleic acid bases which may be protected by protecting groups,

[0034] R are the same or different and each independently represents a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group or an OQ' group,

[0035] Q' are the same or different and each independently represents a methylene group connected to the carbon atom at the 4' position of ribose, an ethylene group connected to the carbon atom at the 4' position of ribose, or an ethylidene group connected to the carbon atom at the 4' position of ribose,

[0036] Y are the same or different and each independently represents an oxygen atom or a sulfur atom,

[0037] n is any integer from 1 to 200,

[0038] When X represents OZ, W represents an OV group, and V represents a protective group for a hydroxyl group.

[0039] When X represents an R group, W represents a group represented by OZ,

[0040] Z represents a group having a structure including a solid phase support and a linking group, and

[0041] When n is an integer greater than 2, the nucleic acid compound represented by formula (4) may be incorporated via a non-nucleotide linker to replace at least one nucleotide between the nucleotide at the 5' end and the nucleotide at the 3' end of the nucleic acid compound).

[0042] The compound containing a phosphotriester bond is a compound represented by formula (5),

[0043] [Chemical formula 4]

[0044]

[0045] [in,

[0046] G 1 , G 2 , B a , R, n, W, X and Y are the same as defined above, and

[0047] As defined in formula (4), non-nucleotide linkers may be incorporated in place of nucleotides)

[0048] [3] The method for preparing a nucleic acid oligomer according to [2], comprising:

[0049] The step of extending the chain length of the nucleic acid compound represented by formula (5) to any chain length by an amide method to obtain the nucleic acid represented by formula (5'),

[0050] [Chemical formula 5]

[0051]

[0052] (in,

[0053] G 2 , B a , R, X and W are the same as those in formula (5),

[0054] G 5 represents a protecting group for a hydroxyl group, or a hydrogen atom,

[0055] m is an integer satisfying m≥n,

[0056] Y are the same or different and each independently represents an oxygen atom or a sulfur atom, but at least one Y is an oxygen atom);

[0057] a step of excising a compound represented by formula (6) from a compound represented by formula (5'),

[0058] [Chemical formula 6]

[0059]

[0060] (in,

[0061] G 5 , R and m are the same as above.

[0062] B c The same or different, each independently represents a nucleic acid base,

[0063] G 4 represents a hydrogen atom, an alkali metal ion, an ammonium ion, an alkylammonium ion or a hydroxyalkylammonium ion,

[0064] Y independently represents an oxygen atom or a sulfur atom, and at least one of them is an oxygen atom, and

[0065] X1 represents a hydroxyl group, W1 represents an OV group, wherein V represents a protective group for the hydroxyl group, or

[0066] X1 represents an R group and W1 represents a hydroxyl group);

[0067] and, a step of deprotecting the compound represented by formula (6) to prepare a deprotected nucleic acid oligomer represented by formula (7),

[0068] [Chemical formula 7]

[0069]

[0070] (in,

[0071] m, Y, G4 and B c Same as the above definition,

[0072] R' is the same or different and each independently represents a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group or an OQ' group,

[0073] Q' are the same or different and each independently represents a methylene group connected to the carbon atom at the 4' position of ribose, an ethylene group connected to the carbon atom at the 4' position of ribose, or an ethylidene group connected to the carbon atom at the 4' position of ribose,

[0074] X 10 and W 10 Each independently represents a hydroxyl group, or

[0075] X 10 Represents R' group, W 10 represents hydroxyl group).

[0076] [4] The method according to [2] or [3] above, wherein the non-nucleotide linker is a linker formed by an amino acid backbone.

[0077] [5] The method according to [4], wherein the linker comprising an amino acid backbone is a linker having a structure selected from the following formulae (A14-1), (A14-2) and (A14-3),

[0078] [Chemical formula 8]

[0079]

[0080] [6] The method according to any one of [1] to [5], wherein the concentration of iodine in the oxidizing solution is 0.005 to 2 M.

[0081] [7] The method according to any one of [1] to [5], wherein the concentration of iodine in the oxidizing solution is 0.005 to 0.2 M.

[0082] [8] The method according to any one of [1] to [5], wherein the concentration of iodine in the oxidizing solution is 0.007 to 0.1 M.

[0083] [9] The method according to any one of [1] to [5], wherein the concentration of iodine in the oxidizing solution is 0.008 to 0.07 M.

[0084]

[10] The method according to any one of [1] to [9], wherein the oxidizing solution is prepared by mixing iodine, pyridine, and water.

[0085]

[11] The method according to

[10] , wherein the oxidizing solution is an oxidizing solution containing at least one solvent selected from the group consisting of acetonitrile and tetrahydrofuran.

[0086]

[12] The method according to

[10] or

[11] , wherein the oxidizing solution is an oxidizing solution further containing an acetonitrile solvent.

[0087]

[13] The method according to

[11] , wherein the solvent of the oxidation solution is a mixture of solvents obtained by mixing pyridine, water, acetonitrile and tetrahydrofuran in a volume ratio of 1 to 90:1 to 50:0 to 90:0 to 90.

[0088]

[14] The method according to

[11] or

[12] , wherein the solvent of the oxidation solution is a mixture of solvents obtained by mixing pyridine, water, and acetonitrile in a volume ratio of 1 to 90:1 to 50:0 to 90.

[0089]

[15] The method according to any one of [1] to

[14] , wherein the prepared oxidation solution is aged in the range of 40° C. to 60° C. during storage until it is used in the oxidation reaction for nucleic acid synthesis.

[0090]

[16] The method according to any one of [1] to

[15] , wherein the nucleic acid compound is a nucleic acid compound containing ribonucleoside (RNA).

[0091]

[17] The method according to any one of [2] to

[16] , wherein the nucleic acid is a ribonucleoside (RNA), and the 2' protecting group thereof is a protecting group represented by formula (12),

[0092] [Chemical formula 9]

[0093]

[0094] (in,

[0095] Q is an integer from 1 to 5,

[0096] R a and R b are the same or different and each independently represents a methyl group, an ethyl group or a hydrogen atom, the bond marked with the symbol * represents an oxygen atom of an OQ group, and

[0097] E w The group represents an electron-withdrawing group).

[0098]

[18] The method according to

[17] , wherein R a and R b At the same time, E w It represents cyano.

[0099]

[19] The method according to any one of [1] to

[18] , wherein the nucleic acid is a ribonucleoside (RNA) having a chain length of 40 or more nucleotides.

[0100]

[20] The method according to any one of [1] to

[19] , further comprising the step of preparing the oxidizing solution described in [1].

[0101] Effects of the Invention

[0102] The present invention provides an efficient method for preparing a nucleic acid oligomer. According to the method of the present invention, it is expected that the purity of the prepared nucleic acid oligomer will be improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0103] Figure 1 It is a diagram showing the route of steps (1) to (6) in the method of the present invention. DETAILED DESCRIPTION

[0104] Example

[0105] The following method is described: a method for preparing a nucleic acid compound having a nucleotide represented by the above formula (I) at its 5' end, the method being a method for preparing a nucleic acid oligomer having high quality by the phosphoramidite method,

[0106] The method comprises the step of reacting a precursor having a phosphite triester represented by the above formula (II) at the 5' end of the precursor with a heat-treated oxidizing solution containing iodine, pyridine and water (referred to as "oxidizing solution of the present invention").

[0107] The following method is described: a method for preparing a nucleic acid compound, which comprises the following steps: reacting a nucleic acid precursor having a phosphite triester bond with an oxidizing solution containing iodine, pyridine and water, thereby converting the phosphite triester bond into a phosphotriester bond, wherein the oxidizing solution is a heat-treated oxidizing solution.

[0108] Iodine can be used as an oxidizing agent, and the iodine concentration (hereinafter referred to as "conc.") in the oxidizing solution containing iodine, pyridine and water is adjusted to a range of generally 0.005 to 2M, preferably 0.005 to 0.2M, more preferably 0.007 to 0.1M, and further preferably 0.008 to 0.07M.

[0109] In addition to iodine, the oxidizing solution contains water and pyridine. Examples of usable solvents include acetonitrile, tetrahydrofuran (THF) or mixtures of these solvents in any ratio. Preferred examples include mixtures of pyridine and water, or mixtures of pyridine, water and acetonitrile.

[0110] The solution that can be used has a typical composition, which contains 1 to 90 volume % of pyridine, 1 to 50 volume % of water, 0 to 90 volume % of acetonitrile, and 0 to 90 volume % of tetrahydrofuran, relative to the total volume of the solution. The solution can be prepared by mixing solvents in any proportions so that the total volume of the solution is 100 volume %. It preferably includes a solvent in which 5 to 90 volume % of pyridine, 2 to 30 volume % of water, 0 to 80 volume % of acetonitrile, and 0 to 80 volume % of tetrahydrofuran are mixed in any proportions so that the total volume of the solution is 100 volume %. It more preferably includes a solvent in which 90 volume % of pyridine and 10 volume % of water are mixed, or a solvent in which 6 volume % of pyridine, 30 volume % of water, and 64 volume % of acetonitrile are mixed.

[0111] When preparing the oxidizing solution, although stirring of the reaction system is not essential, it is usually carried out at a stirring power Pv of 0.0 to 0.5 kW / m 3 The stirring is carried out in the range of 0.1 to 0.3 kW / m 3 .

[0112] The oxidizing solution having an iodine concentration higher than that in the oxidizing solution to be finally used may be subjected to heat treatment. In this case, after storage and aging but before use, the resulting oxidizing solution is diluted with a solvent to the final adjusted iodine concentration.

[0113] The oxidizing solution used in the oxidation step of the method of the present invention is stored and aged at a temperature range of 20° C. to 80° C., preferably, for example, 40° C. to 60° C., typically 60° C., before being used in the oxidation reaction in nucleic acid synthesis. The storage and aging period of the solution is also 1 hour or more, preferably, for example, in the range of 24 hours to 1 week, typically 24 hours.

[0114] In order to store the oxidizing solution in the container, a glass container, a plastic container or a metal container can be used. Examples of the plastic container include containers made of polyethylene, polypropylene, etc., and examples of the metal container include SUS containers or hastelloy containers.

[0115] The oxidizing solution may be stored under an air atmosphere or an inert gas atmosphere, and examples of the inert gas that can be used include argon, nitrogen, carbon dioxide, and helium.

[0116] Examples of compounds containing a phosphorous (phosphite) triester bond include the compound of the above formula (4). Examples of nucleic acid compounds obtained by reacting with an oxidizing solution include nucleic acid compounds of formula (5).

[0117] In formula (4) and formula (5), examples of compounds include the structure of the following formula (8), wherein Q' is the same or different and each independently represents a methylene group connected to the carbon atom at the 4' position of ribose, an ethylene group connected to the carbon atom at the 4' position of ribose, or an ethylidene group connected to the carbon atom at the 4' position of ribose.

[0118] [Chemical formula 10]

[0119]

[0120] (Among them, B a represents an optionally protected nucleic acid base. )

[0121] Examples of the group represented by Z include a group comprising a solid phase carrier and a linking portion that connects the solid phase carrier to the oxygen atom of the hydroxyl group at the 2' or 3' position of the ribose at the 3' end of the nucleic acid oligomer. More specifically, Z represents a structure represented by formula (9):

[0122] [Chemical formula 11]

[0123]

[0124] In formula (9), Sp represents a spacer.

[0125] Examples of the spacer (Sp) include a structure represented by the following formula (10).

[0126] [Chemical formula 12]

[0127]

[0128] The linker can, for example, have a structure as shown in the following formula (11), or a structure as shown in the following formula (11), wherein the structure as shown in the following formula (11) does not contain a hexamethyleneamine portion and thus the propylamine group is connected to Si, or the linker can have a structure as shown in the following formula (15).

[0129] [Chemical formula 13]

[0130]

[0131] (in,

[0132] A can be a hydroxyl group, an alkoxy group or an alkyl group. Examples of alkoxy groups include methoxy and ethoxy groups. Examples of alkyl groups include methyl, ethyl, isopropyl, and n-propyl groups. Si represents that it is bound to the oxygen atom of the hydroxyl group on the surface of the support.

[0133] Examples of solid phase supports include inorganic porous supports and organic resin supports. Examples of inorganic porous supports include controlled pore glass (CPG). Examples of organic resin supports include supports made of polystyrene.

[0134] Examples of nucleosides (ribose and deoxyribose) contained in the nucleic acid oligomer used in the present invention include DNA, RNA, 2'-O-MOE (2-O-methoxymethyl), 2'-O-Me, 2'-F RNA, and the above-mentioned LNA, but the above-mentioned nucleosides are not limited thereto.

[0135] The method for synthesizing a nucleic acid oligomer includes an oxidation step using the above-mentioned oxidation solution by a solid phase synthesis method, and typically includes the following steps.

[0136] (1) a step of deprotecting the hydroxyl group at the 5′ position of a nucleoside having a protected hydroxyl group which is bound to a solid support via a linker,

[0137] (2) a step of subjecting the 5'-hydroxyl group obtained in the above step to a coupling reaction with a phosphoramidite compound to obtain a phosphite triester compound,

[0138] (3) a step of preparing an extended nucleic acid by oxidizing the phosphite triester prepared in the above step into a phosphotriester bond, or an optional step of converting the phosphite triester into a thiophosphate triester,

[0139] (4) a step of preparing a nucleic acid on a solid support, which comprises repeating the reaction cycles of steps (1) to (3) for an optional number of times, i.e., a step of deprotecting the 5'-hydroxyl group of the obtained nucleic acid, a step of coupling the 5'-hydroxyl group with an amide compound, and a step of oxidizing the prepared triester phosphite, and

[0140] (5) excising the nucleic acid prepared on the solid phase support in the above step (4), and then subjecting the obtained nucleic acid to a deprotection reaction to free it from the solid phase support, thereby preparing a deprotected nucleic acid oligomer,

[0141] In the above-mentioned method for synthesizing nucleic acid oligomers, after step (2) or (3), a step of capping the 5'-hydroxyl group that has not undergone coupling reaction with a phosphoramidite compound may be included, or a capping step may be added between any steps of the reaction cycle of step (4).

[0142] More specifically, the above step (5) is performed as follows: the nucleic acid molecule on the solid phase carrier prepared in step (4) is subjected to the following reaction steps (5-1) and (5-2) in order, and then the obtained reaction product is subjected to reaction step (5-3). Here, reaction step (5-1) can be performed optionally, and reaction step (5-2) can be performed according to the method described in Japanese Patent No. 4705716. As a result, a nucleic acid oligomer detached from the solid phase carrier, in which the protecting group is removed from the nucleic acid molecule, or a nucleic acid oligomer in which the hydroxyl group is protected can be prepared.

[0143] (5-1) a reaction for deprotecting the protective group of the hydroxyl group at the 5' end of the nucleic acid molecule,

[0144] (5-2) a reaction in which the nucleic acid molecule is released by cutting it out from the solid phase carrier, and

[0145] (5-3) A reaction for deprotecting the protecting group of the hydroxyl group at the 2' position of the ribose of a nucleic acid molecule or the hydroxyl group at the 3' position of the ribose at the 3' end.

[0146] The route of the above steps (1) to (6) is shown in Figure 1 , Figure 1 The oxidation reaction of step (3) or step (4) is carried out by using the above-mentioned oxidation solution. The definitions of the substituents contained in the chemical formula in Scheme A are the same as those defined above.

[0147] According to the amide method, by using a nucleotide type or non-nucleotide type linker, the nucleic acid compound of formula (5) can be further extended to any chain length, and then can be used to prepare the nucleic acid compound shown in the above formula (5'). In addition, only a nucleic acid oligomer can be cut out from the nucleic acid compound bound to the solid phase carrier of the above formula (5') to obtain a nucleic acid oligomer shown in the above formula (6), and then the obtained nucleic acid oligomer is further deprotected to obtain a nucleic acid oligomer shown in the above formula (7).

[0148] Hereinafter, the substituents in each formula are described in more detail.

[0149] Optionally, B a The nucleic acid base protected by the protecting group represented by is not particularly limited. The example of nucleic acid base includes adenine, cytosine, guanine, uracil, thymine, 5-methylcytosine, pseudouracil, 1-methylpseudouracil, etc. In addition, the nucleic acid base can also be optionally substituted by a substituent. The example of the substituent includes a halogen atom (such as a fluoro group, a chloro group, a bromo group and an iodo group), an acyl group (such as an acetyl group), an alkyl group (such as a methyl group and an ethyl group), an aralkyl group (such as a benzyl group, an alkoxy group (such as a methoxyethyl group), a cyanoalkyl group (such as a cyanoethyl group), a hydroxyl group, an acyloxymethyl group, an amino group, a monoalkylamino group, a dialkylamino group, a carboxyl group, a cyano group and a nitro group, and a combination of two or more of these substituents.

[0150] In the case where the nucleic acid base contains an exocyclic amino group, there is no particular limitation on the protecting group for the amino group, and protecting groups used in the field of nucleic acid chemistry known to the public can be used. Examples of protecting groups include benzoyl, 4-methoxybenzoyl, acetyl, propionyl, butyryl, isobutyryl, phenylacetyl, phenoxyacetyl, 4-tert-butylphenoxyacetyl, 4-isopropylphenoxyacetyl and (dimethylamino)methylene, as well as combinations of two or more of these protecting groups.

[0151] More specifically, B a represents any of the groups shown below.

[0152] [Chemical formula 14]

[0153]

[0154] {in,

[0155] R 4 represents a hydrogen atom, a methyl group, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group or a benzoyl group,

[0156] R 5 represents a hydrogen atom, an acetyl group, an isobutyryl group or a benzoyl group,

[0157] R 6 represents a hydrogen atom, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group or an isobutyryl group,

[0158] R 7 represents 2-cyanoethyl,

[0159] R 8 represents a hydrogen atom, a methyl group, a benzoyl group, a 4-methoxybenzoyl group or a 4-methylbenzoyl group, and

[0160] R 9 represents dimethylaminomethylene).

[0161] G 1 Any group that can function as a protecting group may be used without any particular limitation, and any group that is publicly known for use in amide compounds may be widely used.

[0162] G 1 Preferably represents the following groups.

[0163] [Chemical formula 15]

[0164]

[0165] (Among them, R 1 , R 2 , R 3 are the same or different, each independently representing a hydrogen atom or an alkoxy group)

[0166] R 1 , R 2 , R 3 One of them represents a hydrogen atom, and the other two are the same or different (preferably the same) alkoxy groups. As the alkoxy group, a methoxy group is particularly preferred.

[0167] G2 can be used without any particular limitation as long as it can function as a protecting group, and a wide range of publicly known protecting groups for amide compounds can be used. 2 Examples include alkyl, alkenyl, alkynyl, cycloalkyl, haloalkyl, aryl, heteroaryl, aralkyl, cycloalkenylalkyl, cycloalkylalkyl, cycloalkyl, hydroxyalkyl, aminoalkyl, alkoxyalkyl, heterocyclylalkenyl, heterocyclylalkyl, heteroaralkyl, silyl, siloxyalkyl, monoalkylsilyl, dialkylsilyl or trialkylsilyl, monoalkylsiloxyalkyl, dialkylsiloxyalkyl or trialkylsiloxyalkyl, and the like, which may be optionally substituted with one or more electron withdrawing groups.

[0168] G2 preferably represents an alkyl group substituted with an electron withdrawing group. Examples of the electron withdrawing group include a cyano group, a nitro group, an alkylsulfonyl group, a halogen atom, an arylsulfonyl group, a trihalomethyl group, a trialkylamino group, etc., preferably a cyano group.

[0169] G 2 Particularly preferred examples include the following groups.

[0170] [Chemical formula 16]

[0171]

[0172] For G 3 For example, the two G 3 Preferably, two G 3 All are isopropyl.

[0173] The above R 1 , R 2 , R 3 and G 2 The alkyl group in the definition of may be a straight chain group or a branched chain group, preferably includes an alkyl group containing 1 to 12 carbon atoms, and more preferably includes an alkyl group containing 1 to 6 carbon atoms. Specific examples of the alkyl group include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl and hexyl. The alkyl part of the alkoxy group in the definition of the above substituent group has the same definition as that described in the definition of alkyl in this specification.

[0174] In addition, in the method of the present invention, the amide compound can be used in a free state or in a salified state. Examples of salts of amide compounds include base addition salts or acid addition salts, but are not particularly limited thereto. Examples of base addition salts include salts with inorganic bases such as sodium, magnesium, potassium, calcium, aluminum, etc.; salts with organic bases such as methylamine, ethylamine, ethanolamine, etc.; salts with basic amino acids such as lysine, ornithine, arginine, etc.); and ammonium salts. Specific examples of acid addition salts include inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, etc.); acid addition salts, for example, salts with organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, maleic acid, tartaric acid, fumaric acid, succinic acid, lactic acid, maleic acid, citric acid, methanesulfonic acid, trifluoromethanesulfonic acid, ethanesulfonic acid, and salts with acidic amino acids such as aspartic acid and glutamic acid. Examples of the amide compound include salts, hydrates, solvates, crystal polymorphs and the like.

[0175] When R represents a protected hydroxyl group, its protecting group may be any protecting group that can be used in the amide method, for example, the following groups may be used: in addition to 2'-tert-butyldimethylsilyl (TBDMS), 2'-bis(2-acetoxy)methyl (ACE), 2'-(triisopropylsilyloxy)methyl (TOM), 2'-(2-cyanoethoxy)ethyl (CEE), 2'-(2-cyanoethoxy)methyl (CEM), 2'-toluenesulfonylethoxymethyl (TEM), 2'-EMM (WO2006 / 022323A1), there are also those groups described in WO2013 / 027843A1 and WO2019 / 208571A1. Among the 2' protecting groups of these ribonucleosides (RNA), the above-mentioned protecting groups shown in formula (12) are exemplified as preferred protecting groups. Further preferably, as E w The electron withdrawing group shown is exemplified by a cyano-containing protecting group shown in formula (13).

[0176] [Chemical formula 17]

[0177]

[0178] (in,

[0179] q, R a and R b Same as above, but R a and R b not simultaneously represent hydrogen atoms).

[0180] The protecting group represented by formula (13) can be synthesized, for example, according to the methods described in WO2013 / 027843A1 and WO2019 / 208571A1, and the amide compound having such a protecting group can be used to prepare nucleic acid compounds.

[0181] For nucleic acid extension reactions, use Figure 1 The amide compound represented by formula (3) shown in route A.

[0182] As a non-nucleotide linker, a linker formed by an amino acid skeleton (for example, a linker formed by an amino acid skeleton described in JP5157168B2 or JP5554881B2) is exemplified. Specifically, as a non-limiting example, a linker represented by formula (A14-1), formula (A14-2) or formula (A14-3) is exemplified. In addition to these linkers, specific linkers described in WO2012 / 005368A1, WO2018 / 182008 or WO2019 / 074110 are also exemplified.

[0183] [Chemical formula 18]

[0184]

[0185] Nucleotides and amides (wherein, the R group in formula (3) and the R' group in formula (4)) can also be prepared from nucleosides, which are synthesized according to the publicly known methods described in JP3745226B2, WO2001 / 053528B2, JP2014-221817A1, etc., or the publicly known methods cited in these documents. In addition, they can be prepared online using commercially available compounds by complying with the methods described in the following examples or by appropriately modifying these methods.

[0186] Regarding the nucleic acid synthesis according to the amide method in the above steps (1) to (6), in addition to the conventionally known method (for example, the method described in the above JP5157168B2 or JP5554881B2), Figure 1 In addition to the oxidation step of the present invention involved in step (3) in the scheme, the extension reaction of the nucleic acid can be performed by repeating each step such as the deprotection step and the condensation step. Each step is described below.

[0187] G 4 " represents a hydrogen atom, an alkali metal ion, an ammonium ion, an alkylammonium ion or a hydroxyalkylammonium ion. Examples of alkali metal ions include sodium ions and lithium ions. Specific examples of alkyl groups also include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl and hexyl, and specific examples thereof include ammonium ions, diethylammonium ions, triethylammonium ions, tetrabutylammonium ions, hexylammonium ions, dibutylammonium ions and the like. As hydroxyalkylammonium ions, specific examples of the hydroxyalkyl moiety thereof include hydroxymethyl, hydroxyethyl, hydroxy-n-propyl, hydroxy-isopropyl, hydroxy-n-butyl and trimethylol, and more specific examples of hydroxyalkylammonium include trimethylolammonium ions and the like.

[0188] G 5 represents a hydrogen atom or a protecting group. When it represents a protecting group, it is identical to G 1 The same definition as in. 5 When deprotected, it is a hydrogen atom, in which case the nucleotide compound can also be used in a series of steps for nucleic acid extension reaction.

[0189] (Nucleic acid extension reaction)

[0190] The "nucleic acid extension reaction" used in this specification refers to a reaction for extending an oligonucleotide by sequentially linking nucleotides via a phosphodiester bond. The nucleic acid extension reaction can be performed according to the usual phosphoramidite method. The nucleic acid extension reaction can be performed using a nucleic acid automatic synthesizer using the phosphoramidite method, etc.

[0191] The chain length of the nucleic acid oligomer can be, for example, 2 to 200 mer, 10 to 150 mer, or 15 to 110 mer.

[0192] The 5' deprotection step in step (1) is a step of deprotecting the protecting group of the 5' hydroxyl group at the end of the RNA chain supported on the solid phase carrier. 4,4'-dimethoxytrityl (DMTr group), 4-monomethoxytrityl and 4,4',4"-trimethoxytrityl are used as common protecting groups. The deprotection reaction can be carried out by using an acid. Examples of acids for the deprotection reaction include trifluoroacetic acid, dichloroacetic acid, trifluoroethanesulfonic acid, trichloroacetic acid, methanesulfonic acid, trifluoromethanesulfonic acid, trichloroacetic acid, methanesulfonic acid, hydrochloric acid, acetic acid, p-toluenesulfonic acid, and the like.

[0193] The condensation step in step (2) is Figure 1The reaction of connecting the nucleoside phosphoramidite shown in formula (3) described in route A with the 5' hydroxyl group at the end of the oligonucleotide chain deprotected by the above-mentioned deprotection step. Use the amide compound shown in formula (3) or formula (A12) as the phosphoramidite for nucleic acid extension. In addition, other available phosphoramidites include 2'-OMe, 2'-F, 2'-o-tert-butyldimethylsilyl, 2'-O-methoxyethyl, 2'-H, 2'-fluoro-2'-deoxy-β-D-arabinofuranosyl, etc. As the above-mentioned nucleoside phosphoramidite, a nucleoside phosphoramidite in which the 5' hydroxyl group is protected by a protecting group (e.g., DMTr group) is used. The condensation step can be carried out by using an activator that activates the above-mentioned nucleotide phosphoramidite. Examples of activators include 5-benzylthio-1H-tetrazolyl (BTT), 1H-tetrazolyl, 4,5-dicyanoimidazole (DCI), 5-ethylthio-1H-tetrazolyl (ETT), N-methylbenzimidazolium trifluoromethanesulfonate (N-MeBIT), benzimidazolium trifluoromethanesulfonate (BIT), N-phenylimidazolium trifluoromethanesulfonate (N-PhIMT), imidazolium trifluoromethanesulfonate (IMT), 5-nitrobenzimidazolium trifluoromethanesulfonate (NBT), 1-hydroxybenzotriazole (HOBT) and 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazolyl, etc.

[0194] Figure 1 The nucleotide phosphoramidite (hereinafter referred to as "amide") represented by formula (3) described in Scheme A is shown below.

[0195] A compound represented by the following formula (3):

[0196] [Chemical formula 19]

[0197]

[0198] {in

[0199] G 1 , G 2 , G 3 , B a and R are the same as defined above).

[0200] After the condensation step, the unreacted 5' hydroxyl group may be capped as necessary. The capping reaction may be performed by using a publicly known capping solution such as acetic anhydride-tetrahydrofuran solution, phenoxyacetic anhydride / N-methylimidazole solution.

[0201] The oxidation step of step (3) is a step of converting the phosphite group formed by the above-mentioned condensation step into a phosphate group or a thiophosphate group. This step is a reaction of converting trivalent phosphorus into pentavalent phosphorus using an oxidant, and can be performed by allowing the oxidant to act on the oligonucleic acid derivative supported on the solid phase carrier.

[0202] When the phosphite group is converted into a phosphate group, as an "oxidant", for example, iodine can be used. The oxidant can be used by adjusting its concentration to 0.005 to 2M. Water can be used as an oxygen source for oxidation, and pyridine and other components can be used as a base for the reaction. In addition, the solvent is not particularly limited as long as it does not participate in the reaction, and can be used as a mixed solvent of acetonitrile, tetrahydrofuran (THF) or any proportion of these solvents. For example, iodine / water / pyridine / acetonitrile, or iodine / water / pyridine, or iodine / water / pyridine / THF can be used. The reaction temperature is preferably 5°C to 50°C, and the reaction time of the reaction is usually appropriately 1 minute to 30 minutes. Relative to 1 mole of the compound supported on the solid phase carrier, the amount of the reagent used is in the range of 1 to 100 moles, preferably in the range of 1 to 10 moles.

[0203] When the phosphite triester group is converted into a thiophosphoric acid group, as the "oxidant", for example, sulfur, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazole-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazol-3-one (POS), [(N,N-dimethylaminomethyline)amino]-3H-1,2,4-dithiazoline-3-thione (DDTT) and phenylacetyldisulfide (PADS) can be used. The oxidant can be diluted with an appropriate solvent so that its concentration is adjusted to 0.001 to 2 M. The solvent used is not particularly limited as long as it does not participate in the reaction, and includes, for example, dichloromethane, acetonitrile, pyridine, or any mixed solvent of these solvents. The oxidation step can be performed after the above-mentioned end-capping step, or vice versa, the end-capping step can be performed after the oxidation step, and the order of the steps is not limited.

[0204] In step (5), in the step of deprotecting the protecting group of the phosphorus group, when the synthesis of the nucleic acid having the desired sequence is completed, an amine compound is allowed to act to deprotect the protecting group of the phosphorus part. Examples of the amine compound include diethylamine described in JP4705716B2.

[0205] The protecting group of the 5' hydroxyl group of the nucleoside introduced at the final stage of elongation can be used for column purification labeled with the 5' protecting group after the steps of cleavage from the solid phase support and deprotection of the protecting group described below, or the protecting group of the 5' hydroxyl group can be deprotected after column purification.

[0206] In step (5), the excision of the nucleic acid oligomer from the solid phase support is generally performed by using concentrated aqueous ammonia as an excision agent, and the nucleic acid oligomer is extended into a desired chain on the solid phase support.

[0207] Furthermore, the oligonucleotide chain is recovered by, for example, cleaving it from the solid phase support using ammonia or an amine compound, etc. Examples of the amine compound include methylamine, ethylamine, isopropylamine, ethylenediamine, diethylamine, and the like.

[0208] In step (6), according to the method described in WO2006 / 022323A1, WO2013 / 027843A1 or WO2019 / 208571A1, the protecting group of the hydroxyl group at the 2-position or 3-position of the ribose of the nucleic acid compound (6) cut out from the solid phase support in step (5) can be removed to obtain a deprotected nucleic acid oligomer (7).

[0209] Examples of nucleic acid oligomers that can be prepared according to the method of the present invention include nucleic acid oligomers in which the nucleosides contained in the nucleic acid oligomers are RNA, DNA, RNA with 2'-O-MOE, 2'-O-Me, 2'-F, and LNA, but are not limited thereto. For example, various nucleosides described in the following documents are included: Xulong, Shen et al., Nucleic Acids Research, 2018, Vol. 46, No. 46, 1584-1600; and Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558.

[0210] Typical examples of nucleic acid oligomers that can be used in the method of the present invention include the following examples in addition to the examples described in the Examples, but the invention is not limited thereto.

[0211] Hereinafter, in the description of sequences, u is uridine, c is cytidine, A is adenosine, or G is guanosine.

[0212] Examples include nucleic acid oligomers having the following sequences (B) and (C) as described in WO2019 / 060442.

[0213] Sequence (B): 5'-AUGGAAUmACUCUUGGUUmACdTdT-3' (antisense) (SEQ ID NO: 3) 21mer

[0214] Sequence (C): 5'-GUmAACmCmAAGAGUmAUmUmCmCmAUmdTdT-3' (positive sense) (SEQ ID NO: 4) 21mer

[0215] In sequence (B) and sequence (C), Um is 2'-O-methyluridine, Cm is 2'-o-methylcytidine, or dt is thymidine.

[0216] Examples include the nucleic acid oligomers described in Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558. Typical examples thereof include nucleic acid oligomers having the following sequence (D).

[0217] Sequence (D): 5'-AGAGCCAGCCUUCUUAUUGUUUUAGAGCUAUGCUGU-3' (SEQ ID NO: 5) 36mer

[0218] The nucleic acid oligomer described in JP4965745B2 is exemplified. Typical examples thereof include a nucleic acid oligomer having the following sequence (E).

[0219] Sequence (E): 5'-CCAUGAGAAGUAUGACAACAGCC-P-GGCUGUUGUCAUACUUCUCAUGGUU-3'49mer. CCAUGAGAAGUAUGACAACAGCC (SEQ ID NO: 6), GGCUGUUGUCAUACUUCUCAUGGUU (SEQ ID NO: 7).

[0220] In the sequence (E), "P" is represented by the partial structure divided by wavy lines in the following formula (A5).

[0221] An example is a nucleic acid oligomer having the following sequence (F) described in Nucleic Acids Research, 2019, Vol. 47, No. 2: 547.

[0222] Sequence (F): 5'-ACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3' (SEQ ID NO: 8) 67mer

[0223] An example is a nucleic acid oligomer having the following sequence (G) described on page 173 of JP2015-523856.

[0224] Sequence (E): 5'-GUUUUCCCUUUUCAAAGAAAUCUCCUGGGCACCUAUCUUCUUAGGUGCCCUCCCUUGUUUAAACCUGACCAGUUAACCGGCUGGUUAGGUUUUU-3' (SEQ ID NO: 9) 94mer

[0225] The nucleic acid oligomers described in JP2017-537626 are cited as examples. Typical examples thereof include nucleic acid oligomers having the following sequences (F), (G), (H) and (J).

[0226] Sequence (F): 5'-AGUCCUCAUCUCCCUCAAGCGUUUUAGAGCUAGUAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (SEQ ID NO: 10) 100mer

[0227] Sequence (G): 5'-GCAGAUGUAGUGUUUCCACAGUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (SEQ ID NO: 11) 113mer

[0228] Sequence (H): 5'-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAdAdGdCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUUUUU-3' (serial number 12) 113mer

[0229] In the sequence (H), dt is thymidine, dc is 2'-deoxycytidine, dA is 2'-deoxyadenosine, or dG is 2'-deoxyguanosine.

[0230] Sequence (J): 5'-AmsGmsUmsCCUCAUCUCCCUCAAGCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUUmsUmsUmsU-3' (Sequence 13) 113mer

[0231] In sequence (J), Um is 2'-O-methyluridine, Cm is 2'-O-methylcytidine, Am is 2'-O-methyladenosine, Gm is 2'-O-methylguanosine, or s is phosphorothioate modification.

[0232] Example

[0233] Hereinafter, the present invention will be described in more detail by way of examples, but the present invention is not limited to these examples.

[0234] <Measurement method>

[0235] First, various measurement methods used in the following experiments are shown below.

[0236] The purity of the oligonucleotides was determined by HPLC.

[0237] The HPLC assay conditions are shown in Table 1 below.

[0238] (Measurement method 1: Determination of oligonucleotide purity)

[0239] [Table 1]

[0240]

[0241] (Measurement method 2: measurement of oligonucleotide yield)

[0242] The OD260 of the crude product was measured. OD260 represents the absorbance at UV260 nm per 10 mm optical path length in 1 mL of a solution (pH=7.5). Generally, it is known that OD=40 μg for RNA1, so the yield was calculated based on the measured value of OD260.

[0243] <Solid Phase Synthesis of Oligonucleotides>

[0244] Sequence (I): 5'-AGCAGAGUACACACAGCAUAUACC-P-GGUAUAUGCUGUGUGUACUCUGCUUC-PG-3' (SEQ ID NOs. 1, 2) 3mer

[0245] In the above sequence (I), "A" is represented by the local structure divided by wavy lines in the following formula (A1). "C" is represented by the local structure divided by wavy lines in the following formula (A2). "G" is represented by the local structure divided by wavy lines in the following formula (A3). "U" is represented by the local structure divided by wavy lines in the following formula (A4). "P" is represented by the local structure divided by wavy lines in the following formula (A5). Here, the "A" at the 5' end is represented by the local structure divided by wavy lines in the following formula (A6). In addition, the "G" at the 3' end is represented by the local structure divided by wavy lines in the following formula (A7).

[0246] AGCAGAGUAC ACACAGCAUA UACC (serial number 1)

[0247] GGUAUAUGCU GUGUGUACUC UGCUUC (serial number 2)

[0248] [Chemical formula 20]

[0249]

[0250] [Chemical formula 21]

[0251]

[0252] [Chemical formula 22]

[0253]

[0254] [Chemical formula 23]

[0255]

[0256] [Chemical formula 24]

[0257]

[0258] [Chemical formula 25]

[0259]

[0260] [Chemical formula 26]

[0261]

[0262] Using controlled pore glass (CPG) as a solid phase carrier and NTS M-4MX-E (manufactured by NIHON TECHNO SERVICE CO. LTD) as a nucleic acid synthesizer, an oligonucleotide consisting of the above sequence (I) was synthesized from the 3' end to the 5' end according to the phosphoramidite solid phase synthesis method. When NTS M-4MX-E (manufactured by NIHON TECHNO SERVICE CO. LTD) was used, the synthesis was performed on a scale of about 1 μmol. In addition, the synthesis used uridine EMM amide described in Example 2 of US2012 / 0035246, cytidine EMM amide described in Example 3 thereof, adenosine EMM amide described in Example 4 thereof, guanosine EMM amide described in Example 5 thereof, and compound (3) described in WO2017 / 188042, and a high-purity solution of trichloroacetic acid toluene was used as a deblocking solution, 5-benzylmercapto-1H-tetrazole was used as a condensing agent, an iodine solution was used as an oxidizing agent, and a phenoxyacetic anhydride solution and an N-methylimidazole solution were used as a blocking solution.

[0263] [Chemical formula 27]

[0264]

[0265] [Chemical formula 28]

[0266]

[0267] [Chemical formula 29]

[0268]

[0269] [Chemical formula 30]

[0270]

[0271] [Chemical formula 31]

[0272]

[0273] Next, specific examples of the preparation of nucleic acid oligomers prepared by the method of the present invention are shown. Here, in the following examples, the oligonucleotides prepared by the method of the present invention are nucleic acid oligomers having the above-mentioned sequence numbers 1 and 2.

[0274] In addition, the guanosine derivatives described in the following Examples and Comparative Examples represent compounds represented by the following structural formula: The ring shown in the following structural formula schematically represents CPG.

[0275] [Chemical formula 32]

[0276]

[0277] (Example 1)

[0278] Using controlled pore glass (CPG) loaded with 1.07 μmol of a guanosine derivative and each amide represented by formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12), a nucleic acid oligomer represented by sequence (I) was automatically synthesized from the 3' end to the 5' end using NTS M-4MX-E (manufactured by NIHON TECHNO SERVICE CO. LTD). In the process for automatic synthesis, first, a 3% trichloroacetic acid toluene solution was liquid-transferred to CPG in 1.4 mL portions to deprotect the trityl protecting group at the 5' position, and then 0.3 mL of each amide and 0.4 mL of 5-benzylmercapto-1H-tetrazole as a condensing agent were liquid-transferred to CPG to perform a coupling reaction at the hydroxyl group at the 5' position. Subsequently, after a solution of acetonitrile: water: pyridine = 35.2: 52.9: 11.4 (wt%) containing 17 mM iodine was stored at 60°C for 161 hours, and shortly before the synthesis, acetonitrile was added thereto to prepare a solution of acetonitrile: water: pyridine = 58.2: 34.2: 7.4 (wt%) containing 10 mM iodine, and 0.7 mL of the resulting solution was subjected to liquid transfer to convert the phosphite group into a phosphate group. Next, 0.5 mL of a 0.1 M phenoxyacetic anhydride solution and 0.5 mL of a 10% N-methylimidazole / 10% 2,6-dimethylpyridine acetonitrile solution were used to perform a capping reaction at the reaction point where the coupling reaction did not proceed. These steps were repeated a total of 52 times to synthesize a nucleic acid oligonucleotide of the sequence shown in sequence (I) on a CPG carrier, and the trityl protecting group at the 5' position was deprotected using a 3% trichloroacetic acid toluene solution. Then, with 752 μ L ammonia and 252 μ L ethanol treatment, the CPG carrier of all amount oligonucleotide is carried thereon, so that nucleic acid oligomer is separated from solid phase carrier, and ammonia and ethanol are removed by nitrogen spray.Then, free oligonucleotide is dissolved in 400 μ L dimethyl sulfoxide, after adding nitromethane 5.3 μ L and stirrer therein, under the condition of stirring with agitator, dimethyl sulfoxide solution 530 μ L (10.2 moles of TBAF with respect to every 1 mole of protecting group) of 1M tetra-n-butylammonium fluoride (TBAF) dehydrated with molecular sieve 4A is injected therein at 30 ℃, and the gained mixture is incubated 4 hours to carry out the protecting group deprotection of 2 '-EMM protecting group.Obtain crude product by precipitation operation.Yield is 8.6mg, and purity is 61%.For the crude product obtained, the purity of oligonucleotide is measured by the method in the above-mentioned assay method 1, in addition, the yield of oligonucleotide is measured by the method using the above-mentioned assay method 2.

[0279] (Example 2)

[0280] Using controlled pore glass (CPG) loaded with 1.02 μmol of a guanosine derivative and each amide represented by formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12), a nucleic acid oligomer represented by sequence (I) was automatically synthesized from the 3' end to the 5' end by NTS M-4MX-E (manufactured by NIHON TECHNO SERVICE CO. LTD). For the process for automatic synthesis, first, 1.4 mL of a 3% trichloroacetic acid toluene solution was transferred to CPG at a time, and the trityl protecting group at the 5' position was deprotected. Subsequently, 0.3 mL of each amide and 0.4 mL of 5-benzylmercapto-1H-tetrazole as a condensing agent were transferred to CPG, and a coupling reaction was performed at the hydroxyl group at the 5' position. Subsequently, after a solution of acetonitrile: water: pyridine = 35.2: 52.9: 11.4 (wt%) containing 17 mM iodine was stored at 60°C for 24 hours, and shortly before the synthesis, acetonitrile was added thereto to prepare a solution of acetonitrile: water: pyridine = 58.2: 34.2: 7.4 (wt%) containing 10 mM iodine, and 0.7 mL of the resulting solution was subjected to liquid transfer to convert the phosphite group into a phosphate group. Next, 0.5 mL of a 0.1 M phenoxyacetic anhydride solution and 0.5 mL of a 10% N-methylimidazole / 10% 2,6-dimethylpyridine acetonitrile solution were used to perform a capping reaction at the reaction point where the coupling reaction did not proceed. These steps were repeated a total of 52 times to synthesize a nucleic acid oligonucleotide of the sequence shown in sequence (I) on a CPG carrier, and the trityl protecting group at the 5' position was deprotected using a 3% trichloroacetic acid toluene solution. Then, with 752 μ L ammonia and 252 μ L ethanol treatment, the CPG carrier of all amount oligonucleotide is carried thereon, so that nucleic acid oligomer is separated from solid phase carrier, and ammonia and ethanol are removed by nitrogen spray.Then, free oligonucleotide is dissolved in 400 μ L dimethyl sulfoxide, after adding nitromethane 5.3 μ L and stirrer therein, under the condition of stirring with agitator, dimethyl sulfoxide solution 530 μ L (10.2 moles of TBAF with respect to every 1 mole of protecting group) of 1M tetra-n-butylammonium fluoride (TBAF) dehydrated with molecular sieve 4A is injected therein at 30 ℃, gained mixture is incubated 4 hours, to carry out the protecting group deprotection of 2 '-EMM protecting group.Obtain crude product by precipitation operation.Yield is 7.3mg, and purity is 59%.For the crude product obtained, the purity of oligonucleotide is measured by the method in the above-mentioned assay method 1, in addition, the yield of oligonucleotide is measured by the method using the above-mentioned assay method 2.

[0281] (Example 3)

[0282] Using controlled pore glass (CPG) loaded with 1.03 μmol of a guanosine derivative and each amide represented by formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12), a nucleic acid oligomer represented by sequence (I) was automatically synthesized from the 3' end to the 5' end by NTS M-4MX-E (manufactured by NIHON TECHNO SERVICE CO. LTD). For the process for automatic synthesis, first, 1.4 mL of a 3% trichloroacetic acid toluene solution was transferred to CPG at a time, and the trityl protecting group at the 5' position was deprotected. Subsequently, 0.3 mL of each amide and 0.4 mL of 5-benzylmercapto-1H-tetrazole as a condensing agent were transferred to CPG, and a coupling reaction was performed at the hydroxyl group at the 5' position. Subsequently, after a solution of acetonitrile: water: pyridine = 35.2: 52.9: 11.4 (wt%) containing 17 mM iodine was stored at 40°C for 24 hours, and shortly before the synthesis, acetonitrile was added thereto to prepare a solution of acetonitrile: water: pyridine = 58.2: 34.2: 7.4 (wt%) containing 10 mM iodine, and 0.7 mL of the resulting solution was subjected to liquid transfer to convert the phosphite group into a phosphate group. Next, 0.5 mL of a 0.1 M phenoxyacetic anhydride solution and 0.5 mL of a 10% N-methylimidazole / 10% 2,6-dimethylpyridine acetonitrile solution were used to perform a capping reaction at the reaction point where the coupling reaction did not proceed. These steps were repeated a total of 52 times to synthesize a nucleic acid oligonucleotide of the sequence shown in sequence (I) on a CPG carrier, and the trityl protecting group at the 5' position was deprotected using a 3% trichloroacetic acid toluene solution. Then, with 752 μ L ammonia and 252 μ L ethanol treatment, the CPG carrier of all amount oligonucleotide is carried thereon, so that nucleic acid oligomer is separated from solid phase carrier, and ammonia and ethanol are removed by nitrogen spray.Then, free oligonucleotide is dissolved in 400 μ L dimethyl sulfoxide, after adding nitromethane 5.3 μ L and stirrer therein, under the condition of stirring with agitator, dimethyl sulfoxide solution 530 μ L (10.2 moles of TBAF with respect to every 1 mole of protecting group) of 1M tetra-n-butylammonium fluoride (TBAF) dehydrated with molecular sieve 4A is injected therein at 30 ℃, and the gained mixture is incubated 4 hours to carry out the protecting group deprotection of 2 '-EMM protecting group.Obtain crude product by precipitation operation.Yield is 8.1mg, and purity is 57%.For the crude product obtained, the purity of oligonucleotide is measured by the method in the above-mentioned assay method 1, in addition, the yield of oligonucleotide is measured by the method using the above-mentioned assay method 2.

[0283] (Reference Example 1)

[0284] Using controlled pore glass (CPG) loaded with 1.00 μmol of a guanosine derivative and each amide represented by formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12), a nucleic acid oligomer represented by sequence (I) was automatically synthesized from the 3' end to the 5' end by NTS M-4MX-E (manufactured by NIHON TECHNO SERVICE CO. LTD). For the process for automatic synthesis, first, 1.4 mL of a 3% trichloroacetic acid toluene solution was transferred to CPG at a time, and the trityl protecting group at the 5' position was deprotected. Subsequently, 0.3 mL of each amide and 0.4 mL of 5-benzylmercapto-1H-tetrazole as a condensing agent were transferred to CPG, and a coupling reaction was performed at the hydroxyl group at the 5' position. Subsequently, a solution containing 50 mM iodine in pyridine: water = 88.7: 10.0 (wt%) was stored at 25°C for 24 hours, and 0.7 mL of the resulting solution was liquid transferred to convert the phosphite group into a phosphate group. Next, 0.5 mL of a 0.1 M phenoxyacetic anhydride solution and 0.5 mL of a 10% N-methylimidazole / 10% 2,6-dimethylpyridine acetonitrile solution were used to perform a capping reaction at the reaction point where the coupling reaction did not proceed. These steps were repeated a total of 52 times to synthesize a nucleic acid oligonucleotide of the sequence shown in sequence (I) on a CPG carrier, and the trityl protecting group at the 5' position was deprotected with a 3% trichloroacetic acid toluene solution. Then, the CPG carrier on which the entire amount of oligonucleotide was loaded was treated with 752 μL of ammonia water and 252 μL of ethanol to detach the nucleic acid oligomer from the solid phase carrier, and the ammonia water and ethanol were removed by nitrogen spraying. Next, the free oligonucleotide is dissolved in 400 μL of dimethyl sulfoxide, after adding 5.3 μL of nitromethane and a stirrer therein, under stirring with a stirrer, 530 μL of dimethyl sulfoxide solution (10.2 moles of TBAF) of 1M tetra-n-butylammonium fluoride (TBAF) dehydrated with molecular sieve 4A is injected therein at 30 ℃, and the resulting mixture is incubated for 4 hours to deprotect the protecting group of the 2'-EMM protecting group. The crude product is obtained by precipitation operation. The yield is 7.9 mg, and the purity is 42%. For the crude product obtained, the purity of the oligonucleotide is measured by the method using the above-mentioned assay method 1, and in addition, the yield of the oligonucleotide is measured by the method using the above-mentioned assay method 2.

[0285] (Reference Example 2)

[0286] Using controlled pore glass (CPG) loaded with 1.04 μmol of a guanosine derivative and each amide represented by formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12), a nucleic acid oligomer represented by sequence (I) was automatically synthesized from the 3' end to the 5' end by NTS M-4MX-E (manufactured by NIHON TECHNO SERVICE CO. LTD). For the process for automatic synthesis, first, 1.4 mL of a 3% trichloroacetic acid toluene solution was transferred to CPG at a time, and the trityl protecting group at the 5' position was deprotected. Subsequently, 0.3 mL of each amide and 0.4 mL of 5-benzylmercapto-1H-tetrazole as a condensing agent were transferred to CPG, and a coupling reaction was performed at the hydroxyl group at the 5' position. Subsequently, a solution of acetonitrile: water: pyridine = 58.2: 34.4: 7.2 (wt%) containing 10 mM iodine was stored at 25°C for 24 hours, and 0.7 mL of the resulting solution was liquid transferred to convert the phosphite group into a phosphate group. Next, 0.5 mL of a 0.1 M phenoxyacetic anhydride solution and 0.5 mL of a 10% N-methylimidazole / 10% 2,6-dimethylpyridine acetonitrile solution were used to perform a capping reaction at the reaction point where the coupling reaction did not proceed. These steps were repeated a total of 52 times to synthesize a nucleic acid oligonucleotide of the sequence shown in sequence (I) on a CPG carrier, and the trityl protecting group at the 5' position was deprotected with a 3% trichloroacetic acid toluene solution. Then, the CPG carrier on which the entire amount of oligonucleotides were loaded was treated with 752 μL of ammonia water and 252 μL of ethanol to detach the nucleic acid oligomer from the solid phase carrier, and the ammonia water and ethanol were removed by nitrogen spraying. Next, the free oligonucleotide is dissolved in 400 μL of dimethyl sulfoxide, after adding 5.3 μL of nitromethane and a stirrer therein, under stirring with a stirrer, 530 μL of dimethyl sulfoxide solution (10.2 moles of TBAF) of 1M tetra-n-butylammonium fluoride (TBAF) dehydrated with molecular sieve 4A is injected therein at 30 ℃, and the resulting mixture is incubated for 4 hours to deprotect the protecting group of the 2'-EMM protecting group. The crude product is obtained by precipitation operation. The yield is 7.8 mg, and the purity is 35%. For the crude product obtained, the purity of the oligonucleotide is measured by the method using the above-mentioned assay method 1, and in addition, the yield of the oligonucleotide is measured by the method using the above-mentioned assay method 2.

[0287] The test results of Examples 1 to 3 and Reference Examples 1 to 2 are shown in Table 2.

[0288] [Table 2]

[0289]

[0290] According to the above results in the table, when the oxidation solution of the present invention heat-treated at a temperature of 40° C. or higher is used and compared with the oxidation solutions of Reference Examples 1 and 2, a nucleic acid oligomer with high purity can be obtained.

[0291] Industrial Applicability

[0292] The present invention provides an efficient method for preparing a nucleic acid oligomer. In addition, it can be expected that the purity of the nucleic acid oligomer prepared by the method for preparing a nucleic acid oligomer will be improved.

[0293] Sequence Listing Free Text

[0294] Sequence numbers 1 to 13 of the sequence listing represent nucleotide sequences of oligonucleotides prepared according to the preparation method of the present invention.

Claims

1. A method for preparing a nucleic acid compound having a nucleotide represented by formula (I) at its 5' end by the phosphoramidite method. [Chemical formula 1] in, G 1 and G 2 Each independently represents a protecting group for a hydroxyl group, B a represents a nucleic acid base which may be optionally protected by a protecting group, R represents a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group or an OQ' group, Q' represents a methylene group of the carbon atom attached to the 4' position of ribose, an ethylene group of the carbon atom attached to the 4' position of ribose, or an ethylidene group of the carbon atom attached to the 4' position of ribose, and The bond marked with the symbol * indicates the bond pointing to the 3' terminal side of the nucleic acid, The method comprises: A step of reacting a precursor having a phosphite triester bond represented by formula (II) with an oxidizing solution containing iodine, pyridine and water which has been heat-treated at 40° C. or higher, wherein the prepared oxidizing solution is aged in a range of 40° C. or higher and 80° C. or lower during storage until it is used for an oxidation reaction for nucleic acid synthesis, [Chemical formula 2] in, G 1 , G 2 , B a , R and * are the same as defined above.

2. The method according to claim 1, wherein: The precursor having a phosphite triester bond is a nucleic acid compound represented by formula (4), [Chemical formula 3] in, G 1 represents a protecting group for a hydroxyl group, G 2 are the same or different, each independently representing a protecting group for a hydroxyl group, B a are the same or different, and each independently represents a nucleic acid base that can be protected by a protecting group, R are the same or different and each independently represents a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group or an OQ' group, Q' are the same or different and each independently represents a methylene group connected to the carbon atom at the 4' position of ribose, an ethylene group connected to the carbon atom at the 4' position of ribose, or an ethylidene group connected to the carbon atom at the 4' position of ribose, Y are the same or different and each independently represents an oxygen atom or a sulfur atom, n is any integer from 1 to 200, When X represents OZ, W represents an OV group, and V represents a protective group for a hydroxyl group. When X represents an R group, W represents a group represented by OZ, Z represents a group having a structure including a solid phase support and a linking group, and When n is an integer of 2 or more, the nucleic acid compound represented by formula (4) is optionally incorporated via a non-nucleotide linker to replace at least one nucleotide between the nucleotide at the 5' terminal and the nucleotide at the 3' terminal of the nucleic acid compound, The compound containing a phosphotriester bond is a compound represented by formula (5), [Chemical formula 4] in, G 1 , G 2 , B a , R, n, W, X and Y are the same as defined above, and As defined in formula (4), a non-nucleotide linker is optionally incorporated in place of a nucleotide.

3. The method according to claim 2, comprising: The step of extending the chain length of the nucleic acid compound represented by formula (5) to any chain length by an amide method to obtain the nucleic acid represented by formula (5'), [Chemical formula 5] in, G 2 , B a , R, X and W are the same as those in formula (5), G 5 represents a protecting group for a hydroxyl group, or a hydrogen atom, m is an integer satisfying m≥n, Y are the same or different and each independently represents an oxygen atom or a sulfur atom, but at least one Y is an oxygen atom; a step of excising a compound represented by formula (6) from a compound represented by formula (5'), [Chemical formula 6] in, G 5 , R and m are the same as defined above, B c are the same or different, each independently representing a nucleic acid base, G 4 represents a hydrogen atom, an alkali metal ion, an ammonium ion, an alkylammonium ion or a hydroxyalkylammonium ion, Y independently represents an oxygen atom or a sulfur atom, and at least one of them is an oxygen atom, and X1 represents a hydroxyl group, W1 represents an OV group, wherein V represents a protective group for the hydroxyl group, or X1 represents an R group and W1 represents a hydroxyl group; and, a step of deprotecting the compound represented by formula (6) to prepare a deprotected nucleic acid oligomer represented by formula (7), [Chemical formula 7] in, m, Y, G 4 and B c Same as the above definition, R' is the same or different and each independently represents a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group or an OQ' group, Q' are the same or different and each independently represents a methylene group connected to the carbon atom at the 4' position of ribose, an ethylene group connected to the carbon atom at the 4' position of ribose, or an ethylidene group connected to the carbon atom at the 4' position of ribose, X 10 and W 10 Each independently represents a hydroxyl group, or X 10 Represents R' group, W 10 Represents hydroxyl.

4. The method according to claim 2 or 3, wherein: The non-nucleotide linker is a linker formed by an amino acid backbone.

5. The method according to claim 4, wherein: The linker comprising an amino acid skeleton is a linker having a structure selected from the following formulae (A14-1), (A14-2) and (A14-3), [Chemical formula 8] 6. The method according to any one of claims 1 to 3, wherein: The concentration of iodine in the oxidizing solution is 0.005 to 2M.

7. The method according to any one of claims 1 to 3, wherein: The concentration of iodine in the oxidizing solution is 0.005 to 0.2M.

8. The method according to any one of claims 1 to 3, wherein: The concentration of iodine in the oxidizing solution is 0.007 to 0.1 M.

9. The method according to any one of claims 1 to 3, wherein: The concentration of iodine in the oxidizing solution is 0.008 to 0.07M.

10. The method according to any one of claims 1 to 3, wherein: The oxidizing solution is prepared by mixing iodine, pyridine and water.

11. The method according to claim 10, wherein: The oxidizing solution is an oxidizing solution containing at least one solvent selected from the group consisting of acetonitrile and tetrahydrofuran.

12. The method according to claim 10, wherein: The oxidation solution further contains an acetonitrile solvent.

13. The method according to claim 11, wherein: The solvent of the oxidation solution is a mixture of solvents obtained by mixing pyridine, water, acetonitrile, and tetrahydrofuran in a volume ratio of 1 to 90:1 to 50:0 to 90:0 to 90.

14. The method according to claim 11, wherein: The solvent of the oxidation solution is a mixture of solvents obtained by mixing pyridine, water, and acetonitrile in a volume ratio of 1 to 90:1 to 50:0 to 90.

15. The method according to any one of claims 1 to 3, wherein: The prepared oxidation solution is aged in the range of 40° C. or higher and 60° C. or lower during storage until it is used for the oxidation reaction for nucleic acid synthesis.

16. The method according to any one of claims 1 to 3, wherein: The nucleic acid compound is an RNA-containing nucleic acid compound.

17. The method according to claim 2 or 3, wherein: The nucleic acid is RNA, and its 2' protecting group is a protecting group represented by formula (12), [Chemical formula 9] in, q is an integer from 1 to 5, R a and R b are the same or different, each independently representing a methyl group, an ethyl group or a hydrogen atom, The bond marked with the symbol * represents the oxygen atom of the OQ group, and E w The group represents an electron withdrawing group.

18. The method according to claim 17, wherein: R a and R b At the same time, it is a hydrogen atom, E w It represents cyano.

19. The method according to any one of claims 1 to 3, wherein: The nucleic acid is an RNA having a chain length of 40 or more nucleotides.

20. The method according to any one of claims 1 to 3, further comprising the step of preparing the oxidizing solution described in claim 1.

21. The method according to any one of claims 1 to 3, wherein: G 1 Represents the following groups: [Chemical formula 10] Among them, R 1 , R 2 and R 3 are the same or different and each independently represents a hydrogen atom or an alkoxy group.

22. The method according to claim 2 or 3, wherein: The solid phase carrier includes an inorganic porous carrier.

23. The method according to any one of claims 1 to 3, wherein: When R represents a protected hydroxyl group, its protecting group is a protecting group selected from the group consisting of 2'-tert-butyldimethylsilyl, 2'-bis(2-acetoxy)methyl, 2'-(triisopropylsilyloxy)methyl, 2'-(2-cyanoethoxy)ethyl, 2'-(2-cyanoethoxy)methyl, and 2'-toluenesulfonylethoxymethyl.

Images