A sgRNA target sequence for increasing rice grain shape, a recombinant vector and its application

Abstract

The present invention provides an sgRNA target sequence for increasing rice grain shape, including an sgRNA1 target and an sgRNA2 target, wherein the sgRNA1 target sequence is CTCCCGCATGACGACGGAGT, and the sgRNA2 target sequence is CAGCGCTGTGATCGAGAAGA. The present invention also provides a recombinant vector comprising the sgRNA target sequence and its application. The present invention performs site-directed editing on a specific sequence of a rice qGL3 gene through CRISPR / Cas9 gene editing technology, and after gene mutation, the grain length, grain width and grain weight of rice can be increased, providing gene resources and technical ideas for research on rice grain shape improvement.

Description

Technical Field

[0001] The present invention relates to the technical field of gene editing, and in particular to a sgRNA target sequence for increasing rice grain shape, a recombinant vector and applications thereof. Background Art

[0002] my country is the world's largest rice producer and consumer, and rice production plays a vital role in my country's food security. Rice yield is a complex agronomic trait, consisting of three factors: number of panicles, number of grains per panicle, and thousand-grain weight. Among them, thousand-grain weight is the most genetically stable trait, and increasing grain weight is considered to be the most effective way to increase yield (Peng Dingwen, Journal of Southern Agricultural Sciences, 2011, 42: 250-252).

[0003] Rice grain weight is determined by grain shape (grain length, width, and thickness), which is a quantitative trait controlled by multiple genes. To date, more than 60 grain shape regulatory genes have been cloned, such as GS3, GW2, GS5, qSW5 / GW5, GW8, qGL3, GIF1, EP2 / DEP2, etc. (Liu Xi et al., Chinese Journal of Rice Science, 2018, 32(1): 1-11). The cloning of these genes provides important gene resources for rice molecular design breeding, which is of great significance for guiding rice high-yield breeding (Kang Yiwei et al., Chinese Journal of Rice Science, 2020, 34(6): 479-490). Several grain shape genes, such as GS3, qGL3, and GS9, mainly regulate grain elongation and can be used as important candidate genes for cultivating long-grain rice germplasm using gene editing. Currently, GS3 and GS9 genes have been successfully edited using CRSPR / Cas9 technology, and long-grain rice germplasm resources have been obtained (Meng Shuai et al., Chinese Journal of Rice Science, 2018, 32(2): 119-127; Xu Shanbin et al., Chinese Journal of Rice Science, 2020, 34(5): 406-412; Shen Lan et al., Chinese Journal of Rice Science, 2017, 31(3): 223-231). However, it is still unknown whether new large-grain rice germplasm can be obtained by editing qGL3. Summary of the invention

[0004] The function of the rice qGL3 gene has been studied in detail. The gene encodes a protein phosphatase OsPPKL1 with two Kelch domains. It mainly regulates grain elongation through the brassinosteroid (BR) signaling pathway. The loss-of-function genotype exhibits a large-grain phenotype (Zhang et al, PNAS, 2012, 109: 21534). Through genotype detection in rice planting resources, it was found that the large-grain genotype of qGL3 originated from a rare mutation in large-grain germplasm, which does not exist in common cultivated varieties, thus providing conditions for using CRISPR / Cas9 technology to improve the grain shape of cultivated rice varieties by editing the qGL3 gene. In recent years, gene editing technology represented by CRISPR / Cas9 technology has become a new means for precise improvement of plant traits and research on gene functions. It has the advantages of simple operation, short experimental cycle, low cost, and the ability to eliminate vector sequences and create new germplasm without marker genes. The present invention uses CRISPR / Cas9 gene editing technology to perform site-specific editing on a specific sequence of the rice qGL3 gene. After gene mutation, the grain length, width and weight of rice can be increased, providing genetic resources and technical ideas for research on rice grain shape improvement.

[0005] The present invention provides an sgRNA target sequence, comprising an sgRNA1 target and an sgRNA2 target, wherein the sgRNA1 target sequence is CTCCCGCATGACGACGGAGT, and the sgRNA2 target sequence is CAGCGCTGTGATCGAGAAGA.

[0006] The present invention also provides a recombinant vector comprising the sgRNA target sequence, wherein the basic plasmid of the recombinant vector comprises CRISPR / Cas9-U3-sgRNA1-U6a-sgRNA2.

[0007] Wherein, the U3 linker sequence of the sgRNA1 is: U3-sgRNA1-F: GGCACTCCCGCATGACGACGGAGT or U3-sgRNA1-R: AAACACTCCGTCGTCATGCGGGAG;

[0008] The U6a linker sequence of the sgRNA2 is: U6a-sgRNA2-F: GCCGCAGCGCTGTGATCGAGAAGA or U6a-sgRNA2-R: AAACTCTTCTCGATCACAGCGCTG.

[0009] The present invention also provides an application of the sgRNA target sequence or the recombinant vector in increasing rice grain shape.

[0010] The present invention also provides an application of the sgRNA target sequence or the recombinant vector in editing the rice qGL3 gene.

[0011] The present invention also provides an application of the sgRNA target sequence or the recombinant vector in editing the first exon of the rice qGL3 gene.

[0012] Preferably, the editing comprises causing one or more bases to be deleted and / or inserted and / or replaced in the coding frame of the rice qGL3 gene.

[0013] Preferably, the rice is a small-grain japonica rice variety.

[0014] In the specific creation of the present invention, by constructing a qGL3 gene editing vector, the U3 linker sequence and the U6a linker sequence containing the sgRNA target sequence are introduced into the recipient rice through the editing vector to obtain gene-edited rice with a mutation in the qGL3 gene; compared with the recipient rice, the grain shape and grain weight of the gene-edited rice are significantly improved.

[0015] Compared with the prior art, the beneficial effects of the present invention are:

[0016] 1. The present invention uses CRISPR / Cas9 technology to successfully edit the rice grain type gene qGL3, and cultivates a new large-grain rice germplasm with significantly improved grain length and grain weight, confirming the contribution of the qGL3 gene to grains, which will have great application value in the field of rice molecular breeding. Traditional rice grain type directional improvement breeding is mainly carried out through hybridization and backcrossing, but due to factors such as unstable offspring separation, long cycle and linkage drag of unfavorable genes, it is difficult to cultivate excellent varieties with improved grain shape that can be stably inherited. Therefore, CRISPR / Cas9 technology is being widely used in rice trait improvement and new germplasm creation because of its advantages such as simple operation, high editing efficiency and low cost.

[0017] 2. Different from the existing reports on gene editing in terms of target selection, the present invention uses two sgRNA targets to edit the qGL3 gene. In addition to ensuring the efficiency of gene editing, it also obtains materials with large fragment sequence deletions from sgRNA1 to sgRNA2. This type of mutation can completely lose the gene function. When a single sgRNA target is used, not only does no editing often occur, but only a single or a few bases can be inserted or deleted when editing occurs, resulting in partial retention of the function of the target gene, and the effect of gene function editing cannot be achieved. Therefore, the CRISPR / Cas9 vector constructed by the present invention has certain advantages in targeting efficiency and accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1Schematic diagram of the rice qGL3 gene structure and sgRNA position in the embodiment of the present invention.

[0019] Figure 2 Schematic diagram of the pYLCRISPR / Cas9-qGL3 vector containing two targets for editing the rice qGL3 gene in an embodiment of the present invention.

[0020] Figure 3 This is a schematic diagram of the mutation method of qGL3 editing rice in an embodiment of the present invention.

[0021] Figure 4 Schematic diagram of the grain phenotype and thousand-grain weight of qGL3 gene-edited rice in an embodiment of the present invention. DETAILED DESCRIPTION

[0022] In order to make the technical means, creative features, objectives and effects achieved by the present invention easy to understand, the present invention is further explained below with reference to specific diagrams.

[0023] Example 1

[0024] Target design and gene editing vector construction: The genetic transformation receptor material selected in the present invention is the small-grain japonica rice variety Nanjing 5055. According to the prediction on the NCBI website, the rice qGL3 gene has 21 exons and is located on the third chromosome of rice. Sequencing analysis showed that the CDS sequence of the qGL3 gene of the small-grain variety Nanjing 5055 was the same as that of Nipponbare, and no mutation occurred. Two sgRNA target sites were designed on the first exon of the qGL3 gene, and a 20bp conservative specific sequence was designed for each target site. Target 1 (sgRNA1) is located at the nucleotides 12~21bp of the qGL3 gene, and target 2 (sgRNA2) is located at 225~244bp. The target site positions and sgRNA sequences are as follows: Figure 1 shown.

[0025] According to the requirements of U3 and U6a vectors, U3-sgRNA1-F / R linker and U6a-sgRNA2-F / R linker were synthesized respectively. After preparing oligo dimers, sgRNA1 was connected to OsU3 plasmid vector, and sgRNA2 was connected to OsU6 plasmid vector. Two rounds of PCR amplification (the primer sequences used for PCR amplification include:

[0026] UF: CTCCGTTTTACCTGTGGAATCG,

[0027] sgRNA1(2)-R:CGGAGGAAAATTCCATCCAC,

[0028] B1':TTCAGAGGTCTCTCTCGACTAGTGGAATCGGGCAGCAAAGG,

[0029] B2: AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC,

[0030] B2':TTCAGAggtctcTctgaCACTGGAATCGGCAGCAAAGG,

[0031] BL: AGCGTGGGTCTCGACCGACGCGTCCATCCACTCCAAGCTC)

[0032] The DNA fragment of U3-sgRNA1-U6a-sgRNA2 was obtained and then connected to the CRISPR / Cas9 expression vector. The specific method was referred to the operation steps of (Ma et al, Molecular Plant, 2015, 8(8): 1274-1284). Finally, the editing vector pYLCRISPR / Cas9-qGL3 containing dual targets was successfully constructed. Figure 2 shown.

[0033] Example 2

[0034] Identification of transgenic rice with qGL3 gene editing and analysis of editing efficiency: The gene editing vector pYLCRISPR / Cas9-qGL3 plasmid was transformed into callus tissue of Nanjing 5055 by Agrobacterium EHA105-mediated rice transgenic method, and 20 independent T0 transformed strains were differentiated by hygromycin selection. The genetic transformation process is as follows: Agrobacterium EHA105 containing pYLCRISPR / Cas9-qGL3 plasmid was used to infect mature embryonic callus tissue of japonica rice recipient variety Nanjing 5055, and cultured in the dark at 26℃ on the co-culture medium for 3 days. The washed callus tissue was transferred to the selection medium containing hygromycin for resistance screening. The selected resistant callus was transferred to the pre-differentiation medium for 14 days, and then transferred to the differentiation medium for light culture. When the seedlings grew to 3 cm, they were transferred to the rooting medium to induce the occurrence of adventitious roots. When the seedlings grow to about 10 cm in height, the seedlings are taken out, the attached solid culture medium is washed off with sterile water, and the seedlings are moved into soil and cultivated in a greenhouse. After the plants are strong, samples are taken for leaf DNA extraction.

[0035] With Nanjing 5055 as the control, PCR detection was performed using primers hygromycin marker (Hyg-F: GCTTTTCAGCTTCGATGTAGGAG, Hyg-R: CTACACAGCCATCGGTCCAGA) and nuclease marker (Cas9-F: GATCCTTACTTTCCGTATTCCTTACTACG, Cas9-R: ATACCCTCCTCAATCCTCTTCATG), and those that could amplify specific bands were positive transgenic plants. After identification, a total of 18 positive transgenic plants were screened, with a positive rate of 90.0%. The target site adjacent sequences of qGL3-positive transformed plants were amplified and sequenced by PCR using primers qGL3seq-F / R (qGL3seq-F: GAATCCCCACGCAATTCCCAA, qGL3seq-R: AATATCCACGAGACACGACCA). It was detected that 16 of the qGL3-positive transformed plants had mutations, and the gene editing efficiency was 88.9%. However, no homozygous edited lines were identified in the T0 transgenic plants, and all the editing sites were heterozygous.

[0036] Example 3

[0037] Screening of qGL3 homozygous edited lines without transgenic components: gene editing T 0 The plant can remove the transgenic tag hygromycin resistance gene and nuclease gene in the offspring through self-exchange, thereby obtaining a safer edited plant without transgenic tags. Therefore, in order to obtain a homozygous edited strain without transgenic components, the gene editing T in Example 2 is replaced by 0 Plants are grown for generations until T 1 generations.

[0038] Extract Nanjing 5055 and T 1 The leaf DNA of the plants was used as a control, and the Hyg-F / R and Cas9-F / R markers were used to identify the transgenic components. A series of T-type lines without transgenic components were screened out in each line. 1 Plants. Then, through sequencing analysis of target sequences adjacent to plants without transgenic components, four mutations were detected in each strain, mainly fragment deletions, and plants with a large fragment deletion of 213 bp were detected, such as Figure 3 As shown, and T 1 The mutation types of the target sites are similar to those of T 0 The strains are consistent, indicating that the gene editing sites can be stably inherited between different generations.

[0039] Example 4

[0040] Grain phenotype analysis of gene-edited homozygous plants: Taking Nanjing 5055 as the control, the grain phenotype of the qGL3 homozygous edited plants obtained in Example 3 was investigated and photographed. Statistical analysis showed that the differences in the traits such as grain length, grain width, length-to-width ratio, and 1000-grain weight between Nanjing 5055 and the two edited plants reached extremely significant levels. The average grain length of the gene-edited plants was 8.58 mm, an increase of 21.1% compared with the grain length of Nanjing 5055 (7.08 mm); the average grain width was 4.01 mm, an increase of 6.9% compared with the grain width of Nanjing 5055 (3.75 mm); the average length-to-width ratio was 2.14, an increase of about 13.2% compared with the length-to-width ratio of Nanjing 5055 (1.89); the average 1000-grain weight was 29.35 g, an increase of about 29.8% compared with the 1000-grain weight of Nanjing 5055 (22.61 g), as shown in Figure 2. Figure 4 Therefore, compared with the small-grain Nanjing 5055 variety, the qGL3 gene-edited rice obtained by the present invention has significantly improved grain shape and grain weight, and has important value in the field of rice genetic breeding.

[0041] The above are only implementation modes of the present invention, and are not intended to limit the patent scope of the present invention. Any equivalent structure made using the contents of the present invention's specification and drawings, directly or indirectly used in other related technical fields, are also within the patent protection scope of the present invention.

Claims

1. A sgRNA target sequence for increasing rice grain shape, It is characterized in that It includes a sgRNA1 target site and a sgRNA2 target site, wherein the sgRNA1 target site sequence is CTCCCGCATGACGACGGAGT, and the sgRNA2 target site sequence is CAGCGCTGTGATCGAGAAGA.

2. A recombinant vector comprising the sgRNA target sequence of claim 1, It is characterized in that The basic plasmid of the recombinant vector includes CRISPR / Cas9-U3-sgRNA1-U6a-sgRNA2.

3. Use of the sgRNA target sequence according to claim 1 or the recombinant vector according to claim 2 in increasing rice grain shape.

4. Use of the sgRNA target sequence according to claim 1 or the recombinant vector according to claim 2 in editing the rice qGL3 gene.

5. Use of the sgRNA target sequence according to claim 1 or the recombinant vector according to claim 2 in editing the first exon of the rice qGL3 gene.

6. The use according to claim 4 or 5, It is characterized in that The editing includes causing one or more bases to be deleted and / or inserted and / or replaced in the coding frame of the rice qGL3 gene.

7. The use according to any one of claims 3 to 5, It is characterized in that The rice is a small-grain japonica rice variety.

Images