A sealing device for connecting amplification and detection reaction systems and a method of use

Abstract

The present invention relates to the field of molecular detection technology, and in particular to a sealing device for connecting an amplification and detection reaction system and a method for using the sealing device, the device comprising a test strip tube, an amplification tube being arranged just below the front of the test strip tube, and a test strip cavity cover being arranged at the other end of the test strip tube; the interior of the test strip tube is a hollow test strip cavity, in which a test strip is placed; the interior of the amplification tube is a hollow amplification cavity, the surface where the test strip tube and the amplification tube contact each other is an isolation layer, and the test strip cavity and the amplification cavity are separated by the isolation layer; a reaction knob is arranged on the side of the test strip tube opposite to the isolation layer, and a downward pressing portion of the reaction knob extends into the test strip cavity; a fixing knob is also arranged on the test strip tube, and a fixing head of the fixing knob extends into the test strip cavity and presses and fixes the test strip; a diluent cavity is arranged at the front end of the amplification tube, and a diluent cavity cover is arranged at the head of the diluent cavity.

Description

Technical Field

[0001] The present invention relates to the field of molecular detection technology, and specifically relates to a sealing device for connecting an amplification and detection reaction system. Background Art

[0002] Molecular detection is a technology that uses molecular biological methods to detect nucleic acid molecular fragments. To ensure the sensitivity of diagnosis, the nucleic acid will be amplified first, and the change during the amplification process or the amplification product will be detected after the amplification is completed to determine whether the sample contains the target sequence. Since the concentration of the amplification product is extremely high, it is easy to cause aerosol contamination, so molecular detection has strict requirements on laboratory conditions and operations.

[0003] In order to quickly conduct molecular detection on site, the industry has begun to develop "fully enclosed disposable molecular detection devices" that do not require rigorous laboratories and operations. One of the difficulties is that the reaction system for molecular detection is relatively small, at the level of tens of microliters, and the mixing and transfer of liquids is more troublesome. Currently, many microfluidics are used to solve this problem, but the processing difficulty and cost are relatively high. Summary of the invention

[0004] The object of the present invention is to provide a sealing device for connecting two reaction systems of amplification and detection in molecular detection and a method for using the sealing device.

[0005] To achieve the above object, the present invention provides the following technical solutions:

[0006] A sealing device for connecting an amplification and detection reaction system, comprising a test strip tube, an amplification tube is arranged just below the front of the test strip tube, and a test strip cavity cover is arranged at the other end of the test strip tube;

[0007] The interior of the test strip tube is a hollow test strip cavity, in which a test strip is placed; the interior of the amplification tube is a hollow amplification cavity, the contact surface of the test strip tube and the amplification tube is an isolation layer, and the test strip cavity and the amplification cavity are separated by the isolation layer;

[0008] A reaction knob is provided on the side of the test strip tube opposite to the isolation layer, and the pressing portion of the reaction knob extends into the test strip cavity; a fixing knob is also provided on the test strip tube, and the fixing head of the fixing knob extends into the test strip cavity and presses and fixes the test strip;

[0009] The front end of the amplification tube is provided with a diluent cavity, and the head of the diluent cavity is provided with a diluent cavity cover.

[0010] The test strip includes a bottom plate, a sample pad is bonded to the bottom plate, one end of the sample pad is exposed from the bottom plate and bonded to the free end of the bottom plate, the free end of the bottom plate is separated from the bottom plate by a certain distance, and the free end of the bottom plate can be bent after being pressed.

[0011] Among them, a reaction knob joint that is compatible with the reaction knob is provided on the test strip tube, and a protective pull ring is provided at the connection between the reaction knob and the reaction knob joint; when the protective pull ring is removed and the reaction knob is rotated, the pressing part can press down the sample pad on the test strip, thereby breaking the isolation layer so that the free end of the bottom plate and the sample pad connected to the free end of the bottom plate extend into the amplification chamber.

[0012] A pointed tip is provided at the center of the diluent chamber cover, and the pointed tip is located in the diluent chamber; a protective pull ring is provided at the connection between the diluent chamber cover and the diluent chamber; when the protective pull ring is removed and the diluent chamber cover is rotated, the pointed tip can pierce the bottom surface of the diluent chamber.

[0013] Wherein, the amplification chamber is filled with an amplification reagent; the amplification reagent is freeze-dried or dried on the amplification pad.

[0014] The bottom and sides of the amplification tube can be heated by a heater.

[0015] Wherein, the test strip tube and the amplification tube are an integrated molding structure.

[0016] The head of the test strip tube is circular, the test strip is placed into the test strip tube through the opening at the head of the test strip tube, and the head of the test strip tube is sealed by tightening the test strip cavity cover.

[0017] The head of the amplification tube is a circular amplification tube head, on which a through hole matching the cavity of the diluent cavity is provided, and the diluent cavity is covered on the amplification tube head; the diluent cavity is filled with diluent.

[0018] An alternative solution may also be adopted, in which the test strip chamber cover in the sealing device for connecting the amplification and detection reaction system is replaced with a disinfectant chamber, the end of which is provided with a disinfectant chamber cover; a conical tip is provided at the center of the disinfectant chamber cover, and the tip is located in the disinfectant chamber; the disinfectant chamber is filled with disinfectant;

[0019] A protective pull ring is provided at the connection between the disinfectant cavity cover and the disinfectant cavity; when the protective pull ring is removed and the disinfectant cavity cover is rotated, the tip can pierce the bottom surface of the disinfectant cavity.

[0020] The method for using the sealing device for connecting the amplification and detection reaction systems of the present invention is specifically as follows: adding the sample processing liquid into the amplification chamber, turning on the heating device, and starting amplification;

[0021] After the amplification is completed, the diluent chamber cover is twisted, and the diluent enters the amplification chamber. Then the reaction knob is twisted, and a part of the sample pad of the test strip contacts the amplification pad in the amplification chamber. The test strip starts to run the sample and read the result.

[0022] Compared with the prior art, the beneficial effects of the present invention are mainly:

[0023] The sealing device for connecting the amplification and detection reaction systems of the present invention facilitates liquid mixing and transfer: since the volume of the amplification system for molecular detection is generally only 25-50 μL, the transfer of conventional small-volume liquids requires careful mixing to avoid uneven mixing of reagents or liquid adhesion to the wall. The present invention places the amplification system on a pad, and when adding samples, the liquid sample naturally diffuses on the pad without the need for a stirring and mixing process. When adding diluent, the diluent also diffuses directly without adhering to the wall. In addition, using an amplification pad to connect the amplification product and the test strip also avoids the risk of reduced sensitivity due to the diluent contacting the test strip first in the event of an operational error.

[0024] The amplification tube and the test strip tube of the device of the present invention are sealed and connected, and nucleic acid amplification and rapid detection can be achieved when the entire detection device is sealed, which not only simplifies the operation process of nucleic acid detection, but also effectively prevents aerosol contamination caused by amplification products, greatly improving the convenience, safety and practicality of nucleic acid detection.

[0025] The present invention realizes the structural conversion of nucleic acid amplification and result detection by means of rotation and puncture, and the operation is simple and convenient; amplification and detection are realized in a completely closed device, and the results can be judged by naked eyes. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a schematic diagram of the overall structure of the sealing device for the connection amplification and detection reaction system of Example 1;

[0027] Figure 2 It is a cross-sectional view of the test strip tube and the amplification tube;

[0028] Figure 3 It is a schematic diagram of the structure of the test strip;

[0029] Figure 4 is the main view of the test strip;

[0030] Figure 5 It is a schematic diagram of the structure of the diluent chamber and the diluent chamber cover;

[0031] Figure 6 Another structural schematic diagram of the device of Example 1;

[0032] Figure 7 This is another structural schematic diagram of the device of Example 1;

[0033] Figure 8 This is a schematic diagram of the overall structure of the sealing device for connecting the amplification and detection reaction systems of Example 2.

[0034] Among them, 1-test strip tube, 2-amplification tube, 3-dilution liquid cavity, 4-dilution liquid cavity cover, 5-reaction knob, 6-fixed knob, 7-test strip cavity cover, 8-test strip, 9-free end of bottom plate, 10-bottom plate, 11-reaction knob joint, 12-fixed knob joint, 21-amplification cavity, 22-amplification tube head, 31-bottom surface of diluent cavity, 41-tip, 51-downward pressure part, 61-fixed head, 13-disinfectant cavity, 14-disinfectant cavity cover.

[0035] Fig. 9 It is the detection result of Example 3. DETAILED DESCRIPTION

[0036] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0037] Example 1

[0038] like Figure 1-5 As shown, a sealing device for connecting an amplification and detection reaction system comprises a test strip tube 1, an amplification tube 2 is provided just below the front of the test strip tube 1, and a test strip cavity cover 7 is provided at the other end of the test strip tube 1; the head of the test strip tube 1 is circular, a test strip 8 is placed into the test strip tube 1 through the opening of the head of the test strip tube, and the head of the test strip tube 1 is sealed by tightening the test strip cavity cover 7. The test strip tube 1 and the amplification tube 2 are an integrated structure.

[0039] The interior of the test strip tube 1 is a hollow test strip cavity, in which a test strip 8 is placed; the interior of the amplification tube 2 is a hollow amplification cavity 21, and the surfaces where the test strip tube 1 and the amplification tube 2 contact each other are an isolation layer, and the test strip cavity and the amplification cavity 21 are separated by the isolation layer. The isolation layer is very thin and can be made of plastic to ensure that it is easy to crush.

[0040] A reaction knob 5 is provided on the side of the test strip tube 1 opposite to the isolation layer, and a corresponding reaction knob connector 11 is provided on the test strip tube 1, and the reaction knob 5 is connected to the reaction knob connector 11. The pressing portion 51 of the reaction knob 5 passes through the reaction knob connector 11 and extends into the test strip cavity.

[0041] The test strip tube 1 is also provided with a fixed knob 6, and a corresponding fixed knob joint 12 is provided on the test strip tube 1, and the fixed knob 6 is connected to the fixed knob joint 12. The fixed head 61 of the fixed knob 6 passes through the fixed knob joint 12 and extends into the test strip cavity, and presses and fixes the gold pad sample pad part of the test strip 8.

[0042] The front end of the amplification tube 2 is provided with a diluent chamber 3 , and the head of the diluent chamber 3 is provided with a diluent chamber cover 4 .

[0043] The test strip 8 includes a bottom plate 10, on which a sample pad is bonded, one end of which is exposed from the bottom plate 10 and bonded to the bottom plate free end 9, the bottom plate free end 9 is separated from the bottom plate 10 by a certain distance, and the bottom plate free end 9 can be bent after being pressed. The bottom plate 10 is made of a transparent material. In other embodiments, it can also be made opaque, so that the result can be viewed from the bottom.

[0044] A protective pull ring is provided at the connection between the reaction knob 5 and the reaction knob connector 11 to ensure that the reaction knob will not be rotated by mistake. When the protective pull ring is removed and the reaction knob 5 is rotated, the pressing portion 51 can press down the sample pad on the test strip 8, thereby breaking the isolation layer so that the bottom plate free end 9 and the sample pad connected to the bottom plate free end 9 extend into the amplification chamber 21. Before, during and after rotation, the reaction knob 5 and the reaction knob connector 11 are always sealed.

[0045] A conical tip 41 is provided at the center of the diluent chamber cover 4, and the tip 41 is located in the diluent chamber 3; a protective pull ring is provided at the connection between the diluent chamber cover 4 and the diluent chamber 3; when the protective pull ring is removed and the diluent chamber cover 4 is rotated, the tip 41 can pierce the bottom surface 31 of the diluent chamber. The bottom surface 31 of the diluent chamber is generally made of thin plastic that is integrally formed to ensure easy piercing.

[0046] The amplification chamber 21 is filled with an amplification reagent, which is freeze-dried or dried on a flat amplification pad. The bottom and side of the amplification tube 2 can be heated by a heater.

[0047] The head of the amplification tube 2 is a circular amplification tube head 22, and a through hole that is adapted to the shape and size of the dilution chamber 3 is opened on the amplification tube head 22. The dilution chamber 3 is covered on the amplification tube head 22, and the cavity of the dilution chamber 3 extends into the amplification tube head 22; the dilution chamber 3 is filled with diluent.

[0048] In this embodiment, the test strip tube 1 and the amplification tube 2 are generally straight-lined. In other beneficial embodiments, the two may be connected at different angles, such as Figure 6-7As shown, it is only necessary to ensure that the pressing portion of the reaction knob can press down the sample pad on the test strip, thereby breaking the isolation layer so that the sample pad extends into the amplification chamber.

[0049] The method of using the device is as follows:

[0050] Add the sample processing solution into the amplification chamber, turn on the heating device, and start amplification;

[0051] After the amplification is completed, the diluent chamber cover is twisted, and the diluent enters the amplification chamber. Then the reaction knob is twisted, and a part of the sample pad of the test strip contacts the amplification pad in the amplification chamber. The test strip starts to run the sample and read the result.

[0052] Example 2

[0053] A sealing device for connecting amplification and detection reaction systems, such as Figure 8 As shown, compared with Example 1, the main structural difference is that the test strip chamber cover 7 is replaced by a disinfectant chamber 13, and a disinfectant chamber cover 14 is installed at the end of the disinfectant chamber 13. A conical tip is provided at the center of the disinfectant chamber cover 14, and the tip is located in the disinfectant chamber 13. The disinfectant chamber 13 is filled with disinfectant.

[0054] Similar to the diluent chamber, a protective pull ring is provided at the connection between the disinfectant chamber cover 14 and the disinfectant chamber 13; when the protective pull ring is removed and the disinfectant chamber cover 14 is rotated, the tip can pierce the bottom surface of the disinfectant chamber.

[0055] This structure can be used to inject disinfectant into the test strip tube after the reaction is completed to inactivate all reaction products.

[0056] Example 3

[0057] The sealing device for connecting the amplification and detection reaction system of Example 1 was used to carry out an amplification and detection experiment. The specific experimental process is as follows.

[0058] (1) Amplify the novel coronavirus N gene (sequence shown in SEQ ID NO: 1) using the following primers:

[0059] The length of the amplified fragment is 213 bp, as shown in SEQ ID NO:2.

[0060] Primers Sequence (5' to 3') (as shown in SEQ ID NO: 3-8) Marking situation F3 agatcacattggcacccg B3 ccattgccagccattctagc FIP tgctcccttctgcgtagaagccaatgctgcaatcgtgctac 5'Fluorescein FAM BIP ggcggcagtcaagcctcttccctactgctgcctggagtt LF gcaatgttgttccttgaggaagtt 5' Biotin LB gttcctcatcacgtagtcgcaaca

[0061] (2) Preparation of reaction pad

[0062] A. Preparation of Amplification Pad Treatment Solution

[0063]

[0064]

[0065] B. Amplification pad treatment: The pad is Ahlstrom 8962 glass fiber pad, cut into 7×7 mm size, add 50 μl of treatment solution to each piece, then bake at 37°C for 4 hours to dry, dry and seal for later use.

[0066] C. Assemble the device, place the amplification pad into the amplification chamber of the device, and close the amplification chamber cover. Place the universal nucleic acid test strip (Fam / Biotin) into the test strip tube through the opening at the head of the test strip tube, tighten the fixing knob to fix the test strip, and tighten the test strip chamber cover.

[0067] D. Use of the device: Prepare the new coronavirus pseudovirus standard prepared with the sample treatment solution into 100, 200, 500, 1000, 2000, 5000 copies / mL, and take 50ul of the sample treatment solution as a negative control, add it to the amplification pad, and cover it. Place the device on the heater to maintain the temperature in the amplification tube at 60-65℃. After reacting for 20 minutes, pull open the protective ring of the rotating diluent chamber cover and tighten it to allow the diluent to enter the amplification tube. Then pull open the reaction knob protective ring and tighten it to allow the free end of the test strip to contact the amplification pad. The reaction solution begins to run on the test strip, and the results are checked with the naked eye after 5 minutes.

[0068] Test results such as Fig. 9 As shown, it can be seen that the detection limit is 500 copies / mL.

[0069] It can be seen that the sealing device for connecting the amplification and detection reaction systems of the present invention realizes the structural conversion of nucleic acid amplification and result detection by rotation and puncture, and the operation is simple; amplification and detection are realized in a completely closed device, and the results can be judged by naked eyes.

[0070] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents. Sequence Listing <110> Gu'an Beiji Biotechnology Co., Ltd. <120> A sealing device for connecting amplification and detection reaction systems and a method of use <160> 8 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1260 <212> DNA <213> Artificial Sequence <400> 1 atgtctgata atggacccca aaatcagcga atgcacccc gcattacgtt tggtggaccc 60 tcagattca ctggcagtaa ccagaatgga gaacgcagtg gggcgcgatc aaaacaacgt 120 cggccccaag gtttaccca taatactgcg tctggttca ccgctcac tcacatggc 180 aaggaagacc ttaaattccc tcgaggacaa ggcgttccaa ttaacaccaa tagcagtcca 240 gatgaccaaa ttggctacta ccgaagagct accagacgaa ttcgtggtgg tgacggtaaa 300 atgaaagatc tcagtccaag atggtatttc tactacctag gaactgggcc agaagctgga 360 cttccctatg gtgctaacaa agacggcatc atatgggttg cAactgaggg agccttgaat 420 acaccaaaag atcacattgg cacccgcaat cctgctaaca atgctgcaat cgtgctacaa 480 cttcctcaag gaacacatt gccaaaaggc ttctacgcag aagggagcag aggcggcagt 540 caagccctt ctcgttcctc atcacgtagt cgcaacagtt caagaattc aactccaggc 600 agcagtaggg gaacttctcc tgctagaatg gctggcaatg gcggtgatgc tgctcttgct 660 ttgctgctgc ttgacagatt gaaccagctt gagagcaaaa tgtctggtaa aggccaacaa 720 caacaaggcc aaactgtcac taagaaatct gctgctgagg cttctaagaa gcctcggcaa 780 caacaaggcc aaactgtcac taagaaatct gctgctgagg cttctaagaa gcctcggcaa 780 aaacgtactg ccactaaagc atacaatgta acacaagctt tcggcagacg tggtccagaa 840 aaacgtactg ccactaaagc atacaatgta acacaagctt tcggcagacg tggtccagaa 840 caaacccaag gaaattttgg ggaccaggaa ctaatcagac aaggaactga ttacaaacat 900 caaacccaag gaaattttgg ggaccaggaa ctaatcagac aaggaactga ttacaaacat 900 tggccgcaaa ttgcacaatt tgcccccagc gcttcagcgt tcttcggaat gtcgcgcatt 960 tggccgcaaa ttgcacaatt tgcccccagc gcttcagcgt tcttcggaat gtcgcgcatt 960 ggcatggaag tcacaccttc gggaacgtgg ttgacctaca caggtgccat caaattggat 1020 ggcatggaag tcacaccttc gggaacgtgg ttgacctaca caggtgccat caaattggat 1020 gacaaagatc caaatttcaa agatcaagtc attttgctga ataagcatat tgacgcatac 1080 gacaaagatc caaatttcaa agatcaagtc attttgctga ataagcatat tgacgcatac 1080 aaaacattcc caccaacaga gcctaaaaag gacaaaaaga agaaggctga tgaaactcaa 1140 aaaacattcc caccaacaga gcctaaaaag gacaaaaaga agaaggctga tgaaactcaa 1140 gccttaccgc agagacagaa gaaacagcaa actgtgactc ttcttcctgc tgcagatttg 1200 gccttaccgc agagacagaa gaaacagcaa actgtgactc ttcttcctgc tgcagatttg 1200 gatgatttct ccaaacaatt gcaacaatcc atgagcagtg ctgactcaac tcaggcctaa 1260 gatgatttct ccaaacaatt gcaacaatcc atgagcagtg ctgactcaac tcaggcctaa 1260 <210> 2<210> 2 <211> 213<211> 213 <212> DNA<212> DNA <213> Artificial Sequence<213> Artificial Sequence <400> 2 <400> 2 agatcacatt ggcacccgca atcctgctaa caatgctgca atcgtgctac aacttcctca 60 agatcacatt ggcacccgca atcctgctaa caatgctgca atcgtgctac aacttcctca 60 aggaacaaca ttgccaaaag gcttctacgc agaagggagc agaggcggca gtcaagcctc 120 ttctcgttcc tcatcacgta gtcgcaacag ttcaagaaat tcaactccag gcagcagtag 180 gggaacttct cctgctagaa tggctggcaa tgg 213 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <400> 3 agatcacatt ggcacccg 18 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 ccattgccag ccattctagc 20 <210> 5 <211> 41 <212> DNA <213> Artificial Sequence <400> 5 tgctcccttc tgcgtagaag ccaatgctgc aatcgtgcta c 41 <210> 6 <211> 39 <212> DNA <213> Artificial Sequence <400> 6 ggcggcagtc aagcctcttc cctactgctg cctggagtt 39 <210> 7 <211> twenty four <212> DNA <213> Artificial Sequence <400> 7 gcaatgttgt tccttgagga agtt 24 <210> 8 <211> twenty four <212> DNA <213> Artificial Sequence <400> 8 gttcctcatc acgtagtcgc aaca 24

Claims

1. A sealing device for connecting an amplification and detection reaction system, characterized in that: It comprises a test strip tube (1), wherein an amplification tube (2) is provided just below the front of the test strip tube (1), and a test strip cavity cover (7) is provided at the other end of the test strip tube (1); The interior of the test strip tube (1) is a hollow test strip cavity, in which a test strip (8) is placed; the interior of the amplification tube (2) is a hollow amplification cavity (21); the surfaces where the test strip tube (1) and the amplification tube (2) contact each other are an isolation layer, and the test strip cavity and the amplification cavity (21) are separated by the isolation layer; A reaction knob (5) is provided on the side of the test strip tube (1) opposite to the isolation layer, and a pressing portion (51) of the reaction knob (5) extends into the test strip cavity; a fixing knob (6) is also provided on the test strip tube (1), and a fixing head (61) of the fixing knob (6) extends into the test strip cavity and presses and fixes the test strip (8); The front end of the amplification tube (2) is provided with a diluent chamber (3), and the head of the diluent chamber (3) is provided with a diluent chamber cover (4); The head of the test strip tube (1) is circular, and the head of the test strip tube (1) is sealed by tightening the test strip cavity cover (7); The test strip (8) comprises a bottom plate (10), a sample pad is bonded to the bottom plate (10), one end of the sample pad is exposed from the bottom plate (10) and bonded to a free end (9) of the bottom plate, the free end (9) of the bottom plate is spaced a certain distance from the bottom plate (10), and the free end (9) of the bottom plate can be bent after being pressed; The test strip tube (1) is provided with a reaction knob connector (11) adapted to the reaction knob (5), and a protective pull ring is provided at the connection between the reaction knob (5) and the reaction knob connector (11); When the protective pull ring is removed and the reaction knob (5) is rotated, the pressing portion (51) can press down the sample pad on the test strip (8), thereby breaking the isolation layer so that the bottom plate free end (9) and the sample pad connected to the bottom plate free end (9) extend into the amplification chamber (21); A tip (41) is provided at the center of the diluent chamber cover (4), and the tip (41) is located in the diluent chamber (3); a protective pull ring is provided at the connection between the diluent chamber cover (4) and the diluent chamber (3); When the protective pull ring is removed and the diluent chamber cover (4) is rotated, the tip (41) can pierce the bottom surface (31) of the diluent chamber.

2. The sealing device for connecting an amplification and detection reaction system according to claim 1, characterized in that: The amplification chamber (21) contains an amplification reagent; the amplification reagent is freeze-dried or dried on the amplification pad.

3. The sealing device for connecting an amplification and detection reaction system according to claim 1, characterized in that: The bottom and side surfaces of the amplification tube (2) can be heated by a heater.

4. The sealing device for connecting an amplification and detection reaction system according to claim 1, characterized in that: The test strip tube (1) and the amplification tube (2) are an integrated structure.

5. The sealing device for connecting an amplification and detection reaction system according to claim 1, characterized in that: The head of the amplification tube (2) is a circular amplification tube head (22), and a through hole matching the cavity of the diluent cavity (3) is provided on the amplification tube head (22). The diluent cavity (3) covers the amplification tube head (22); the diluent cavity (3) is filled with diluent.

6. A sealing device for connecting an amplification and detection reaction system, characterized in that: The test strip chamber cover (7) in the sealing device described in any one of claims 1 to 5 is replaced with a disinfectant chamber (13), the end of the disinfectant chamber (13) is provided with a disinfectant chamber cover (14); a conical tip is provided at the center of the disinfectant chamber cover (14), and the tip is located in the disinfectant chamber (13); the disinfectant chamber (13) is filled with disinfectant; A protective pull ring is provided at the connection between the disinfectant liquid chamber cover (14) and the disinfectant liquid chamber (13); when the protective pull ring is removed and the disinfectant liquid chamber cover (14) is rotated, the tip can pierce the bottom surface of the disinfectant liquid chamber.

7. A method for using the sealing device for connecting an amplification and detection reaction system according to any one of claims 1 to 6, characterized in that: Add the sample processing solution into the amplification chamber, turn on the heating device, and start amplification; After the amplification is completed, the diluent chamber cover is twisted, and the diluent enters the amplification chamber. Then the reaction knob is twisted, and a part of the sample pad of the test strip contacts the amplification pad in the amplification chamber. The test strip starts to run the sample and read the result.

Images