A detection method for Photobacterium mermaniformis subspecies

Abstract

The invention provides a method for detecting the mermaid luminescent bacillus mermaid subspecies, comprising extracting DNA from a single colony of the mermaid luminescent bacillus mermaid subspecies or extracting DNA from a fish tissue to be detected, and designing specific primers based on the subspecies level, taking the DNA of the sample to be detected as a template, performing PCR amplification detection through an upstream primer P1 and a downstream primer P2 pair, and performing electrophoresis analysis. The invention can accurately distinguish the mermaid luminescent bacillus mermaid subspecies and the piscivorous subspecies in clinical practice, and has high application value in aquaculture.

Description

Technical Field

[0001] The present invention relates to the field of biological detection, and in particular to a detection method for Photobacterium mermaniformis subspecies. Background Art

[0002] Photobacterium damselae is divided into two subspecies, namely P. damselae subsp. damselae (PDD) and P. damselae subsp. piscicida (PDP), both of which are Gram-negative pathogens widely distributed in the marine environment.

[0003] The mermaid subspecies of Photorhabdus mermaidus infects a variety of host species, including crustaceans, fish, mammals and even humans, such as causing crustacean sarcoidosis, causing necrotizing fasciitis in fish, causing multiple organ failure, causing hemorrhagic disease, etc. However, the mermaid subspecies of Photorhabdus mermaidus, according to current reports, only infects fish. The homology of these two subspecies of Photorhabdus mermaidus is very strong. The housekeeping genes gyrB, toxR and ompU cannot accurately distinguish the two subspecies. Even the 16srRNA sequences of the two differ by only one base, and the DNA-DNA hybridization similarity reaches 80%, which increases the difficulty of identifying the mermaid subspecies. There are literature reports that the two subspecies differ in certain biochemical indicators. For example, the positive reactions of arginine dihydrogenase and methyl red, nitrate reduction reactions, and the production of blood glucose enzymes can all distinguish between the mermaid judge bacteria mermaid subspecies and the fish-killing subspecies, but these physiological and biochemical characteristics vary in different strains and are extremely unstable as identification indicators; there are also literature reports that flight mass spectrometry is used to distinguish the subspecies, but this method is time-consuming and labor-intensive, and has very high requirements for instruments; there are also reports that urease genes are used as targets to distinguish the two subspecies, but some mermaid photobacterium fish-killing subspecies also have urease genes, resulting in low differentiation. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a method for detecting the mermaid subspecies of Photorhabditis elegans, so as to solve the problems of unstable detection and low discrimination of the current conventional methods.

[0005] In order to solve the above problems, the present invention provides a method for detecting Photorhabditis mermani subspecies, comprising the following steps:

[0006] S1: Extract DNA from the sample to be tested;

[0007] S2: Based on the cyclic di-GMP phosphodiesterase gene sequence of Photorhabditis mermani subspecies as the detection target sequence, a pair of species-specific primers P1 and P2 were designed based on the interspecies and inter-subspecies variation regions. The sequences of P1 and P2 are as follows:

[0008] Upstream primer P1: 5'TTGTACTATTTTTAACAAACTTGGCTA 3',

[0009] Downstream primer P2: 5′CCTAATGTTTGTAAGCGAGTTAGCG 3′;

[0010] S3: Using the DNA of the sample to be tested as a template, real-time fluorescence PCR amplification detection is performed through the upstream primer P1 and the downstream primer P2, and electrophoresis analysis is performed to complete the identification.

[0011] As a preferred solution, in step S1, extracting DNA from the sample to be tested includes extracting DNA from a single colony of Photorhabditis elegans subspecies or extracting DNA from the tissue of the fish to be tested.

[0012] As a preferred scheme, the extraction of DNA from a single colony of Photorhabdus mermani subspecies includes the following steps: picking a single colony of Photorhabdus mermani subspecies into a liquid culture medium for shaking culture overnight, removing the supernatant and adding water to mix, continuing centrifugation, removing the supernatant again and adding water to obtain a mixed solution, placing the mixed solution in a boiling water water bath for heating for 3-7 minutes and then taking it out, centrifuging it again and taking the supernatant, wherein the supernatant is the Photorhabdus mermani subspecies DNA extract.

[0013] As a preferred solution, the extraction of DNA from the fish tissue to be tested includes the following steps: taking the tissue to be tested, lysing and centrifuging it, extracting the precipitate and dissolving it in sterile water to obtain the mermaid subspecies DNA.

[0014] As a preferred solution, in step S3, the reaction system of the PCR amplification detection is: 2×TaqMasterMix 12.5μl, template DNA 1μl, ddH 2 O 9.5 μl, 1 μl each of 10 μM upstream and downstream primers.

[0015] As a preferred solution, in step S3, the reaction conditions of the PCR amplification detection are: denaturation at 94°C for 2 min; 94°C for 30 s, 54°C for 30 s, 72°C for 30 s, 35 cycles; and extension at 72°C for 2 min.

[0016] As a preferred solution, in step S3, the electrophoresis analysis specifically includes: performing agarose gel electrophoresis detection on the PCR product, and tissues with visible bands are infected with Photorhabditis elegans subspecies, otherwise tissues are not infected with Photorhabditis elegans subspecies.

[0017] The invention determines a sequence encoded by the cyclic di-GMPphosphodiesterase Gmr gene by multiple whole genome comparison technology, takes the sequence as a PCR target, and designs a pair of primers in a region that is conserved in different strains of Photobacterium mermaniformis subspecies and has variations when compared with Photobacterium mermaniformis piscicidal subspecies. The primers are tested to have high sensitivity and specificity for different strains of PDD. In addition, by optimizing various experimental conditions, the designed primers can directly detect infected fish tissues, thereby achieving the purpose of simple, rapid and specific detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The figure is the detection result of Photobacterium mermani subspecies and fish killer subspecies and other bacteria using specific primer Gmr; wherein, 1 is the PDD standard strain, 2 and 3 are PDD isolates, 4 is the PDP standard strain, 5 and 6 are PDP isolates, 7-11 are Vibrio parahaemolyticus, Vibrio alginolyticus, Staphylococcus aureus, Vibrio harveyi, and Escherichia coli, respectively;

[0019] Figure 2 The figure is the detection result of single colonies of Photobacterium mermani subspecies and single colonies of non-Photobacterium mermani subspecies using specific primer Gmr; wherein, A1, A2, A3 are single colonies of PDD standard strain, A4, A5, A6 are single colonies of PDD isolate 1, A7, A8, A9 are single colonies of PDD isolate 2, B1, B2, B3 are single colonies of PDP standard strain, B4, B5, B6 are single colonies of PDP isolate 1, B7, B8, B9 are single colonies of PDP isolate 2;

[0020] Figure 3 This is the PCR amplification diagram of the colony gradient DNA using the specific primer Gmr; 1 to 8 are the concentrations of the strains after the concentration gradient decreased by 10 times, and the initial concentration is 177.54ng / μl;

[0021] Figure 4 It is the specific amplification diagram of PCR of fish tissues infected with Photorhabditis elegans subspecies using specific primer Gmr; among them, 1 is the PDD standard strain, 2, 3, 4 are the liver, spleen, and kidney of silver pomfret infected with PDD, and 5, 6, and 7 are the liver, spleen, and kidney of silver pomfret not infected with PDD. DETAILED DESCRIPTION

[0022] The technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0023] The present invention provides a method for detecting Photobacterium mermaniformis subspecies mermaid, comprising the following steps:

[0024] S1: Extract DNA from the sample to be tested;

[0025] S2: Based on the cyclic di-GMP phosphodiesterase gene sequence of Photorhabditis mermani subspecies as the detection target sequence, a pair of species-specific primers P1 and P2 were designed based on the interspecies and inter-subspecies variation regions. The sequences of P1 and P2 are as follows:

[0026] Upstream primer P1: 5'TTGTACTATTTTTAACAAACTTGGCTA 3',

[0027] Downstream primer P2: 5′CCTAATGTTTGTAAGCGAGTTAGCG 3′;

[0028] S3: Using the DNA of the sample to be tested as a template, real-time fluorescence PCR amplification detection is performed through the upstream primer P1 and the downstream primer P2, and electrophoresis analysis is performed to complete the identification.

[0029] Preferably, in step S1, extracting DNA from the sample to be tested includes extracting DNA from a single colony of Photorhabditis elegans subspecies or extracting DNA from tissues of fish to be tested.

[0030] Preferably, the method of extracting DNA from a single colony of Photorhabdus mermani subspecies comprises the following steps: picking a single colony of Photorhabdus mermani subspecies into a liquid culture medium for shaking culture overnight, removing the supernatant, adding water to mix, continuing centrifugation, removing the supernatant again, adding water to obtain a mixed solution, placing the mixed solution in a boiling water water bath for heating for 3-7 minutes, taking out the mixed solution, centrifuging again and obtaining the supernatant, wherein the supernatant is the Photorhabdus mermani subspecies DNA extract.

[0031] Preferably, the method of extracting DNA from the fish tissue to be tested comprises the following steps: taking the tissue to be tested, performing lysis and centrifugation, extracting the precipitate and dissolving it in sterile water to obtain the mermaid subspecies DNA.

[0032] Preferably, in step S3, the reaction system of the PCR amplification detection is: 2×Taq MasterMix 12.5 μl, template DNA 1 μl, ddH 2 O 9.5 μl, 1 μl each of 10 μM upstream and downstream primers.

[0033] Preferably, in step S3, the reaction conditions of the PCR amplification detection are: denaturation at 94°C for 2 min; 94°C for 30 s, 54°C for 30 s, 72°C for 30 s, 35 cycles; and extension at 72°C for 2 min.

[0034] Preferably, in step S3, the electrophoresis analysis specifically includes: performing agarose gel electrophoresis detection on the PCR product, and tissues with visible bands are infected by Photobacterium mermani subspecies mermaid, otherwise tissues are not infected by Photobacterium mermani subspecies mermaid.

[0035] The above scheme of the present invention is described in more detail below in combination with specific data:

[0036] The present invention provides a method for extracting Photobacterium mermaniformis subspecies, comprising extracting DNA from a single colony of Photobacterium mermaniformis subspecies or extracting DNA from a fish tissue to be tested:

[0037] Extraction of Photobacterium mermanii subspecies DNA from single colonies of the mermaid subspecies:

[0038] Pick a single colony into an EP tube with liquid culture medium and culture overnight on a shaking table. Centrifuge at 10,000 g for 5 min, discard the supernatant, add 200 μl dd H2O, pipette evenly, centrifuge at 10,000 g for 5 min, discard the supernatant, add 200 μl dd H2O, boil in boiling water at constant temperature for 5 min, take out immediately, centrifuge at 10,000 g for 8 min, take the supernatant, which is the DNA extraction solution, and store at -20°C for later use.

[0039] Extraction of Photobacterium mermaniformis subspecies DNA from the fish tissue to be tested:

[0040] Take about 30 mg of liver, spleen, and kidney tissue blocks, cut them into pieces, add 200 μl of tissue lysis buffer (20 mM Tris-HCl, 5 mM EDTANa 2, 400mM NaCl, 1% SDS, pH 8.0), and add proteinase K with a final concentration of 100μg / ml, and lyse in a water bath at 50-55℃ for 2 hours. During the lysis process, shake it intermittently to make it fully lysed. After the lysis is completed, centrifuge for 5min (12000g) and take the supernatant, add an equal volume of phenol-chloroform-isoamyl alcohol (25:24:1) and mix well, centrifuge at 10000g for 5min, and take the supernatant; add 2 times the volume of anhydrous ethanol to the supernatant and mix well, ice bath for 15min, centrifuge at 10000g for 5min, dissolve the precipitate in 20μl sterile water to obtain the DNA extraction solution, and store at -20℃ for later use.

[0041] Detection of Photobacterium mermaniformis subspecies, Photobacterium piscicidalis subspecies and other bacteria by colony PCR:

[0042] Take one standard strain and two isolates of Photobacterium mermani subspecies Mermaid, one standard strain and two isolates of Photobacterium mermani subspecies Ichthyococcus, and other bacterial standard strains including Escherichia coli, Staphylococcus aureus, Vibrio parahaemolyticus, Vibrio harveyi, and Vibrio alginolyticus standard strains, respectively, and inoculate them into TSA solid medium (Photobacterium mermani subspecies Mermaid, Photobacterium mermani subspecies Ichthyococcus, Staphylococcus aureus, Escherichia coli) or TCBS solid medium (Vibrio harveyi, Vibrio alginolyticus, Vibrio parahaemolyticus) by plate streaking method, and culture at 28°C for 24 to 48 hours. Pick a single colony and inoculate it into 1.5 ml TSB liquid medium, shake and culture at 28°C for 18-24 hours, and extract the genomic DNA of the above bacteria by the method of extracting Photobacterium mermani subspecies DNA from the single colony of the above-mentioned Mermaid subspecies.

[0043] The results were obtained by PCR amplification and gel electrophoresis, as shown in the attached Figure 1 As shown, it shows that Gmr has specificity.

[0044] The specific primer Gmr was used to perform PCR amplification of the colony gradient DNA. The PDD standard strain frozen at -80°C was inoculated into TSA solid culture medium by streak separation method and cultured at 28°C for 48 hours. A single colony of the standard strain was picked and mixed thoroughly with 100 μl of sterile double distilled water. It was then diluted tenfold in sequence to 10-7 times. Then 30 μl was taken for each dilution and the DNA was extracted using the above-mentioned method for extracting genomic DNA of Photobacterium mermani subspecies.

[0045] As attached Figure 3 As shown, the minimum concentration of DNA template amplified by primer Gmr is 1.78×10-1ng / μl.

[0046] The specific primer Gmr was used to detect single colonies of Photobacterium mermaniformis subspecies and single colonies of non-Photobacterium mermaniformis subspecies. Figure 2 As shown; among them, A1, A2, and A3 are single colonies of the PDD standard strain, A4, A5, and A6 are single colonies of the PDD isolate 1, A7, A8, and A9 are single colonies of the PDD isolate 2, B1, B2, and B3 are single colonies of the PDP standard strain, B4, B5, and B6 are single colonies of the PDP isolate 1, and B7, B8, and B9 are single colonies of the PDP isolate 2.

[0047] The PCR method was used to detect the silver pomfret tissues infected with Photorhabditis mermani subspecies and the silver pomfret tissues not infected with Photorhabditis mermani subspecies:

[0048] The PCR method was used to extract the luminescent bacillus mermaid subspecies DNA from the above-mentioned fish tissues to be tested. The PCR conditions were as follows: the PCR reaction system (25 μl) included 2×Taq MasterMix 12.5 μl, primer P1 (concentration of 10 μM) (5'TTGTACTATTTTTAACAAACTTGGCTA 3') 1 μl, primer (concentration of 10 μM) P2 (5'CCTAATGTTTGTAAGCGAGTTAGCG 3') 1 μl, template DNA 1 μl, ddH2O 9.5 μl. The PCR reaction conditions were: denaturation at 94°C for 2 min; 94°C for 30 s, 54°C for 30 s, 72°C for 30 s, 35 cycles; extension at 72°C for 2 min.

[0049] The primer Gmr was found to be able to quickly detect diseased fish infected with Photobacterium mermani subspecies, as shown in the attached Figure 4 shown.

[0050] The above examples further demonstrate that the identification method of the present invention optimizes various experimental conditions so that the designed primers can directly detect infected fish tissues, thereby achieving the purpose of simple, rapid and specific detection.

[0051] Although the disclosure is disclosed as above, the protection scope of the disclosure is not limited thereto. Those skilled in the art can make various changes and modifications without departing from the spirit and scope of the disclosure, and these changes and modifications will fall within the protection scope of the present invention.

Claims

1. A method for detecting Photorhabditis mermaniformis subspecies, the method not being aimed at diagnosing or treating a disease, characterized in that: The following steps are involved: S1: Extract DNA from the sample to be tested; S2: Based on the cyclic di-GMP phosphodiesterase gene sequence of Photorhabditis mermani subspecies as the detection target sequence, a pair of species-specific primers P1 and P2 were designed based on the interspecies and inter-subspecies variation regions. The sequences of P1 and P2 are as follows: upstream primer P1: 5'TTGTACTATTTTTAACAAACTTGGCTA3', downstream primer P2: 5'CCTAATGTTTGTAAGCGAGTTAGCG 3'; S3: Using the DNA of the sample to be tested as a template, real-time fluorescence PCR amplification detection is performed through the upstream primer P1 and the downstream primer P2, and electrophoresis analysis is performed to complete the identification.

2. The method for detecting Photorhabditis mermani subspecies according to claim 1, characterized in that: In the step S1, extracting DNA from the sample to be tested includes extracting DNA from a single colony of Photorhabditis elegans subspecies.

3. The method for detecting Photobacterium mermaniformis subspecies according to claim 2, characterized in that: The method for extracting DNA from a single colony of Photobacterium mermaniformis subspecies comprises the following steps: picking a single colony of Photobacterium mermaniformis subspecies to be placed in a liquid culture medium for shaking culture overnight, removing the supernatant, adding water to mix, continuing centrifugation, removing the supernatant again, adding water to obtain a mixed solution, placing the mixed solution in a boiling water water bath for heating for 3-7 minutes, taking it out, centrifuging it again, and taking the supernatant, wherein the supernatant is the Photobacterium mermaniformis subspecies DNA extract.

4. The method for detecting Photorhabditis mermani subspecies according to claim 1, characterized in that: In step S3, the reaction system of the PCR amplification detection is: 12.5 μl of 2×Taq Master Mix, 1 μl of template DNA, 9.5 μl of ddH2O, and 1 μl of each of 10 μM upstream and downstream primers.

5. The method for detecting Photorhabditis mermani subspecies according to claim 1, characterized in that: In step S3, the reaction conditions of the PCR amplification detection are: denaturation at 94°C for 2 min; 94°C for 30 s, 54°C for 30 s, 72°C for 30 s, 35 cycles; and extension at 72°C for 2 min.

Images