Method and device for generating DNA storage encoding and decoding rules and DNA storage encoding and decoding method and device

Abstract

The present application provides a method, device and DNA storage coding and decoding method for generating DNA storage coding and decoding rules, wherein the method for generating DNA storage coding and decoding rules includes: setting a sliding window (n, k) of DNA storage coding and decoding rules; based on the length n of the sliding window, obtaining a full set of sequences, using restrictions, screening out a qualified sequence set that meets the restrictions in the full set of sequences, wherein the restrictions are set according to the sequence characteristics in the full set of sequences; connecting the sequences in the qualified sequence set by means of a directed graph; deleting nodes in the directed graph whose out-degree number is less than the set out-degree number limit; deleting the redundant out-degree of each node in the directed graph; obtaining an algorithm graph, which includes DNA storage coding and decoding rules. The present invention can solve the problem of extreme GC or special motifs that cannot be completely avoided by existing fixed rules.

Description

Technical Field

[0001] The present invention relates to the field of information storage technology, and in particular to a method and device for generating DNA storage encoding and decoding rules and a DNA storage encoding and decoding method and device. Background Art

[0002] With the development of modern technology, especially the Internet, the amount of data in the world is increasing exponentially. The ever-increasing amount of data places higher and higher demands on storage technology. Traditional storage technologies, such as magnetic tape and optical disc storage, are increasingly unable to meet current data needs due to their limited storage density and time. In recent years, the development of DNA storage technology has provided a new way to solve these problems. Compared with traditional storage media, DNA as a medium for information storage has the advantages of long storage time (up to thousands of years, more than a hundred times that of existing magnetic tape and optical disc media), high storage density (up to about 10 9 Gb / mm 3 , which is more than 10 million times the existing tape and CD media) and has the advantages of good storage security.

[0003] like Figure 1 As shown, DNA storage generally includes the following steps: 1) Encoding: Converting the binary 0 / 1 code of computer information into DNA sequence information of A / T / C / G; 2) Synthesis: Using DNA synthesis technology to synthesize the corresponding DNA sequence, and storing the obtained DNA molecules in an in vitro medium or living cells; 3) Sequencing: Using sequencing technology to read the DNA sequence of the stored DNA molecules; 4) Decoding: Using the method corresponding to the encoding process in step 1, convert the sequenced DNA sequence into a binary 0 / 1 code, and further convert it into computer information. In order to achieve effective DNA data storage, it is necessary to develop technologies for the above steps. Among them, the encoding and decoding technologies involved in steps 1 and 4 are the most critical technologies for DNA data storage. The most critical part of this technology is: 1) How to maximize the density of DNA encoding 0 / 1 binary information. The improvement of DNA storage density is crucial to saving the synthesis cost of DNA for storing information in step 2. 2) When 0 / 1 binary information is converted into A / T / C / G sequence, single base repetition, high GC and high AT between sequences are avoided to the greatest extent. Generally speaking, the presence of continuous single-base repeats, high GC or high AT in the DNA sequence will make it difficult to read the sequence information during the sequencing process. The way the binary 0 / 1 data is converted to the A / T / C / G DNA sequence directly determines the difficulty of interpreting the DNA sequence during the sequencing process, thereby determining the fidelity of the data during the reading process.

[0004] At present, the third generation sequencing, i.e. single molecule sequencing, has been increasingly favored by the sequencing industry, with PacBio's SMRT and ONT's Nanopore technology being the most mature of the third generation sequencing technologies. Although the third generation sequencing technology has the advantage of fast sequencing speed compared with the second generation high throughput sequencing technology, its high error rate is one of the important bottlenecks that inhibit its widespread application. The accuracy of the third generation sequencing can be greatly improved by artificially designing the sequence, such as controlling its GC content and removing special motifs. And for DNA storage to achieve instant and fast reading, the third generation sequencing must be used. Therefore, it is necessary to design a DNA sequence whose encoding technology can meet any restriction conditions.

[0005] The existing DNA storage encoding and decoding algorithms, the classic methods include various algorithms proposed by Church, Goldman, Grass, Erlich and others. The existing algorithms focus on improving the encoding density, or avoiding extreme GC content, or avoiding continuous single base repetitions, etc. However, these algorithms cannot completely avoid extreme GC or special motifs due to their fixed rules. When using third-generation sequencing for sequencing decoding, a lot of computing time is required for error correction. Summary of the invention

[0006] The purpose of the present invention is to provide a method and device for generating DNA storage encoding and decoding rules and a DNA storage encoding and decoding method and device, which can solve the problem of extreme GC or special motifs that cannot be completely avoided by existing fixed rules.

[0007] According to a first aspect of the present invention, the present invention provides a method for generating DNA storage encoding and decoding rules, comprising:

[0008] (1) Setting a sliding window (n, k) for storing DNA encoding and decoding rules, where n represents the length of the sliding window, and k represents the length of the base character of each sliding, where n and k are positive integers, and n ≥ k;

[0009] (2) based on the length n of the sliding window, obtaining a full set of sequences, wherein the full set of sequences is a set of all base sequences formed by random combinations of all possible bases at each base position within the length of the sliding window, and using a restriction condition to screen out a qualified sequence set that meets the restriction condition in the full set of sequences, wherein the restriction condition is set based on sequence features in the full set of sequences;

[0010] (3) connecting the sequences in the above qualified sequence set by means of a directed graph, wherein each node in the above directed graph represents each sequence;

[0011] (4) Delete the nodes in the directed graph whose out-degree number is less than the set out-degree limit;

[0012] (5) deleting the redundant out-degrees of each node in the directed graph, wherein the redundant out-degrees are out-degrees that exceed the set out-degree limit;

[0013] (6) Obtain an algorithm diagram, which includes DNA storage encoding and decoding rules.

[0014] In a preferred embodiment, the above-mentioned restriction conditions include at least one of GC base content, single base repeat, simple sequence repeat, palindromic sequence repeat, complementary palindromic sequence repeat and elimination of special sequences.

[0015] In a preferred embodiment, the above-mentioned restriction conditions include at least one of the following:

[0016] The GC base content is 40%-60%, the single base repetition does not exceed 3 consecutive identical bases, the simple sequence repetition is not less than 4 bases, the palindromic sequence repetition is not less than 4 bases, the complementary palindromic sequence repetition is not less than 4 bases, and the special sequence elimination is to eliminate the sequences containing AGA, GAG, CTC, and TCT.

[0017] In a preferred embodiment, the above-set limit on the number of out-degrees is the number of out-degrees required for coding efficiency.

[0018] In a preferred embodiment, the above coding efficiency is e, and e∈(0,2], the first The out-degree limit of a layer is

[0019] In a preferred embodiment, when the above coding efficiency is 1, the out-degree limit of each node is 2.

[0020] In a preferred embodiment, the above-mentioned deleting redundant out-degrees of each node in the above-mentioned directed graph includes: if the total number of out-degrees of the above-mentioned nodes exceeds the set out-degree number limit, then outputting the bases of the above-mentioned nodes in reverse order, and deleting the out-degrees pointing to the corresponding bases in sequence according to the order of the bases output in reverse order.

[0021] In a preferred embodiment, the above method further comprises, after step (4):

[0022] (4') Delete the nodes with in-degree 0 in the above directed graph.

[0023] In a preferred embodiment, the above method further comprises:

[0024] After executing step (4'), return to step (4) again, and repeat steps (4)-(4') until the out-degree numbers of all nodes in the directed graph are greater than the set out-degree limit, and there is no node with an in-degree of 0 in the directed graph.

[0025] In a preferred embodiment, the above method further comprises, between step (4) and step (4'):

[0026] (4") Delete the redundant out-degrees of each node in the directed graph, where the redundant out-degrees are the out-degrees exceeding the set out-degree limit.

[0027] In a preferred embodiment, the above method further comprises:

[0028] After executing step (4'), return to step (3) again, and repeat steps (3)-(4)-(4") (4') until the out-degree numbers of all nodes in the directed graph are greater than the set out-degree limit, and there is no node with an in-degree of 0 in the directed graph.

[0029] According to a second aspect of the present invention, the present invention provides a device for generating DNA storage encoding and decoding rules, comprising:

[0030] A sliding window setting unit, used to set a sliding window (n, k) of the DNA storage encoding and decoding rule, where n represents the length of the sliding window, k represents the length of the base character of each sliding, where n, k are positive integers, and n≥k;

[0031] A qualified sequence screening unit is used to obtain a full set of sequences based on the length n of the sliding window, wherein the full set of sequences is a set of all base sequences formed by random combinations of all possible bases at each base position within the length of the sliding window, and to screen out a set of qualified sequences that meet the above-mentioned restriction conditions in the full set of sequences using restriction conditions, wherein the above-mentioned restriction conditions are set based on sequence features in the above-mentioned full set of sequences;

[0032] A directed graph connection unit, used to connect the sequences in the above qualified sequence set in a directed graph, wherein each node in the above directed graph represents each sequence;

[0033] The out-degree violation deletion unit is used to delete the nodes whose out-degree number is less than the set out-degree limit in the above directed graph;

[0034] A redundant out-degree deletion unit is used to delete the redundant out-degrees of each node in the directed graph, wherein the redundant out-degrees are out-degrees exceeding a set out-degree limit;

[0035] The algorithm chart obtaining unit is used to obtain an algorithm chart, wherein the algorithm chart includes DNA storage encoding and decoding rules.

[0036] According to a third aspect of the present invention, the present invention provides a DNA storage encoding method, comprising:

[0037] Obtaining the DNA storage encoding and decoding rules generated by the method of the first aspect, and setting an initial node, and setting the initial node as the current node;

[0038] Obtain a binary sequence to be encoded and slice it to generate binary slices, convert the binary value corresponding to the slice into an out-degree node or multiple out-degree nodes connected to the current node, wherein each out-degree node describes a nucleic acid fragment, and the binary slice and the corresponding nucleic acid fragment form a pair of mapping relationships;

[0039] According to the DNA storage encoding and decoding rules, the binary slices are input, the nucleic acid fragments mapped by the out-degree node or multiple out-degree nodes are output, and the out-degree node is updated as the current node. The binary slices are input and the nucleic acid fragments are output in a loop according to the binary slice sequence until all the binary slices are input;

[0040] The above nucleic acid fragments are connected in sequence according to the output order and the complete DNA sequence is output.

[0041] In a preferred embodiment, the above method slices the above binary sequence to be encoded according to a length of 2k-1, where k represents the base character length of each sliding of the sliding window.

[0042] In a preferred embodiment, the method further comprises: synthesizing the DNA sequence and then preserving it in an in vitro medium or in living cells.

[0043] According to a fourth aspect of the present invention, the present invention provides a DNA storage encoding device, comprising:

[0044] A coding and decoding rule acquisition unit, used to acquire the DNA storage coding and decoding rule generated by the method of the first aspect, and set an initial node, and set the initial node as the current node;

[0045] A binary sequence slicing and conversion unit is used to obtain a binary sequence to be encoded and slice it to generate a binary slice, and convert the binary value corresponding to the slice into an out-degree node or multiple out-degree nodes connected to the current node, wherein each out-degree node describes a nucleic acid fragment, and the above binary slice and the corresponding nucleic acid fragment form a pair of mapping relationships;

[0046] A nucleic acid fragment output unit is used to input the binary slices according to the DNA storage encoding and decoding rules, output the nucleic acid fragments mapped by the out-degree node or multiple out-degree nodes, and update the out-degree node as the current node, and continuously input binary slices and output nucleic acid fragments in a loop according to the binary slice sequence until all the binary slices are input;

[0047] The nucleic acid fragment connection unit is used to connect the above nucleic acid fragments in sequence according to the output order and output a complete DNA sequence.

[0048] In a preferred embodiment, the above-mentioned binary sequence to be encoded is sliced ​​according to a length of 2k-1, where k represents the base character length of each sliding of the sliding window.

[0049] According to a fifth aspect of the present invention, the present invention provides a DNA storage decoding method, comprising:

[0050] Obtaining the DNA storage encoding and decoding rules generated by the method of the first aspect, and setting an initial node, and setting the initial node as the current node;

[0051] Obtain a DNA sequence to be decoded and slice it to generate a nucleic acid slice. According to the DNA storage encoding and decoding rules and the nucleic acid information corresponding to the slice, find an out-degree node or multiple out-degree nodes connected to the current node, where each out-degree node describes a nucleic acid information. The nucleic acid slice and the corresponding binary value or binary slice form a pair of mapping relationships.

[0052] According to the current node and the out-degree node or the multi-layer out-degree node, the binary value or binary slice between the nodes is obtained according to the mapping relationship, and the out-degree node is updated as the current node, and the nucleic acid slices are continuously input and the binary value or binary slice is output according to the sequence of the nucleic acid slices, until all the nucleic acid slices are input;

[0053] The above binary values ​​or binary slices are concatenated in order of output and a complete binary sequence is output.

[0054] In a preferred embodiment, the above method slices the DNA sequence to be decoded according to the length of k, where k represents the length of the base character of each sliding of the sliding window.

[0055] In a preferred embodiment, the DNA sequence to be decoded is generated by encoding using the method of the third aspect or the device of the fourth aspect.

[0056] According to a sixth aspect of the present invention, the present invention provides a DNA storage decoding device, comprising:

[0057] A coding and decoding rule acquisition unit, used to acquire the DNA storage coding and decoding rule generated by the method of the first aspect, and set an initial node, and set the initial node as the current node;

[0058] A DNA slicing and conversion unit is used to obtain a DNA sequence to be decoded and slice it to generate a nucleic acid slice, and find an out-degree node or multiple out-degree nodes connected to the current node and the current node according to the DNA storage encoding and decoding rules and the nucleic acid information corresponding to the slice, wherein each out-degree node describes a nucleic acid information, and the nucleic acid slice and the corresponding binary value or binary slice form a pair of mapping relationships;

[0059] A binary value output unit is used to obtain binary values ​​or binary slices between nodes according to the above-mentioned current node and the above-mentioned out-degree node or multi-layer out-degree node according to the above-mentioned mapping relationship, and update the above-mentioned out-degree node to the current node, and continuously and cyclically input nucleic acid slices and output binary values ​​or binary slices according to the above-mentioned nucleic acid slice sequence until all the above-mentioned nucleic acid slices are input;

[0060] The binary value connection unit is used to connect the above binary values ​​in sequence according to the output order and output a complete binary sequence.

[0061] In a preferred embodiment, the DNA sequence to be decoded is sliced ​​according to the length of k, where k represents the length of the base character of each sliding of the sliding window.

[0062] According to a seventh aspect of the present invention, the present invention provides a computer-readable storage medium, comprising a program, which can be executed by a processor to implement the method of the first aspect, the method of the third aspect, or the method of the fifth aspect.

[0063] At present, all encoding and decoding rules can be generated by the method for generating DNA storage encoding and decoding rules of the present invention, so there is no need to set corresponding encoding and decoding rules for each restriction condition and coding efficiency, which saves costs.

[0064] In addition, based on the analysis method of graph theory, the generated implicit encoding and decoding rules can be further theoretically analyzed, such as the stability analysis of the algorithm. Compared with the existing encoding and decoding rules, the encoding and decoding rules generated by the present invention are more efficient, because the implicit encoding and decoding rules generated by the present invention are a direct end-to-end mapping relationship between binary and base, and the time complexity of encoding and decoding is O (n). The method of the present invention is applicable to sequencing and decoding under any conditions, especially can be used for third-generation sequencing and decoding, while other existing algorithms do not involve third-generation sequencing and decoding. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] Figure 1 Schematic diagram of the encoding and decoding process of DNA storage in an embodiment of the present invention;

[0066] Figure 2 A flow chart of a method for generating DNA storage encoding and decoding rules in an embodiment of the present invention;

[0067] FIG3 is a schematic diagram of a method for generating DNA storage encoding and decoding rules according to an embodiment of the present invention;

[0068] Figure 4 A structural block diagram of a device for generating DNA storage encoding and decoding rules in an embodiment of the present invention;

[0069] Figure 5 This is a flow chart of the DNA storage encoding method in an embodiment of the present invention;

[0070] Figure 6 It is a schematic diagram of the principle of the encoding rules in the DNA storage encoding and decoding method in the embodiment of the present invention, which is displayed in the form of an adjacency matrix or a graph;

[0071] Figure 7 Schematic diagram of the coding and decoding steps of the DNA storage coding and decoding method in an embodiment of the present invention;

[0072] Figure 8 This is a structural block diagram of a DNA storage encoding device in an embodiment of the present invention;

[0073] Fig. 9 This is a flow chart of the DNA storage decoding method in an embodiment of the present invention;

[0074] Fig.10 This is a structural block diagram of a DNA storage and decoding device in an embodiment of the present invention;

[0075] Fig.11 This is a schematic diagram of part of the information of the configuration file of the encoding and decoding rules in an embodiment of the present invention. DETAILED DESCRIPTION

[0076] The present invention is further described in detail below by specific embodiments in conjunction with the accompanying drawings. In the following embodiments, many details are described to enable the present invention to be better understood. However, those skilled in the art can easily recognize that some of the features can be omitted in different situations, or can be replaced by other materials or methods.

[0077] In addition, the features, operations or characteristics described in the specification can be combined in any appropriate manner to form various implementations. At the same time, the steps or actions in the method description can also be interchanged or adjusted in a manner that is obvious to those skilled in the art. Therefore, the various sequences in the specification and the drawings are only for the purpose of clearly describing a certain embodiment and are not meant to be a required sequence, unless otherwise specified that a certain sequence must be followed.

[0078] Terminology of the present invention:

[0079] Coding method refers to a mapping relationship between binary and base. Generally speaking, the traditional fixed rule coding method will perform multiple steps of optimization processing to finally obtain the final mapping relationship. In the present invention, the coding method is implemented by coding and decoding rules. The coding and decoding rules of the present invention are generated by the method of generating DNA storage coding and decoding rules of the present invention.

[0080] The generator, also referred to as the "method for generating DNA storage encoding and decoding rules" in the present invention, obtains a potential mapping relationship between binary and bases through graph theory based on different combinations, that is, obtains the encoding and decoding rules of the present invention.

[0081] Algorithm stability refers to whether the algorithm can stably meet the constraints for any input electronic file and the output DNA sequence. Usually, in the "arbitrary" case, flood attack-like input is used to observe the stability of the algorithm under extreme conditions.

[0082] End-to-end, from raw data input to result output, from input end to output end, the mapping process in the middle is self-contained.

[0083] Time complexity, the time complexity of an algorithm is a function that qualitatively describes the running time of the algorithm. It is a function of the length of the string representing the input value of the algorithm. Time complexity is often expressed in big O notation, which does not include the lower-order terms and the leading coefficient of this function. When used in this way, the time complexity can be said to be asymptotic, that is, it considers the situation when the size of the input value approaches infinity.

[0084] In view of the sequence constraints of different sequencing or synthesis instruments, the present invention proposes an optimal codec generator based on the constraints, that is, a method for generating DNA storage codec rules of the present invention. The generator (or method) can solve the problem that the existing fixed rules cannot completely avoid extreme GC or special motifs. The special motif here refers to a sequence that is difficult to analyze using fixed rules.

[0085] In addition, the encoding method generated by the generator does not require a screening process, so there is no risk of not being able to accept all inputs. In addition, the encoding and decoding time complexity of the encoding method generated by the generator is O(n). Compared with most encoding and decoding methods that require a lot of optimization processes, the encoding and decoding method of the present invention will be much faster, and will be more efficient for future large-scale DNA storage transcoding.

[0086] The following describes in detail the technical components of the present invention. It should be understood that these descriptions are exemplary and that those skilled in the art can make many modifications based on the technical content of the present invention.

[0087] like Figure 2As shown in FIG3 , in one embodiment of the present invention, a method for generating DNA storage coding rules, i.e., a DNA storage coding generator, is created based on graph theory and combinatorics, and the steps include:

[0088] S210: Setting a sliding window (n, k) for storing DNA encoding and decoding rules.

[0089] As shown in FIG3 , the sliding window is a window model with a fixed length of n. After each sliding of a fixed-length base character k (usually k=1), where n and k are positive integers, n≥k, all character data within the current position window are observed.

[0090] S220: Based on the length n of the sliding window, a full set sequence is obtained, wherein the full set sequence is a set of all base sequences formed by random combinations of all possible bases at each base position within the length of the sliding window, and a set of qualified sequences that meet the restriction conditions in the full set sequence is screened out using restriction conditions, wherein the restriction conditions are set based on sequence features in the full set sequence.

[0091] As shown in FIG. 3 , the restriction condition may include at least one of GC base content, single base repeat, simple sequence repeat, palindromic sequence repeat, complementary palindromic sequence repeat and elimination of special sequences.

[0092] In one embodiment, the restriction conditions include at least one of the following: the GC base content is 40%-60%, the single base repetition does not exceed 3 consecutive identical bases, the simple sequence repetition is not less than 4 bases, the palindromic sequence repetition is not less than 4 bases, the complementary palindromic sequence repetition is not less than 4 bases, and the special sequence is eliminated to eliminate the sequence containing AGA, GAG, CTC, and TCT. It should be noted that the "repetition" in the simple sequence repetition, palindromic sequence repetition, and complementary palindromic sequence repetition refers to the "repeated base length". For example: the base sequence ACGTACGTACGT is a repetition of "ACGT" with a repetition of 4; the base sequence ACGTAAACGTAAACGTAA is a repetition of "ACGTAA" with a repetition of 6. Since the A base and the G base, the C base and the T base have similar chemical structures, when sequencing is performed using a third-generation sequencer, such as nanopore, the adjacent bases of similar chemical structures are prone to base recognition confusion during the sequencing process, thereby causing sequencing sequence errors. Therefore, it is necessary to avoid such sequences as much as possible.

[0093] As shown in FIG3 , the specific operation method for screening out the qualified sequence set is as follows: (1) Since the sequence is composed of bases ACGT, the method of the present invention pre-generates 4 nsequences (i.e., the complete set of sequences); (2) each sequence is tested through the restriction conditions. If the sequence meets the restriction conditions, the sequence is saved in the qualified sequence set.

[0094] S230: Connect the sequences in the qualified sequence set in a directed graph, where each node in the directed graph represents each sequence.

[0095] As shown in Figure 3, a directed graph is a graph consisting of a number of given nodes and lines connecting two nodes. A directed graph means that the line between two nodes is directional. Here, each sequence is compared to a node in a directed graph. Assuming that the length of the sequence represented by the node is n, if the string consisting of the 2nd to the nth characters of the sequence corresponding to a node A is exactly the same as the string consisting of the 1st to the (n-1)th characters of the sequence corresponding to another node B, then the connection relationship is from A to B. For example, the length of the sequence represented by the node is 9, node 1 is the sequence ATAGTGGTC, node 2 is the sequence TAGTGGTCA, the sequence of node 1 from the 2nd to the 9th base is "TAGTGGTC", and the sequence of node 2 from the 1st to the 8th base is "TAGTGGTC", and the two are exactly the same, and the connection relationship is from node 1 to node 2.

[0096] S240: Delete the nodes in the directed graph whose out-degree number is less than the set out-degree limit.

[0097] In one embodiment of the present invention, the set out-degree number limit is the out-degree number required for coding efficiency. As shown in Figure 3, based on coding efficiency, the out-degree number of all nodes is checked. If the out-degree number of a node is less than the out-degree number required for coding efficiency, the node is deleted. The loop is terminated until all nodes meet the conditions. The out-degree number of a node refers to the number of edges pointing from a given node to other nodes in a directed graph.

[0098] In one embodiment, the coding efficiency is e, and e∈(0,2], the first The out-degree limit of a layer is Among them, k represents the base character length of each sliding of the sliding window. Since the base sequence within the length of a sliding window constitutes a node, the base character length k of each sliding is the kth layer of the node.

[0099] In some preferred embodiments, when the coding efficiency is 1, the out-degree limit of each node is 2.

[0100] S250: Delete the redundant out-degree of each node in the directed graph.

[0101] In the present invention, redundant out-degrees are out-degrees that exceed the set out-degree number limit. For example, in one embodiment, for a certain node, if the set out-degree number limit is 2, but the node contains 4 out-degrees, then the out-degrees that exceed the set out-degree number limit are redundant out-degrees, that is, 2 out-degrees need to be deleted. The purpose of deleting redundant out-degrees is to maintain the stability of the algorithm.

[0102] In one embodiment, the excess out-degree is the node's The total number of out-degrees exceeds The out-degree of , where e is the coding efficiency and e∈(0,2].

[0103] As shown in FIG3 , according to the coding efficiency, the redundant out-degree of each node is deleted. The deletion method is specifically that if the total out-degree number of the node exceeds the set out-degree number limit, the base of the node is output in reverse order, and the out-degree pointing to the corresponding base is deleted in sequence according to the base sequence output in reverse order. In the present invention, "the out-degree pointing to the corresponding base" means that in the out-degree formed by the previous node pointing to the next node, if the last base of the base sequence of the next node is the same as the base output in reverse order of the previous node, then the out-degree is the "out-degree pointing to the corresponding base". For example, the sequence of the previous node (L) is AACACGACT, and the next node sequences connected to this node are: node (P1) sequence is AACCGACTA, node (P2) sequence is AACCGACTC, node (P3) sequence is AACCGACTG, and node (P4) sequence is AACCGACTT. Node (L) is connected to nodes (P1), (P2), (P3), and (P4) respectively, forming 4 out-degrees. If the set out-degree limit is 2, the number of redundant out-degrees is 2, that is, 2 redundant out-degrees need to be deleted, and the bases of node (L) are output in reverse order: T, C, A, G, C, A, C, A, A. According to this output order, the out-degrees pointing to bases T and C are deleted in turn, that is, the out-degree formed by node (L) and node (P4) whose last base sequence is T, and the out-degree formed by node (L) and node (P2) whose last base sequence is C are deleted.

[0104] In some preferred embodiments, after step S240, the method further includes:

[0105] Step S240': Delete the nodes with in-degree 0 in the directed graph to reduce the scope of the directed graph. The advantage of this is that for the generation algorithm with looser constraints, the strictness of the constraints can be improved from another level.

[0106] In some preferred embodiments, it further includes: after executing step S240', returning to step S240 again, and looping through steps S240-S240' until the out-degree numbers of all nodes in the directed graph are greater than the set out-degree limit, and there are no nodes with in-degree number of 0 in the directed graph.

[0107] In some preferred embodiments, the following is further included between step S240 and step S240':

[0108] Step S240": delete the redundant out-degrees of each node in the directed graph, wherein the redundant out-degrees are the out-degrees exceeding the set out-degree limit. The redundant out-degrees are defined as above and will not be repeated here.

[0109] In some preferred embodiments, the method further includes: after executing step (S240'), returning to step (S230) again, and looping through steps (S230)-(S240)-(S240") (S240') until the out-degree numbers of all nodes in the directed graph are greater than the set out-degree limit, and there are no nodes with zero in-degree in the directed graph. It should be noted that after each loop ends, since nodes and out-degrees are deleted, when a new loop starts, all nodes will be reconnected according to the above connection principle to form a new directed graph, and then deleted according to the above deletion principle. In addition, before deleting nodes with zero in-degree, redundant out-degrees are removed first, so that more nodes with zero in-degree can be exposed in the current loop, so as to reduce the total number of loops and shorten the program running time.

[0110] S260: Obtain an algorithm chart, which includes DNA storage encoding and decoding rules.

[0111] Corresponding to the method for generating DNA storage encoding and decoding rules of the present invention, the present invention also provides a device for generating DNA storage encoding and decoding rules, such as Figure 4As shown, it includes: a sliding window setting unit 410, which is used to set a sliding window (n, k) of the DNA storage encoding and decoding rules, wherein n represents the length of the sliding window, and k represents the length of the base character of each sliding, wherein n, k are positive integers, and n ≥ k; a qualified sequence screening unit 420, which is used to obtain a full set sequence based on the length n of the sliding window, wherein the full set sequence is a set of all base sequences formed by random combinations of all base possibilities at each base position within the length of the sliding window, and a restriction condition is used to screen out a qualified sequence set that meets the restriction condition in the full set sequence, wherein the restriction condition is based on The sequence characteristics in the full set of sequences are used for setting; a directed graph connection unit 430 is used to connect the sequences in the qualified sequence set by means of a directed graph, and each node in the directed graph represents each sequence; an out-degree mismatch deletion unit 440 is used to delete the nodes in the above directed graph whose out-degree number is less than the set out-degree number limit; a redundant out-degree deletion unit 450 is used to delete the redundant out-degree of each node in the above directed graph, wherein the redundant out-degree is the out-degree that exceeds the set out-degree number limit; an algorithm chart acquisition unit 460 is used to obtain an algorithm chart, and the algorithm chart includes DNA storage encoding and decoding rules.

[0112] Those skilled in the art will appreciate that all or part of the functions of the various methods in the above-mentioned embodiments can be implemented by hardware or by computer programs. When all or part of the functions in the above-mentioned embodiments are implemented by computer programs, the program can be stored in a computer-readable storage medium, and the storage medium can include: read-only memory, random access memory, disk, optical disk, hard disk, etc., and the program is executed by a computer to implement the above-mentioned functions. For example, the program is stored in the memory of the device, and when the program in the memory is executed by the processor, all or part of the above-mentioned functions can be implemented. In addition, when all or part of the functions in the above-mentioned embodiments are implemented by computer programs, the program can also be stored in a storage medium such as a server, another computer, disk, optical disk, flash disk or mobile hard disk, and can be downloaded or copied and saved in the memory of the local device, or the system of the local device is updated, and when the program in the memory is executed by the processor, all or part of the functions in the above-mentioned embodiments can be implemented.

[0113] Therefore, in one embodiment of the present invention, a computer-readable storage medium is provided, including a program, which can be executed by a processor to implement the method of generating DNA storage encoding and decoding rules of the present invention.

[0114] like Figure 5 , Figure 6 ,and Figure 7 As shown, one embodiment of the present invention further provides a DNA storage encoding method, that is, a method for using the generated DNA storage encoding and decoding rules in the encoding stage, comprising the following steps:

[0115] S510: Obtain DNA storage encoding and decoding rules, and the initial node, and set the initial node as the current node. It can be understood that any node can be set as the initial node, and the ID of the initial node is usually set to 0.

[0116] The DNA storage encoding and decoding rules are generated by the method for generating DNA storage encoding and decoding rules of the present invention under a given sliding window (n, k) and restriction conditions.

[0117] In one embodiment of the present invention, the parameters for limiting the sliding window are (n=9, k=1), and the given limiting conditions include: single base repeats not exceeding 2, simple sequence repeats not less than 4 bases, palindromic sequence repeats not less than 4 bases, complementary palindromic sequence repeats not less than 4 bases, GC base content between 40% and 60%, and elimination of 4 special sequences "AGA", "GAG", "CTC", and "TCT" for nanopore sequencing. In other embodiments, the parameters and limiting conditions of the sliding window can be set according to specific needs.

[0118] S520: Obtain the binary sequence to be encoded and slice it to generate binary slices, and convert the binary value corresponding to the slice into an out-degree node or multiple out-degree nodes connected to the current node. Each out-degree node describes a nucleic acid fragment, and the binary slice and the corresponding nucleic acid fragment form a pair of mapping relationships.

[0119] In one embodiment of the present invention, the above-mentioned binary sequence to be encoded is sliced ​​according to a length of 2k-1, where k represents the base character length of each sliding of the sliding window.

[0120] S530: According to the above-mentioned DNA storage encoding and decoding rules, binary slices are input, the nucleic acid fragments mapped by the above-mentioned out-degree nodes or multiple layers of out-degree nodes are output, and the above-mentioned out-degree nodes are updated as the current nodes. Binary slices are continuously input and nucleic acid fragments are output in a loop according to the above-mentioned binary slice sequence until all the above-mentioned binary slices are input.

[0121] In one embodiment of the present invention, an adjacency matrix is ​​used to illustrate the principle of the encoding method, such as Figure 6 As shown. In the adjacency matrix, white characters on a black background represent the nucleotides assigned to the current ID. In the figure, the color of the nodes from light to dark represents the number of layers corresponding to the nodes, the number in the node represents the ID of the node, and the character closest to the node represents the nucleotide assigned to the node. Each arrow represents the bit obtained from this node to the next node.

[0122] In one embodiment of the present invention, an adjacency matrix diagram (DNA Spider-Web) is used to display the specific encoding and decoding process, such as Figure 7 The figure shows the process of the node in the figure jumping to the next node after reading a bit during the encoding process, and obtaining the corresponding nucleotide in this process.

[0123] S540: Connect the above nucleic acid fragments in order according to the output order and output a complete DNA sequence.

[0124] In one embodiment of the present invention, the DNA storage encoding method of the present invention, after outputting the complete DNA sequence, synthesizes the above DNA sequence and then preserves it in an in vitro medium or living cells.

[0125] Corresponding to the DNA storage encoding method of the present invention, one embodiment of the present invention also provides a DNA storage encoding device, such as Figure 8 As shown, it includes: a coding and decoding rule acquisition unit 810, which is used to acquire the DNA storage coding and decoding rules generated by the method for generating DNA storage coding and decoding rules in the present invention, and set an initial node, and set the initial node as the current node; a binary sequence slicing and conversion unit 820, which is used to acquire the binary sequence to be encoded and slice it to generate binary slices, and convert the binary values ​​corresponding to the slices into out-degree nodes or multi-layer out-degree nodes connected to the current node, wherein each out-degree node describes a nucleic acid fragment, and the binary slices and the corresponding nucleic acid fragments form a pair of mapping relationships; a nucleic acid fragment output unit 830, which is used to input the above binary slices according to the above DNA storage coding and decoding rules, output the nucleic acid fragments mapped by the above out-degree nodes or multi-layer out-degree nodes, and update the above out-degree nodes as the current node, and continuously input binary slices and output nucleic acid fragments according to the above binary slice sequence until all the above binary slices are input; a nucleic acid fragment connection unit 840, which is used to sequentially connect the above nucleic acid fragments according to the output sequence and output a complete DNA sequence.

[0126] In addition, an embodiment of the present invention provides a computer-readable storage medium, including a program, which can be executed by a processor to implement the DNA storage encoding method of the present invention.

[0127] like Figure 7 and Fig. 9 As shown, an embodiment of the present invention further provides a DNA storage decoding method, that is, a method for using the generated DNA storage encoding and decoding rules in the decoding stage, comprising the following steps:

[0128] S910: Obtain DNA storage encoding and decoding rules, and set the initial node, and set the initial node as the current node. It can be understood that any node can be set as the initial node, and the ID of the initial node is usually set to 0.

[0129] The DNA storage encoding and decoding rules are generated by the method for generating DNA storage encoding and decoding rules of the present invention under a given sliding window (n, k) and restriction conditions.

[0130] In one embodiment of the present invention, the parameters for limiting the sliding window are (n=9, k=1), and the given limiting conditions include: single base repeats not exceeding 2, simple sequence repeats not less than 4 bases, palindromic sequence repeats not less than 4 bases, complementary palindromic sequence repeats not less than 4 bases, GC base content between 40% and 60%, and elimination of 4 special sequences "AGA", "GAG", "CTC", and "TCT" for nanopore sequencing. In other embodiments, the parameters and limiting conditions of the sliding window can be set according to specific needs.

[0131] S920: Obtain the DNA sequence to be decoded and slice it to generate nucleic acid slices. According to the DNA storage encoding and decoding rules and the nucleic acid information corresponding to the slices, find the out-degree node or multiple layers of out-degree nodes connected to the current node, where each out-degree node describes a nucleic acid information, and the nucleic acid slice and the corresponding binary value or binary slice form a pair of mapping relationships.

[0132] In one embodiment of the present invention, the DNA sequence to be decoded is sliced ​​according to the length of k, where k represents the length of the base character of each sliding of the sliding window.

[0133] S930: Based on the above-mentioned current node and the above-mentioned out-degree node or multi-layer out-degree node, obtain the binary value or binary slice between the nodes according to the above-mentioned mapping relationship, and update the above-mentioned out-degree node to the current node, and continuously loop to input nucleic acid slices and output binary values ​​or binary slices according to the above-mentioned nucleic acid slice sequence until all the above-mentioned nucleic acid slices are input.

[0134] In one embodiment of the present invention, an adjacency matrix diagram (DNA Spider-Web) is used to display the specific encoding and decoding process, such as Figure 7 The figure shows the decoding process, which is the process of the node in the figure jumping to the next node after reading a nucleotide and obtaining the corresponding bit in the process.

[0135] S940: Connect the above binary values ​​or binary slices in order according to the output order and output a complete binary sequence.

[0136] Corresponding to the DNA storage decoding method of the present invention, an embodiment of the present invention further provides a DNA storage decoding device, such as Fig.10 As shown, it includes: a coding and decoding rule acquisition unit 1010, which is used to acquire the DNA storage coding and decoding rule generated by the method for generating DNA storage coding and decoding rule in the present invention, and set the initial node, and set the initial node as the current node; a DNA slicing and conversion unit 1020, which is used to acquire the DNA sequence to be decoded and slice it to generate nucleic acid slices, and find the out-degree node or multi-layer out-degree node connected to the current node according to the DNA storage coding and decoding rule and the nucleic acid information corresponding to the slice, wherein each out-degree node describes a nucleic acid information, and the nucleic acid slice and the corresponding binary value or binary slice form a pair of mapping relationships; a binary value output unit 1030, which is used to obtain the binary value or binary slice between the nodes according to the mapping relationship according to the current node and the out-degree node or multi-layer out-degree node, and update the out-degree node as the current node, and continuously input the nucleic acid slice and output the binary value or binary slice according to the nucleic acid slice sequence until all the nucleic acid slices are input; a binary value connection unit 1040, which is used to sequentially connect the binary values ​​or binary slices in the output order and output a complete binary sequence.

[0137] In addition, an embodiment of the present invention provides a computer-readable storage medium, including a program, which can be executed by a processor to implement the DNA storage decoding method of the present invention.

[0138] The technical solutions and effects of the present invention are described in detail below through examples. It should be understood that the examples are merely illustrative and cannot be construed as limiting the present invention.

[0139] In this example, the parameters defining the sliding window are (n=9, k=1).

[0140] The process of obtaining implicit encoding and decoding rules through DNA storage encoding and decoding generator is as follows:

[0141] (1) Based on the current restrictions (no more than 2 single base repeats, no less than 4 simple sequence repeats, no less than 4 palindromic sequence repeats, no less than 4 complementary palindromic sequence repeats, GC content between 40% and 60%, and elimination of the 4 special sequences "AGA", "GAG", "CTC", and "TCT" for nanopore sequencing) all combinations were obtained. n = Among the 262144 DNA sequence fragment combinations, the DNA sequence fragments that do not meet the above limit conditions are ignored, and the remaining DNA sequence fragments are retained, and finally a qualified sequence set including 48460 combinations is obtained.

[0142] (2) Connect the sequences in the qualified sequence set through a directed graph. Check the out-degree of each node and delete those that do not meet the requirements, that is, those with an out-degree of no more than 2. k = 2, until all remaining nodes meet the requirements. After 9 rounds of screening, 14,000 combinations are finally obtained.

[0143] (3) Eliminate nodes with in-degree 0 and further detect out-degree. After 10 in-degree elimination operations, 5264 combinations of DNA sequence fragments were finally obtained.

[0144] (4) Find all nodes with out-degree greater than 2 in the 5264 combinations of DNA sequence fragments. Output the sequences of these nodes in reverse order. If there are any extra out-degrees, delete the out-degrees pointing to the corresponding bases in reverse order. Save the adjacency matrix of the graph and generate an encoding and decoding method containing implicit encoding and decoding rules.

[0145] Specific examples of using the generated codec method in encoding and decoding:

[0146] (1) Prerequisite: Obtain the encoding and decoding method containing implicit encoding and decoding rules generated by this embodiment. Part of the information in the configuration file of the encoding and decoding rules is as follows: Fig.11 shown.

[0147] (2) Specific storage process:

[0148] [1] Extract the binary code corresponding to the sentence “Hello world!”: 000100101010011000110110001101101111011000000100111011101101001001110001101100010011010000100

[0150] [2] The above binary code is sliced ​​into pieces with a length of 1, and the binary information is encoded according to the encoding rules to obtain DNA fragments. The DNA fragments are connected in the order of slicing to obtain the following full-length DNA sequence:

[0151] ACGTACCACATCAGTCACGTAGTCAGTGCTGATGTGCTGACAACCTAC GTTCGTGATGTGCTGACTACGTTCACGTAGTCAGTCATGCTACACTAC.

[0152] [3] The full-length DNA sequence was synthesized using chemical synthesis methods.

[0153] [4] Save the synthesized DNA molecules to achieve information storage.

[0154] (3) Specific reading process:

[0155] [1] The stored DNA molecules are sequenced to obtain their specific sequences, as follows:

[0156] ACGTACCACATCAGTCACGTAGTCAGTGCTGATGTGCTGACAACCTAC GTTCGTGATGTGCTGACTACGTTCACGTAGTCAGTCATGCTACACTAC.

[0157] [2] The above DNA sequence is sliced ​​into pieces with a length of 1, and the sequence information is decoded according to the encoding rules to obtain binary values. The binary values ​​are connected in the order of slicing to obtain the following binary sequence:

[0158] 0001001010011000110110001101101111011000000100111011101101001001110001101100010011010000100.

[0159] [3] Restore the binary information and interpret it as Hello world!

[0160] The above specific examples are used to illustrate the present invention, which is only used to help understand the present invention and is not intended to limit the present invention. For those skilled in the art, according to the concept of the present invention, some simple deductions, modifications or substitutions can be made.

Claims

1. A method for generating DNA storage encoding and decoding rules, characterized in that: The method comprises: (1) Setting a sliding window (n, k) for storing DNA encoding and decoding rules, where n represents the length of the sliding window, and k represents the length of the base character for each sliding, where n and k are positive integers, and n ≥ k; (2) based on the length n of the sliding window, obtaining a full set of sequences, wherein the full set of sequences is a set of all base sequences formed by random combinations of all possible bases at each base position within the length range of the sliding window, and using a restriction condition to screen out a qualified sequence set that meets the restriction condition in the full set of sequences, wherein the restriction condition is set based on sequence features in the full set of sequences; (3) connecting the sequences in the qualified sequence set by means of a directed graph, wherein each node in the directed graph represents each sequence; (4) deleting nodes in the directed graph whose out-degree number is less than the set out-degree limit; (5) deleting the redundant out-degrees of each node in the directed graph, wherein the redundant out-degrees are out-degrees exceeding a set out-degree limit; (6) Obtaining an algorithm chart, wherein the algorithm chart includes DNA storage encoding and decoding rules.

2. The method according to claim 1, characterized in that The restriction conditions include at least one of GC base content, single base repeat, simple sequence repeat, palindromic sequence repeat, complementary palindromic sequence repeat and elimination of special sequences.

3. The method according to claim 2, characterized in that The restriction condition includes at least one of the following: The GC base content is 40%-60%, the single base repetition does not exceed 3 consecutive identical bases, the simple sequence repetition is not less than 4 bases, the palindromic sequence repetition is not less than 4 bases, the complementary palindromic sequence repetition is not less than 4 bases, and the special sequence elimination is to eliminate the sequences containing AGA, GAG, CTC, and TCT.

4. The method according to claim 1, characterized in that The set out-degree number limit is the out-degree number required for coding efficiency.

5. The method according to claim 4, characterized in that When the coding efficiency is e and e∈(0,2], the out-degree limit of each node in the kth layer is in, 6. The method according to claim 5, characterized in that When the coding efficiency is 1, the out-degree limit of each node is 2.

7. The method according to claim 1, characterized in that The deleting of redundant out-degrees of each node in the directed graph includes: if the total number of out-degrees of the nodes exceeds a set out-degree limit, outputting the bases of the nodes in reverse order, and deleting the out-degrees pointing to the corresponding bases in sequence according to the order of the bases output in reverse order.

8. The method according to claim 1, characterized in that: After step (4), the method further comprises: (4') Delete the nodes with in-degree 0 in the directed graph.

9. The method according to claim 8, characterized in that The method further comprises: After executing step (4'), return to step (4) again, and execute steps (4)-(4') in a loop until the out-degree numbers of all nodes in the directed graph are greater than the set out-degree number limit, and there is no node with an in-degree of 0 in the directed graph.

10. The method according to claim 8 or 9, characterized in that: The method further comprises, between step (4) and step (4'): (4") deleting redundant out-degrees of each node in the directed graph, wherein the redundant out-degrees are out-degrees exceeding a set out-degree number limit.

11. The method according to claim 10, characterized in that The method further comprises: After executing step (4'), return to step (3) again, and repeat steps (3)-(4)-(4")-(4') until the out-degree numbers of all nodes in the directed graph are greater than the set out-degree number limit, and there are no nodes with an in-degree of 0 in the directed graph.

12. A device for generating DNA storage encoding and decoding rules, characterized in that: The device comprises: A sliding window setting unit, used to set a sliding window (n, k) of the DNA storage encoding and decoding rule, where n represents the length of the sliding window, k represents the length of the base character of each sliding, where n, k are positive integers, and n≥k; A qualified sequence screening unit is used to obtain a full set of sequences based on the length n of the sliding window, wherein the full set of sequences is a set of all base sequences formed by random combinations of all possible bases at each base position within the length range of the sliding window, and to screen out a set of qualified sequences in the full set of sequences that meet the restriction conditions using restriction conditions, wherein the restriction conditions are set based on sequence features in the full set of sequences; A directed graph connection unit, used to connect the sequences in the qualified sequence set in a directed graph, wherein each node in the directed graph represents each sequence; An out-degree violation deletion unit is used to delete nodes in the directed graph whose out-degree number is less than a set out-degree limit; A redundant out-degree deleting unit, used to delete the redundant out-degree of each node in the directed graph, wherein the redundant out-degree is the out-degree exceeding the set out-degree number limit; The algorithm chart obtaining unit is used to obtain an algorithm chart, wherein the algorithm chart includes DNA storage encoding and decoding rules.

13. A DNA storage encoding method, characterized in that: The method comprises: Obtaining the DNA storage encoding and decoding rules generated by the method described in any one of claims 1 to 11, and setting an initial node, and setting the initial node as the current node; Obtain a binary sequence to be encoded and slice it to generate binary slices, convert the binary value corresponding to the slice into an out-degree node or multiple out-degree nodes connected to the current node, wherein each out-degree node describes a nucleic acid fragment, and the binary slice and the corresponding nucleic acid fragment form a pair of mapping relationships; According to the DNA storage encoding and decoding rules, the binary slices are input, the nucleic acid fragments mapped by the out-degree node or multiple out-degree nodes are output, and the out-degree node is updated as the current node, and the binary slices are input and the nucleic acid fragments are output in a loop according to the order of the binary slices until all the binary slices are input; The nucleic acid fragments are connected in sequence according to the output order and the complete DNA sequence is output.

14. The method according to claim 13, characterized in that The method slices the binary sequence to be encoded according to a length of 2k-1, where k represents the base character length of each sliding of the sliding window.

15. The method according to claim 13, characterized in that The method also includes: synthesizing the DNA sequence and then storing it in an in vitro medium or in a living cell.

16. A DNA storage encoding device, characterized in that: The device comprises: A coding and decoding rule acquisition unit, used to acquire the DNA storage coding and decoding rule generated by the method according to any one of claims 1 to 11, and set an initial node, and set the initial node as the current node; A binary sequence slicing and conversion unit, used to obtain a binary sequence to be encoded and slice it to generate a binary slice, and convert the binary value corresponding to the slice into an out-degree node or multiple out-degree nodes connected to the current node, wherein each out-degree node describes a nucleic acid fragment, and the binary slice and the corresponding nucleic acid fragment form a pair of mapping relationships; A nucleic acid fragment output unit is used to input the binary slice according to the DNA storage encoding and decoding rule, output the nucleic acid fragment mapped by the out-degree node or multiple out-degree nodes, and update the out-degree node as the current node, and continuously input binary slices and output nucleic acid fragments in a loop according to the order of the binary slices until all the binary slices are input; The nucleic acid fragment connection unit is used to connect the nucleic acid fragments in sequence according to the output order and output a complete DNA sequence.

17. The device according to claim 16, characterized in that The binary sequence to be encoded is sliced ​​according to a length of 2k-1, where k represents the base character length of each sliding of the sliding window.

18. A DNA storage decoding method, characterized in that: The method comprises: Obtaining the DNA storage encoding and decoding rules generated by the method described in any one of claims 1 to 11, and setting an initial node, and setting the initial node as the current node; Obtain a DNA sequence to be decoded and slice it to generate a nucleic acid slice, and find an out-degree node or multiple out-degree nodes connected to the current node according to the DNA storage encoding and decoding rule and the nucleic acid information corresponding to the slice, wherein each out-degree node describes a nucleic acid information, and the nucleic acid slice and the corresponding binary value or binary slice form a pair of mapping relationships; According to the current node and the out-degree node or the multi-layer out-degree node, a binary value or a binary slice between nodes is obtained according to the mapping relationship, and the out-degree node is updated as the current node, and nucleic acid slices are continuously input and binary values ​​or binary slices are outputted in a loop according to the sequence of the nucleic acid slices until all the nucleic acid slices are input; The binary values ​​or binary slices are sequentially connected in output order and a complete binary sequence is output.

19. The method according to claim 18, characterized in that The method slices the DNA sequence to be decoded according to the length of k, wherein k represents the length of the base characters of each sliding of the sliding window.

20. The method according to claim 18, characterized in that The DNA sequence to be decoded is generated by encoding using the method according to claim 13 or 14 or the device according to claim 16 or 17.

21. A DNA storage decoding device, characterized in that: The device comprises: A coding and decoding rule acquisition unit, used to acquire the DNA storage coding and decoding rule generated by the method according to any one of claims 1 to 11, and set an initial node, and set the initial node as the current node; A DNA slicing and conversion unit is used to obtain a DNA sequence to be decoded and slice it to generate a nucleic acid slice, and find an out-degree node or multiple out-degree nodes connected to the current node and the current node according to the DNA storage encoding and decoding rules and the nucleic acid information corresponding to the slice, wherein each out-degree node describes a nucleic acid information, and the nucleic acid slice and the corresponding binary value or binary slice form a pair of mapping relationships; A binary value output unit is used to obtain binary values ​​or binary slices between nodes according to the mapping relationship based on the current node and the out-degree node or the multi-layer out-degree node, and update the out-degree node to the current node, and continuously and cyclically input nucleic acid slices and output binary values ​​or binary slices according to the slice sequence of the nucleic acid until all the nucleic acid slices are input; The binary value connection unit is used to connect the binary values ​​in sequence according to the output order and output a complete binary sequence.

22. The device according to claim 21, characterized in that The DNA sequence to be decoded is sliced ​​according to the length of k, where k represents the length of the base character of each sliding of the sliding window.

23. A computer-readable storage medium, characterized in that: The method comprises a program which can be executed by a processor to implement the method according to any one of claims 1 to 11, the method according to any one of claims 13 to 15, or the method according to any one of claims 18 to 20.

Images