Reagents, kits and methods for four-way detection of pathogens of white shrimp

Abstract

The present invention discloses a reagent, a kit and a method for detecting a white shrimp pathogen in a quadruple manner, and belongs to the field of aquatic biological gene detection. The present invention provides a reagent for detecting a white shrimp pathogen in a quadruple manner, and the reagent includes 25 to 35 primer mixtures of SEQ ID No. 1 to SEQ ID No. 16, and also includes 20 to 30 parts of reagent A; 5 to 15 parts of reagent B, 5 to 15 parts of reagent C, 35 to 40 parts of reagent D, 5 to 15 parts of reagent E, and 100 to 120 parts of ultrapure water. The present invention also provides a method for detecting white shrimp pathogens using the kit. When the reagent, kit and method provided by the present invention are used to detect white shrimp pathogens, results can be obtained quickly and accurately, which is conducive to rapid on-site detection.

Description

Technical Field

[0001] The present invention relates to the field of aquatic biological gene detection, and in particular to a reagent, a kit and a method for quadruple detection of white shrimp pathogens. Background Art

[0002] Enterocytozoon hepatopenaei (EHP) is classified in the kingdom Fungi, phylum Microsporidia, class Haploidia, order Chytridiomycota, family Enterocytidae, genus Enterocytidae. The basic structure of EHP consists of cell wall, anchoring disk, sporoplasm, 5-6 polar filaments, 1 nucleus, polar membrane layer, multiple ribosomes, 1 post-vacuole, etc. The mature spores are oval and 0.7μm×1.1μm in size. Since its discovery, EHP has caused varying degrees of damage to shrimp farming around the world, but due to its biological characteristics, that is, mature spores have a tough chitin shell, there is no effective drug that can kill or control its development.

[0003] Acute hepatopancreas necrosis syndrome (AHPNS) mainly occurs in shrimp seedlings in the early stage, and is also known as early mortality syndrome (EMS). In May 2013, the International Aquaculture Association (GAA) and the Food and Agriculture Organization of the United Nations (FAO) announced that the pathogen causing AHPNS is a specific variant of Vibrio parahaemolyticus (VP), acute hepatopancreas necrosis. After years of research, it has been confirmed that the main pathogen of AHPNS is the toxin proteins Pir A and Pir B secreted by the intracellular plasmids carried by VP, and this gene can be transmitted between Vibrio, resulting in some Vibrio besides VP being able to cause AHPNS.

[0004] White spot syndrome virus (WSSV) belongs to the family Nematoviridae and the genus leucovirus. It is a double-stranded DNA subgroup baculovirus that often forms clusters or disperses in the nucleus or cytoplasm of the infected cells. The widespread prevalence of WSSV is one of the most serious infectious shrimp diseases known in the world. Once infected, the mortality rate can reach 80% to 100%.

[0005] Decapod iridescent virus 1 (DIV1) is a large icosahedral virus with a linear double-stranded DNA structure and a size of 150-160 nm. The iridovirus was first found in a shrimp farm in Ecuador. It was not until March 2019 that the International Committee on Taxonomy of Viruses (ICTV) classified the red claw crayfish iridovirus (CQIV) and shrimp hemecyteiridovirus (SHIV) as a new genus of the Iridoviridae family, the genus Decapoda Iridovirus.

[0006] The Chinese invention patent with patent number CN201710030873.0 discloses a multiplex PCR detection method and kit for simultaneously detecting WSSV, AHPND, EHP, and IHHNV in shrimp. The method and kit adopt a multiplex PCR detection method, which can simultaneously use the special detection primers WSSV-F and WSSV-R, AHPND-F and AHPND-R, EHP-F and EHP-R, IHHNV-F and IHHNV-R of WSSV, AHPND, EHP, and IHHNV to amplify the four pathogenic DNAs at one time. However, this technology belongs to multiplex PCR, and its results need to be further subjected to agarose gel electrophoresis to be displayed. The overall technical operation is complicated and not conducive to rapid on-site detection. Summary of the invention

[0007] The problem to be solved by the present invention is how to improve the detection speed of the four white shrimp pathogens described in the background technology to facilitate rapid on-site detection.

[0008] In order to solve the above problems, the present invention provides a reagent for quadruple detection of white shrimp pathogens, the reagent comprising a primer mixture, the primer mixture comprising the following primer groups:

[0009] Shrimp hepatocellular carcinoma detection primer set:

[0010] SEQ ID No. 1 is the upstream external primer: GATGCAAAGAGATATGTTGAAAG;

[0011] SEQ ID No. 2 is the downstream external primer: TGCTTTAAGGTTTACAGTGTT;

[0012] SEQ ID No. 3 is the upstream internal primer: CGCATTTTTCTGTACCTGTTTTGTTGAATACATTCATACAAAGTTACCAG;

[0013] SEQ ID No. 4 is the downstream internal primer: GCAGAGTGTTGTTAAGGGTTTAAGTTGAAATTGTATTTGACCAATGGT;

[0014] Primer set for detection of acute hepatopancreatic necrosis Vibrio:

[0015] SEQ ID No. 5 is the upstream external primer: AACTTACCATTTACAACGCC;

[0016] SEQ ID No. 6 is the downstream external primer: ACGAGCATTGTTAGGGTT;

[0017] SEQ ID No. 7 is the upstream internal primer: GAAACCACGACTAGCGCCATT-TGATAATGCATTCTATCATCAGC;

[0018] SEQ ID No. 8 is the downstream internal primer: ATTACCACTAAGAAGGTGCTCACA-AAATTCCGTCAAAGATGACAT;

[0019] White Spot Syndrome Virus Detection Primer Set:

[0020] SEQ ID No. 9 is the upstream external primer: ACTAGGCTCTGACGACCT;

[0021] SEQ ID No. 10 is a downstream external primer: GGCGTTCTTTTCTTCGAATGT;

[0022] SEQ ID No. 11 is the upstream internal primer: GGACGGGACCATTGTTGGATGT-TGGAGGAGTAGAATCAATGGAT;

[0023] SEQ ID No. 12 is the downstream internal primer: ACACTAATTTCCGGCAAGGCAG-AATCAAAGGCGAGAGGGC;

[0024] Decapoda Iridescent Virus I Detection Primer Set:

[0025] SEQ ID No. 13 is the upstream external primer: TGTTAGATGGGCAGTCATG;

[0026] SEQ ID No. 14 is a downstream external primer: GCATCCTTGATTGCTGGA;

[0027] SEQ ID No. 15 is the upstream internal primer: ACGAATCGTTTCCCGTGAGA-CAAATGCTGACGAAATCATCA;

[0028] SEQ ID No. 16 is the downstream internal primer: TGGGCTCGAGATTTGTTCCAAC-GCTTGTTGCAAATCATGTGTA.

[0029] The primer mixture provided by the invention can simultaneously detect shrimp hepatocellular carcinoma and Vibrio parahaemolyticus variant VP AHPND , white spot syndrome virus, and decapod iris virus I. Among them, the NCBI classification number of the reference gene of the shrimp hepatocellular carcinoma detection primer set is MG015710.1; the NCBI classification number of the reference gene of the acute hepatopancreatic necrosis Vibrio detection primer set is MH700244.1; the NCBI classification number of the reference gene of the shrimp white spot syndrome virus detection primer set is MN481520.1; and the NCBI classification number of the reference gene of the decapod iris virus I detection primer set is KY681040.1.

[0030] Preferably, in the primer mixture, by molar ratio, there are 1 to 3 parts of total upstream external primers, 1 to 3 parts of total downstream external primers, 5 to 10 parts of total upstream internal primers, and 5 to 10 parts of total downstream internal primers. When performing loop-mediated isothermal amplification, the reagents provided by the present invention have been pre-added with primers, and the operation is simple when used.

[0031] Preferably, the reagents further comprise reagent A, reagent B, reagent C, reagent D, reagent E and ultrapure water. By volume ratio, the primer mixture comprises 25 to 35 parts, reagent A comprises 20 to 30 parts, reagent B comprises 5 to 15 parts, reagent C comprises 5 to 15 parts, reagent D comprises 35 to 40 parts, reagent E comprises 5 to 15 parts and ultrapure water comprises 100 to 120 parts.

[0032] Preferably, the reagent A is 10×Bst Buffer; the reagent B is 100mM magnesium sulfate; the reagent C is hydroxynaphthol blue; the reagent D is 10mM dNTP premix; and the reagent E is DNA polymerase. The reagent for detecting white shrimp pathogens provided by the present invention can be used for loop-mediated isothermal amplification. Hydroxynaphthol blue, as an indicator in the loop-mediated isothermal amplification technology, can combine with magnesium ions to change the color of the solution to violet. During the loop-mediated isothermal amplification, a large amount of byproduct pyrophosphate ions will be generated to react with magnesium ions to form insoluble magnesium pyrophosphate, thereby reducing the magnesium ion concentration in the solution and changing the color of the solution to blue.

[0033] Furthermore, the second aspect of the present invention provides a kit for detecting pathogens of white shrimp in a quadruple manner, the kit comprising a positive control, a negative control and the above reagents. The positive control and the negative control can perform quality control and calibration on the whole detection to ensure the reliability of the experimental results. Therefore:

[0034] Preferably, the positive control is a plasmid mixture of a plasmid carrying a shrimp hepatocystis gene, a plasmid carrying a Vibrio acute hepatopancreatic necrosis gene, a plasmid carrying a shrimp white spot syndrome virus gene, and a plasmid carrying a decapod rainbow virus gene.

[0035] Preferably, the negative control is selected from one or more of ultrapure water, sodium chloride solution, potassium chloride solution, Dulbecco's phosphate solution, and Tris-HCl solution.

[0036] Furthermore, the third aspect of the present invention provides a method for detecting multiple white shrimp pathogens using the aforementioned kit, comprising the following steps:

[0037] S1: Extract DNA template from test sample;

[0038] S2: performing loop-mediated isothermal amplification on the positive control, negative control and DNA template obtained in step S1 respectively;

[0039] S3: Get experimental results.

[0040] The aforementioned kit uses primers to perform loop-mediated isothermal amplification technology to amplify the test sample, and detects four white shrimp pathogens, including shrimp hepatocellular carcinoma, acute hepatopancreatic necrosis Vibrio, shrimp white spot syndrome virus, and decapod rainbow virus I. The loop-mediated isothermal amplification technology is an emerging nucleic acid amplification method. In the method provided by the present invention, the aforementioned kit uses hydroxynaphthol blue as an indicator, and can directly determine whether the test sample is infected with the pathogen by color changes.

[0041] Preferably, in step S1, the test sample is selected from one or more of gills, visceral tissue, muscle tissue, hemolymph, environmental samples, cells or cell cultures. Step S1 is to extract DNA from the test sample, and any specimen containing the above four white shrimp pathogens can be used as a test sample for detection. It should be noted that if a commercial DNA extraction kit is used, the operation must be performed according to the method described in the instructions; when a commercial DNA extraction kit is not used for extraction, the national operating specifications for nucleic acid extraction should be followed.

[0042] Preferably, in step S2, the amplification program of the loop-mediated isothermal amplification is: the temperature is set to 65° C., and the amplification time is 60 min.

[0043] Compared with the prior art, the present invention has the following beneficial effects: the ultimate purpose of the reagent, kit and method for the four-joint detection of white shrimp pathogens provided by the present invention is to use loop-mediated isothermal amplification technology for detection, which has the advantages of simple operation and high detection efficiency compared with traditional PCR and real-time fluorescence quantitative PCR. At the same time, the present invention sets special LAMP primers for conservative fragments of various pathogens to improve the accuracy of detection. The present invention creatively uses hydroxynaphthol blue as an indicator, which can better judge whether a reaction occurs and achieve a higher sensitivity effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 This is a graph showing the results of a sensitivity test of the kit provided by the present invention for infectious subcutaneous and hematopoietic necrosis viruses in a specific embodiment of the present invention;

[0045] Figure 2 This is a diagram showing the results of a sensitivity test of the kit provided by the present invention for acute hepatopancreatic necrosis Vibrio in a specific embodiment of the present invention;

[0046] Figure 3 This is a diagram showing the results of a sensitivity test of the kit provided by the present invention for white spot syndrome virus of shrimp in a specific embodiment of the present invention;

[0047] Figure 4 This is a graph showing the results of a sensitivity test of the kit provided by the present invention for decapod rainbow virus in a specific embodiment of the present invention;

[0048] Figure 5 This is a graph showing the experimental results of negative control in a stability experiment of shrimp hepatocellular carcinoma detection using the kit provided by the present invention in a specific embodiment of the present invention;

[0049] Figure 6 This is a graph showing the experimental results of the positive group in the stability test of shrimp hepatoenterocystis detection by the kit provided by the present invention in a specific embodiment of the present invention;

[0050] Figure 7 This is a graph showing the experimental results of a negative control in a stability experiment for detecting acute hepatopancreatic necrosis Vibrio using the kit provided by the present invention in a specific embodiment of the present invention;

[0051] Figure 8 This is a graph showing the experimental results of the positive group in the stability test of acute hepatopancreatic necrosis Vibrio detected by the kit provided by the present invention in a specific embodiment of the present invention;

[0052] Fig. 9 This is a graph showing the experimental results of a negative control in a stability experiment for detecting white spot syndrome virus of shrimp using the kit provided by the present invention in a specific embodiment of the present invention;

[0053] Fig.10 This is a graph showing the experimental results of the positive group in the stability test of the white spot syndrome virus detection of shrimp in the kit provided by the present invention in a specific embodiment of the present invention;

[0054] Fig.11 This is a graph showing the experimental results of a negative control in a stability test of decapod rainbow virus detection using the kit provided by the present invention in a specific embodiment of the present invention;

[0055] Fig.12 This is a graph showing the experimental results of the positive group in the stability test of decapod rainbow virus detection by the kit provided by the present invention in a specific embodiment of the present invention. DETAILED DESCRIPTION

[0056] In order to make the above-mentioned purposes, features and advantages of the present invention more obvious and easy to understand, the specific embodiments of the present invention are described in detail below. It should be noted that the following embodiments are only used to illustrate the implementation method and typical parameters of the present invention, and are not used to limit the parameter range described in the present invention. Reasonable changes derived therefrom are still within the scope of protection of the claims of the present invention.

[0057] It should be noted that the endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be regarded as specifically disclosed in this article.

[0058] Unless otherwise defined, all terms, symbols and other scientific terms used herein are intended to have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. In some cases, terms with conventionally understood meanings are defined herein for the purpose of clarification or ease of reference, and such definitions herein should not be construed as indicating significant differences from conventional understandings in the art. The technical methods described or cited herein are generally well understood by those skilled in the art and are adopted by conventional methods. Unless otherwise stated, the use of commercially available kits, reagents and instruments is carried out in accordance with the protocols and parameters given by the manufacturer.

[0059] As described in the background technology, the existing technology for detecting white shrimp pathogens has the disadvantages of slow detection speed and complicated operation. The specific embodiment of the present invention aims to provide a reagent, a kit and a detection method for four-way detection of white shrimp pathogens (shrimp hepatoenterozoa, acute hepatopancreatic necrosis Vibrio, shrimp white spot syndrome virus, decapod rainbow virus I). The loop-mediated isothermal amplification technology is used to detect one or more test samples in gills, visceral tissues, muscle tissues, hemolymph, environmental samples, cells or cell cultures, wherein the primers used are primers in SEQ ID No.1 to SEQ ID No.16, and the specific detection steps are:

[0060] S1: Extract DNA sample from test sample;

[0061] S2: performing loop-mediated isothermal amplification on the DNA sample, positive control, and negative control obtained in step S1, respectively;

[0062] S3: Obtain and judge the experimental results.

[0063] In a specific embodiment of the present invention, hydroxynaphthol blue is used as an indicator for loop-mediated isothermal amplification, which allows the detection result to be judged by the naked eye, which is conducive to rapid on-site detection.

[0064] Example 1

[0065] This embodiment provides a reagent and a kit for quadruple detection of four white shrimp pathogens, namely, shrimp hepatocystis, acute hepatopancreatic necrosis Vibrio, white spot syndrome virus, and decapod rainbow virus I. Each reagent includes the following substances:

[0066]

[0067] Among them, since the kit provided in this embodiment can detect four white shrimp pathogens, 16 primers are involved, and the sequences of the 16 primers are shown in SEQ ID No.1 to SEQ ID No.16. The 16 primers are divided into 4 groups, 4 in each group. Therefore, this embodiment uses an upstream external primer (F3), a downstream external primer (B3), an upstream internal primer (FIP), and a downstream internal primer (BIP) to limit the content of the primers. The composition of each primer mixture is as follows:

[0068] F3 (100 μM) 0.1 μL

[0069] B3 (100 μM) 0.1 μL

[0070]

[0071] A positive control was prepared, which was a mixture of plasmids carrying genes of Enterocytozoa hepatopancreatica, plasmids carrying genes of Vibrio acute hepatopancreatic necrosis, plasmids carrying genes of white spot syndrome virus of shrimp, and plasmids carrying genes of decapod rainbow virus I.

[0072] A negative control was prepared, which was normal saline.

[0073] Example 2

[0074] Sensitivity test

[0075] Positive controls were prepared, including plasmids carrying genes of shrimp enterocytosis, plasmids carrying genes of acute hepatopancreatic necrosis Vibrio, plasmids carrying genes of white spot syndrome virus of shrimp, and plasmids carrying genes of decapod rainbow virus I.

[0076] Ultrapure water was used to dilute the above four plasmids to 100 copies / μL, 101 copies / μL, 102 copies / μL, 103 copies / μL, 104 copies / μL, and 105 copies / μL, respectively. Ultrapure water was used as a control, and a portion of the reagent prepared in Example 1 was taken, and different concentrations of plasmids and ultrapure water were added thereto. Constant temperature amplification was performed on the machine, and the amplification program was as follows: the temperature was set at 65°C, and the amplification time was 60 minutes.

[0077] After amplification, place the PCR tube on a white background, observe the color of the solution in the tube, and judge the experimental results.

[0078] Figure 1 The sensitivity test results of shrimp hepatocellular carcinoma are shown in the figure, where the plasmid concentrations from left to right are 0 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL, 0 copies / μL, from which it can be seen that the minimum detection limit of the kit provided in Example 1 of the present invention for shrimp hepatoenterocystis is 10 2 copies / μL, extremely low detection limit and high sensitivity.

[0079] Figure 2 This is the result of the sensitivity detection experiment of acute hepatopancreatic necrosis Vibrio, in which the plasmid concentrations from left to right are 0 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 103 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL, 0 copies / μL, from which it can be seen that the minimum detection limit of the kit provided in Example 1 of the present invention for acute hepatopancreatic necrosis Vibrio is 10 0 copies / μL, with low detection limit and high sensitivity.

[0080] Figure 3 The sensitivity test results of white spot syndrome virus in shrimp are shown in the figure, where the plasmid concentrations from left to right are 0 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL, 0 copies / μL, from which it can be seen that the minimum detection limit of the kit provided in Example 1 of the present invention for white spot syndrome virus of shrimp is 10 0 copies / μL, extremely low detection limit and high sensitivity.

[0081] Figure 4 This is the result of the sensitivity test of decapod rainbow virus I, where the plasmid concentrations from left to right are 0 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL, 0 copies / μL, from which it can be seen that the minimum detection limit of the kit provided in Example 1 of the present invention for decapod rainbow virus I is 10 2 copies / μL, extremely low detection limit and high sensitivity.

[0082] Example 3

[0083] Stability test

[0084] Experimental study on stability of detection of hepatocellular carcinoma in shrimp

[0085] Take 32 PCR tubes and add the following reagents to each tube:

[0086]

[0087] Add 1 μL of a total concentration of 10 4 The mixture of plasmids carrying the gene of Vibrio acute hepatopancreatic necrosis, plasmid carrying the gene of white spot syndrome virus of shrimp, and plasmid carrying the gene of decapod rainbow virus I at 100 copies / μL was recorded as negative control.

[0088] Add 1 μL of a total concentration of 10 to the remaining 16 PCR tubes. 4 The mixture of plasmids carrying genes of Enterocytosis hepatocellularis, Vibrio acute hepatopancreatic necrosis, White Spot Syndrome Virus, and Decapoda Rainbow Virus I at 100 copies / μL was recorded as the positive group.

[0089] The 32 processed PCR tubes were put into the machine for constant temperature amplification. The amplification program was as follows: the temperature was set at 65°C and the amplification time was 60 minutes.

[0090] After amplification, place the PCR tube on a white background, observe the color of the solution in the tube, and judge the experimental results.

[0091] Stability test of acute hepatopancreatic necrosis Vibrio

[0092] Take 32 PCR tubes and add the following reagents to each tube:

[0093]

[0094] Add 1 μL of a total concentration of 10 4 A mixture of plasmids carrying genes of Enterocytosis hepatocellularis, white spot syndrome virus and decapod rainbow virus I at 1000 copies / μL was recorded as negative control.

[0095] Add 1 μL of a total concentration of 10 to the remaining 16 PCR tubes. 4 The mixture of plasmids carrying genes of Enterocytosis hepatocellularis, Vibrio acute hepatopancreatic necrosis, White Spot Syndrome Virus, and Decapoda Rainbow Virus I at 100 copies / μL was recorded as the positive group.

[0096] The 32 processed PCR tubes were put into the machine for constant temperature amplification. The amplification program was as follows: the temperature was set at 65°C and the amplification time was 60 minutes.

[0097] After amplification, place the PCR tube on a white background, observe the color of the solution in the tube, and judge the experimental results.

[0098] Stability test of white spot syndrome virus detection in shrimp

[0099] Take 32 PCR tubes and add the following reagents to each tube:

[0100]

[0101] Add 1 μL of a total concentration of 10 4 The mixture of plasmids carrying genes of Enterocytosis hepatocellularis, Vibrio acute hepatopancreatic necrosis and Decapoda rainbow virus I at 100 copies / μL was recorded as the positive group.

[0102] Add 1 μL of a total concentration of 10 to the remaining 16 PCR tubes. 4 The mixture of plasmids carrying genes of Enterocytosis hepatocellularis, Vibrio acute hepatopancreatic necrosis, White Spot Syndrome Virus, and Decapoda Rainbow Virus I at 100 copies / μL was recorded as the positive group.

[0103] The 32 processed PCR tubes were put into the machine for constant temperature amplification. The amplification program was as follows: the temperature was set at 65°C and the amplification time was 60 minutes.

[0104] After amplification, place the PCR tube on a white background, observe the color of the solution in the tube, and judge the experimental results.

[0105] Stability test of decapod rainbow virus detection

[0106] Take 32 PCR tubes and add the following reagents to each tube:

[0107]

[0108] Add 1 μL of a total concentration of 10 4 The mixture of plasmids carrying genes of Enterocytosis hepatocellularis, Vibrio acute hepatopancreatic necrosis and White Spot Syndrome Virus of shrimp at 100 copies / μL was recorded as the positive group.

[0109] Add 1 μL of a total concentration of 10 to the remaining 16 PCR tubes. 4 The mixture of plasmids carrying genes of Enterocytosis hepatocellularis, Vibrio acute hepatopancreatic necrosis, White Spot Syndrome Virus, and Decapoda Rainbow Virus I at 100 copies / μL was recorded as the positive group.

[0110] The 32 processed PCR tubes were put into the machine for constant temperature amplification. The amplification program was as follows: the temperature was set at 65°C and the amplification time was 60 minutes.

[0111] After amplification, place the PCR tube on a white background, observe the color of the solution in the tube, and judge the experimental results.

[0112] Figure 5 These are the experimental results of the negative control in the shrimp hepatoenteric cytidylcholine detection stability experiment. It can be seen that the relevant primers and reagents have high specificity and stability for shrimp hepatoenteric cytidylcholine.

[0113] Figure 6 These are the experimental results of the positive group in the shrimp hepatoenteric cytidylcholine detection stability experiment. It can be seen that the relevant primers and reagents have high specificity and stability for shrimp hepatoenteric cytidylcholine.

[0114] Figure 7 These are the experimental results of the negative control in the stability experiment of detecting Vibrio necrosis of acute hepatopancreas. It can be seen that the relevant primers and reagents have high specificity and stability for Vibrio necrosis of acute hepatopancreas.

[0115] Figure 8 These are the experimental results of the positive group in the stability experiment of detecting Vibrio necrosis caused by acute hepatopancreatic necrosis. It can be seen that the relevant primers and reagents have high specificity and stability for Vibrio necrosis caused by acute hepatopancreatic necrosis.

[0116] Fig. 9 These are the experimental results of the negative control in the stability experiment of white spot syndrome virus detection in shrimp. It can be seen that the relevant primers and reagents have high specificity and stability for white spot syndrome virus in shrimp.

[0117] Fig.10 These are the experimental results of the positive group in the stability experiment of white spot syndrome virus detection in shrimp. It can be seen that the relevant primers and reagents have high specificity and stability for white spot syndrome virus in shrimp.

[0118] Fig.11 These are the experimental results of the negative control in the stability experiment of decapod rainbow virus detection. It can be seen that the relevant primers and reagents have high specificity and stability for decapod rainbow virus.

[0119] Fig.12 These are the experimental results of the positive group in the stability experiment of decapod rainbow virus detection. It can be seen that the relevant primers and reagents have high specificity and stability for decapod rainbow virus.

[0120] Although the disclosure is disclosed as above, the protection scope of the disclosure is not limited thereto. Those skilled in the art can make various changes and modifications without departing from the spirit and scope of the disclosure, and these changes and modifications will fall within the protection scope of the present invention.

Claims

1. A reagent for detecting pathogens of white shrimp by quadruple detection, characterized in that: The reagents include a primer mixture, wherein the primer mixture The following primer sets are included: Shrimp hepatocellular carcinoma detection primer set: SEQ ID No. 1 is the upstream external primer: GATGCAAAGAGATATGTTGAAAG; SEQ ID No. 2 is the downstream external primer: TGCTTTAAGGTTTACAGTGTT; SEQ ID No. 3 is the upstream internal primer: CGCATTTTTCTGTACCTGTTTTGTTGAATACATTCATACAAAGTTACCAG; SEQ ID No. 4 is the downstream internal primer: GCAGAGTGTTGTTAAGGGTTTAAGTTGAAATTGTATTTGACCAATGGT; Primer set for detection of acute hepatopancreatic necrosis Vibrio: SEQ ID No. 5 is the upstream external primer: AACTTACCATTTACAACGCC; SEQ ID No. 6 is the downstream external primer: ACGAGCATTGTTAGGGTT; SEQ ID No. 7 is the upstream internal primer: GAAACCACGACTAGCGCCATT-TGATAATGCATTCTATCATCAGC; SEQ ID No. 8 is the downstream internal primer: ATTACCACTAAGAAGGTGCTCACA-AAATTCCGTCAAAGATGACAT; White Spot Syndrome Virus Detection Primer Set: SEQ ID No. 9 is the upstream external primer: ACTAGGCTCTGACGACCT; SEQ ID No. 10 is a downstream external primer: GGCGTTCTTTTCTTCGAATGT; SEQ ID No. 11 is the upstream internal primer: GGACGGGACCATTGTTGGATGT-TGGAGGAGTAGAATCAATGGAT; SEQ ID No. 12 is the downstream internal primer: ACACTAATTTCCGGCAAGGCAG-AATCAAAGGCGAGAGGGC; Decapoda Iridescent Virus I Detection Primer Set: SEQ ID No. 13 is the upstream external primer: TGTTAGATGGGCAGTCATG; SEQ ID No. 14 is a downstream external primer: GCATCCTTGATTGCTGGA; SEQ ID No. 15 is the upstream internal primer: ACGAATCGTTTCCCGTGAGA-CAAATGCTGACGAAATCATCA; SEQ ID No. 16 is the downstream internal primer: TGGGCTCGAGATTTGTTCCAAC-GCTTGTTGCAAATCATGTGTA.

2. The reagent for detecting pathogens of white shrimp according to claim 1, characterized in that: In the primer mixture, by molar ratio, there are 1 to 3 parts of total upstream external primers, 1 to 3 parts of total downstream external primers, 5 to 10 parts of total upstream internal primers, and 5 to 10 parts of total downstream internal primers.

3. The reagent for quadruple detection of white shrimp pathogens as claimed in claim 1, characterized in that: The reagents also include 10×Bst Buffer, 100 mM magnesium sulfate, hydroxynaphthol blue, 10 mM dNTP premix, DNA polymerase and ultrapure water. By volume, the primer mixture includes 25 to 35 parts, 10×Bst Buffer includes 20 to 30 parts, 100 mM magnesium sulfate includes 5 to 15 parts, hydroxynaphthol blue includes 5 to 15 parts, 10 mM dNTP premix includes 35 to 40 parts, DNA polymerase includes 5 to 15 parts and ultrapure water includes 100 to 120 parts.

4. A four-in-one kit for detecting pathogens of white shrimp, characterized in that: The kit comprises a positive control, a negative control and the reagent for quadruple detection of white shrimp pathogens according to any one of claims 1 to 3.

5. The kit for detecting pathogens of Penaeus vannamei by four-joint detection according to claim 4, characterized in that: The positive control is a plasmid mixture of a plasmid carrying a shrimp hepatocystis gene, a plasmid carrying an acute hepatopancreatic necrosis Vibrio gene, a plasmid carrying a shrimp white spot syndrome virus gene, and a plasmid carrying a decapod iridovirus I gene.

6. The kit for detecting pathogens of Penaeus vannamei by four combinations as claimed in claim 4, characterized in that: The negative control is selected from one or more of ultrapure water, sodium chloride solution, potassium chloride solution, Dulbecco's phosphate solution, and Tris-HCl solution.

7. An application of the kit for detecting pathogens of white shrimp using the quadruple combination as claimed in any one of claims 4 to 6, characterized in that: The application includes using the kit for detecting pathogens of white shrimp, specifically comprising the following steps: S1: Extract DNA template from test sample; S2: performing loop-mediated isothermal amplification on the positive control, negative control and DNA template obtained in step S1 respectively; S3: Get the experimental results, The application is for non-disease diagnosis purposes.

8. The use according to claim 7, characterized in that In step S1, the test sample is selected from one or more of gills, visceral tissue, muscle tissue, hemolymph, environmental samples, cells or cell cultures.

9. The use according to claim 7, characterized in that In step S2, the amplification program of the loop-mediated isothermal amplification is: the temperature is set to 65° C. and the amplification time is 60 min.

Images