Recessive powdery mildew resistance gene Clpm-2WF in watermelon and its application

Abstract

The invention discloses a recessive hereditary powdery mildew resistance gene for watermelon Clpm‑2WF Discovery and application in the breeding of new disease-resistant watermelon varieties. The present invention constructed 6 generations of genetic populations (P1, P2, F1, BC1P1, BC1P2, F2) using the powdery mildew-resistant watermelon inbred line R23 (P1) and the powdery mildew-susceptible inbred line R12 (P2). The powdery mildew resistance was determined to be recessive by inoculating the powdery mildew physiological race 2WF and performing disease identification. Using the extremely resistant and susceptible F2 individual plant resequencing data, the initial positioning interval of the disease-resistant gene was obtained through GWAS analysis, and then the F2:3 family was used for fine positioning. Disease-resistant genes were further screened based on the transcriptome data analysis before and after inoculation of the resistant and susceptible parents. Combining the results of fine positioning and transcriptome analysis, a recessive watermelon powdery mildew resistance gene was identified. Clpm‑2WF Based on the difference sites between resistant and susceptible materials, molecular marker primers were developed for assisted selection of powdery mildew resistant materials, providing genetic materials and methods for breeding powdery mildew resistant varieties of watermelon.

Description

Technical Field

[0001] The invention relates to the field of molecular biology, and in particular to a primer for detecting a powdery mildew resistance gene in watermelon and an application thereof. Background Art

[0002] Powdery mildew is a fungal disease that seriously harms watermelon production. It can occur throughout the growth period. Symptoms include the formation of a white powdery mold layer on leaves, stems, petioles and fruits, which continues to spread, leading to leaf death, reduced yields and economic losses. Pesticide control is the main method to deal with powdery mildew, but excessive use of pesticides can cause environmental pollution and make powdery mildew pathogens resistant to drugs. In addition, there are many physiological species of powdery mildew fungi, which poses a severe challenge to prevention and control. For the above reasons, discovering disease-resistant genes and cultivating disease-resistant varieties are the most economical and environmentally friendly methods to control watermelon powdery mildew.

[0003] There are currently three reported genes for resistance to powdery mildew race 1W. Pm1.1 is an incompletely dominant gene, and the linkage marker OP-483 is 3.6 cM away from its resistance locus. 1 ; pmr2.1 is located on chromosome 2 of watermelon, and its contribution to phenotypic variation is 80.0% (LOD = 30.76). There are two CAPS markers on both sides of this QTL, wsb2-24 (4.00 cM) and wsb2-39 (13.97 cM). 2 ClaPMR2 is a disease resistance protein obtained by analyzing the differentially expressed genes in the transcriptome of watermelon resistant materials after inoculation with physiological races for 1 week. This protein is homologous to the protein RPW8 that regulates powdery mildew resistance in Arabidopsis and is a NBS-LRR type disease resistance protein. 3 There are two genes in watermelon germplasm resource PI 270545 that are resistant to powdery mildew race 2WU.S.: the recessive high resistance gene pmr-1 and the dominant medium resistance gene Pmr-2 4 The disease resistance genes discovered above are only for powdery mildew races 1W and 2W-US, while race 2WF is more widely distributed in my country. 5-6 At present, there is no report on disease resistance genes against physiological race 2WF.

[0004] References:

[0005] 1.Kim,K.H.et al.Inheritance of resistance to powdery mildew in thewatermelon and development of a molecular marker for selecting resistantplants.Horticulture,Environment and Biotechnology 54,134-140(2013).

[0006] 2.Kim,K.H.et al.Major quantitative trait loci and putative candidategenes for powdery mildew resistance and fruit-related traits revealed by anintraspecific genetic map for watermelon(Citrullus lanatus var.Lanatus).PloSOne 10,e0145665(2015).

[0007] 3.Mandal,M.K.,Suren,H.,Kousik,C.Elucidation of resistance signalingand identification of powdery mildew resistant mapping loci(ClaPMR2)duringwatermelon-Podosphaera xanthii interaction using RNA-Seq and whole-genomeresequencing approach.Scientific Reports 10,14038(2020).

[0008] 4.Tetteh,A.Y.,Wehner,T.C.,Davis,A.R.Inheritance of resistance topowdery mildew race 2in Citrullus lanatus var.lanatus.HortScience 48,1227-1230(2013).

[0009] 5. Wang Juan, Gong Guoyi, Guo Shaogui, et al. Preliminary identification of physiological race differentiation of powdery mildew fungus on melon vegetables in Beijing. Chinese Vegetables 2006, 7-9 (2006).

[0010] 6. Wang Jianshe, Chen Hang. Identification of melon resistance to powdery mildew. Acta Agriculturae Boreali-Sinica. 2000, 15(1): 125-128.

[0011] 7. Liu Xin, Cheng Rui, Xu Binghua, Bai Tian, ​​Xu Wenzhao, Zhang Chaoyang, Luo Dexu, Zhao Jianfeng, Zhang Xingping, Sun Yudong. SNP markers based on KASP technology for watermelon variety fingerprint construction and seed purity detection[J]. Jiangsu Agricultural News, 2022, 38(05): 1348-1356. Summary of the invention

[0012] The invention aims to provide a watermelon recessive powdery mildew resistance gene Clpm-2WF and a detection primer and application thereof.

[0013] The present invention uses the watermelon disease-resistant inbred line R23 (P1) as an antigen and constructs F1, BC1P1, BC1P2 and F2 populations (474 ​​individual plants) with the susceptible parent R12 (P2). According to the disease resistance response of F1, BC1P1 and BC1P2 to the powdery mildew physiological race 2WF, it is determined that the powdery mildew resistance gene from R23 is a recessive disease resistance gene. Using the resistance-susceptibility phenotype data and resequencing data of 474 F2 individual plants to the powdery mildew physiological race 2WF, through GWAS analysis, combined with the transcriptome data analysis results of the resistant and susceptible parents at different infection times, the inventors located the recessive powdery mildew resistance gene, named Clpm-2WF.

[0014] To achieve the above object, the technical solution adopted by the present invention is:

[0015] A recessive powdery mildew resistance gene Clpm-2WF for watermelon, the nucleotide sequence of the gene Clpm-2WF is shown as SEQ ID NO: 1.

[0016] A primer pair for detecting the recessive powdery mildew resistance gene Clpm-2WF of watermelon, wherein the nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID NO: 3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 4.

[0017] A kit for detecting a recessive powdery mildew resistance gene Clpm-2WF in watermelon comprises the above primer pair and DdeI restriction endonuclease.

[0018] Further preferably, the method further comprises PCR buffer, dNTP, MgCl2, TaqDNA polymerase and ddH2O.

[0019] The watermelon recessive powdery mildew resistance gene Clpm-2WF, the primer pair, or the kit are used in detecting powdery mildew resistance watermelons or assisting in breeding powdery mildew resistance watermelon varieties.

[0020] A method for detecting watermelons resistant to powdery mildew comprises the following steps: using watermelon genomic DNA as a template, using the above primer pair or the above kit to perform PCR amplification, using DdeI restriction endonuclease to digest the amplified product, and detecting the digested product; if only one 168 bp band appears, the watermelon to be tested is resistant to powdery mildew.

[0021] Preferably, the PCR amplification reaction conditions are as follows: pre-denaturation at 94°C for 2 minutes; denaturation at 94°C for 30 seconds, annealing at 62°C for 30 seconds, extension at 72°C for 30 seconds, for a total of 35 cycles; and final complete extension at 72°C for 2 minutes.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] 1. The present invention discovered that the disease resistance of watermelon to the powdery mildew race 2WF is controlled by a recessive gene. Through GWAS analysis, genetic map construction and transcriptome data analysis results of resistant and susceptible parents at different infection times based on the resequencing data of 200 extremely resistant and susceptible F2 plants, the gene (ID number: ClG42_02g016130, reference genome: http: / / watermelondb.cn / # / map) was located and named Clpm-2WF. By detecting the gene sequence, it is possible to effectively detect whether the watermelon material is resistant to the powdery mildew race 2WF, that is, it is possible to quickly and high-throughput screen watermelon materials resistant to the powdery mildew race 2WF at the seedling stage or seed germination stage without inoculating powdery mildew, thereby improving the breeding efficiency of watermelon resistance to powdery mildew and shortening the breeding period. The use of disease-resistant watermelon varieties greatly avoids environmental pollution caused by excessive application of pesticides, effectively prevents the development of drug resistance by powdery mildew pathogens, reduces production costs, and increases planting benefits;

[0024] Second, the present invention successfully located the recessive powdery mildew resistance race 2WF gene Clpm-2WF of watermelon. The 2308th base of the coding region of the gene is G in the disease-resistant material and A in the disease-susceptible material (see SEQ ID NO: 1-2). The change of this site causes the change of amino acids, thus leading to the difference in watermelon's resistance to powdery mildew.

[0025] 3. In the present invention, a pair of dCAPS molecular marker primers were further developed based on the difference sites of Clpm-2WF gene between disease-resistant and susceptible materials, and the nucleotide sequences thereof are shown in Example 1; the accuracy of the molecular marker in the isolated population reached 100%, and the detection was convenient and rapid, and the amplification was stable. Watermelon materials containing disease-resistant genes could be screened out without inoculating powdery mildew, which could effectively improve breeding efficiency and reduce breeding costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 GWAS analysis was used to preliminarily locate the powdery mildew resistance gene on chromosome 2;

[0027] Figure 2 Fine mapping of the powdery mildew resistance gene to the physical position interval 29581906 to 29591789 on chromosome 2;

[0028] Figure 3 Sequence differences of Clpm-2WF gene coding region between resistant and susceptible materials;

[0029] Figure 4 The dCAPS-9839F / R marker was used to detect the gene resistant to watermelon powdery mildew.

[0030] Note: R23 in this patent is the experimental material Wm13 (material name: 2012WMH0980) in reference 7, and R12 is the experimental material Wm33 (material name: G38) in reference 7. DETAILED DESCRIPTION

[0031] In order to make the technical means, creative features, objectives and effects achieved by the present invention easy to understand, the present invention is further explained below in conjunction with specific implementation methods.

[0032] Example 1

[0033] Inheritance of powdery mildew resistance in watermelon and location and cloning of resistance genes:

[0034] 1) Genetic rules of powdery mildew resistance and location of resistance genes:

[0035] The watermelon disease-resistant inbred line R23 (P1) and the disease-susceptible inbred line R12 (P2) were used to construct F1, BC1P1, BC1P2 and F2 populations containing 474 plants. The leaf DNA of individual plants in the F2 population was extracted and stored for later sequencing. When the seedlings grew to 2-3 true leaves, the F1, BC1P1, BC1P2 and F2 populations containing 474 plants were inoculated with powdery mildew fungus 2WF (the suspension concentration was 1×10 6 / ml), placed in an environment with a temperature of 25℃ and a relative humidity of 80%, and investigated the disease after the onset of the disease. The diseased leaves were scanned with a scanner, and the image analysis software V2.0 (ASSESS2.0) was used to count and analyze the leaf lesion area. The leaf area infected with powdery mildew was compared with the diseased area of ​​the resistant and susceptible parents to determine the disease resistance of the plant. The disease was investigated 2-3 times with an interval of about 3-5 days, and the resistant and susceptible plants (100 plants each) and parents with extreme phenotypes in the F2 population were resequenced. The experimental results showed that after inoculation with powdery mildew, the F1 phenotype was all susceptible, and the resistance and sensitivity segregation ratios of BC1P1 and BC1P2 were both 1:1. Therefore, it was determined that the disease resistance of R23 was controlled by a recessive gene. By combining the identification results of the F2 population with the resequencing data of 200 extremely resistant and susceptible plants, the disease resistance gene was preliminarily located in the 1M interval at the end of chromosome 2 through GWAS analysis (such as Figure 1 The F2:3 families that underwent recombination in this interval were used for further inoculation and identification. Based on the phenotypic results, the disease resistance gene was further precisely located, and it was determined that the gene was located in the physical position interval of chromosome 2 from 29581906 to 29591789 (e.g. Figure 2 ). At the same time, transcriptome sequencing was performed on the resistant and susceptible parents before and after inoculation, and differentially expressed genes in the localization interval were analyzed. Combining the fine mapping results and transcriptome data screening, the inventors identified a watermelon powdery mildew resistance gene on chromosome 2, with gene ID number: ClG42_02g016130 (reference genome website: http: / / watermelondb.cn / # / map), named Clpm-2WF.

[0036] 2) Clpm-2WF cloning:

[0037] The total RNA of the leaves of the disease-resistant inbred line R23 and the disease-susceptible inbred line R12 was extracted by Trizol method, and cDNA was obtained by using TAKARA reverse transcription kit (Cat. No.: RR037A) according to the instructions. The CDS sequence of the Clpm-2WF gene from the translation start site ATG to the termination site TAA was amplified by PCR. The amplification primer sequences are as follows:

[0038] Clpm-2WF-F:5'-ATGTTGATTGGAAGCATTG-3'

[0039] Clpm-2WF-R:5'-TTAAATGGAAATGCTATTAGGA-3'

[0040] PCR amplification used Phanta Max Master Mix from Novagen. The specific reaction system was as follows: 25 μL of 2×Phanta Max Master Mix, 2 μL of Clpm-2WF-F / R (100 μmol / L), 20 μL of ddH2O, and finally 1 μL of cDNA diluted 2 times. The mixture was mixed and PCR was performed on ice throughout the process.

[0041] The PCR reaction procedure is as follows:

[0042]

[0043] The PCR product was sent to Qingdao Qingke Biotechnology Co., Ltd. for Sanger sequencing, and the sequences of the Clpm-2WF gene in the resistant and susceptible inbred lines were obtained as follows:

[0044] The CDS sequence of the WF gene of the disease-resistant inbred line Clpm-2 is shown in SEQ ID NO:1.

[0045] The CDS sequence of the WF gene of the susceptible inbred line Clpm-2 is shown in SEQ ID NO:2.

[0046] Analysis of the sequence differences between the two revealed that at position 2308 in the Clpm-2WF coding region (position 29586231 on chromosome 2), the resistant inbred line R23 had a base G, while the susceptible inbred line R12 had a base A (e.g. Figure 3 ), which was consistent with the resequencing result, indicating that the differential locus was linked to powdery mildew resistance.

[0047] Example 2 Detection of Molecular Markers of Watermelon Powdery Mildew Resistance Gene Clpm-2WF

[0048] In the present invention, for the 2308th differential site in the Clpm-2WF gene coding region of the obtained resistant and susceptible materials, appropriate primers were designed using the dCAPS Finder 2.0 website (http: / / helix.wustl.edu / dcaps / ). The primers had a mismatched base, thereby introducing the restriction site DdeI, and developing a pair of molecular markers:

[0049] dCAPS-9839F (SEQ ID NO: 3):

[0050] 5'-GACAAAATCTCAATAACTGACACCCCCC-3'

[0051] dCAPS-9839R (SEQ ID NO: 4):

[0052] 5'-TTACGGTGGCTTTGCTCCCAATAGA-3'

[0053] The PCR amplification product is 168bp. The PCR product is cut with DdeI. If the sample to be tested contains the disease resistance gene Clpm-2WF, the PCR product cannot be cut by DdeI and has only one band, i.e., 168bp; otherwise, the PCR product can be cut by DdeI into two bands: 140bp and 28bp or three bands: 168bp, 140bp, and 28bp. The above product can be obtained by polyacrylamide gel electrophoresis (PAGE) or 4% agarose gel electrophoresis.

[0054] Example 3 Application of molecular markers

[0055] In order to verify the validity of the above markers, 36 breeding materials were used to detect the Clpm-2WF allele.

[0056] (1) The CTAB method was used to extract watermelon genomic DNA.

[0057] (2) PCR amplification. PCR amplification used Taq Mix of Ruibo Xingke. The specific reaction system was as follows: 5 μL of 2×Taq Plus Master Mix, 0.4 μL of dCAPS-9839F / R (100 μmol / L), 3.2 μL of ddH2O, and finally 1 μL of template DNA was added and mixed for PCR. The whole process was performed on ice.

[0058] The PCR reaction procedure is as follows:

[0059]

[0060] (3) Enzyme digestion. The above PCR amplification product was used as a substrate and digested with DdeI. The enzyme digestion system was as follows:

[0061]

[0062] The above enzyme digestion system was placed in a PCR instrument or a constant temperature water bath and incubated at 37°C for 3-4 hours, and then incubated at 65°C for 20 minutes to terminate the enzyme digestion reaction.

[0063] (4) The digested product is subjected to polyacrylamide gel electrophoresis. The specific steps are as follows:

[0064] a) Wash the long and short glass plates with distilled water, dry them, wipe them with anhydrous ethanol, and dry them. Stack the two glass plates tightly and clamp them on the left and right sides to fix them.

[0065] b) Prepare 50mL gel solution: ddH2O 30mL + 30% acrylamide 13.3mL + 5×TBE 10mL + 10% ammonium persulfate 400μL + TEMED 33μL. After fully mixing, immediately pour into the gap between the two glass plates. Be careful and slow when pouring to avoid bubbles. After pouring, insert the comb and let the gel at room temperature for 0.5-1 hour.

[0066] c) Fix the gel plate on the electrophoresis tank, add 1×TBE buffer, and carefully remove the comb. Add 2μL of 6×DNA Loading Buffer to the digested product and mix thoroughly. Take 2-3μL and add it to the sample well. Run the electrophoresis at 220V for 50 minutes.

[0067] d) After electrophoresis, remove the gel from the glass plate and soak it in nucleic acid dye (add 30 μL StarStain Red Plus to every 100 mL electrophoresis buffer to make a 3× working concentration dye solution) for 15 min.

[0068] e) Analyze and photograph the stained gel under ultraviolet light.

[0069] (5) According to the expected test results, dCAPS-9839F / R has only one 168bp band in the disease-resistant material (R), while in the susceptible material (S), there are three bands: 168bp, 140bp, and 28bp (bands are not visible). According to the gel image, it can be found that there are 13 disease-resistant materials and 23 susceptible materials in the tested samples, and the genotype is consistent with the phenotype (such as Figure 4 ). Therefore, the dCAPS marker can be used as an ideal marker for Clpm-2WF allele detection, which is helpful for screening materials or varieties with powdery mildew resistance to race 2WF at the watermelon seedling stage, and has important application value in watermelon powdery mildew resistance breeding.

[0070] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments. The above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

[0071] SEQ ID NO: 1

[0072]

[0073] SEQ ID NO:2

[0074] A TGGGGGTGTCAGTTATTGAGATTTTGTCAAGGCATTCTTCAGATGAAGTGTATTTAGGGCAAAGAAGCGACCCTGAATGGACTTTGGATAAGGAAGCTTTGGAAGCATTTGAGAAGTTTGGGAAAAAGTTGGCTGAAATTGAAGGGAAGATTGCTATGAGAAATAAAGATCCTCAATTGAAAAATAGAGTAGGACCTGTGGATATGCCATATACTTTGTTGTTTCCTACTAGTTCAGAAGGTCTCACAGGTAGAGGAATTCC

Claims

1. A powdery mildew resistance gene for watermelon Clpm-2WF and the use of a kit for detecting the gene in detecting watermelons resistant to powdery mildew or assisting in breeding watermelon varieties resistant to powdery mildew, characterized in that: The gene Clpm-2WF The nucleotide sequence is shown in SEQ ID NO: 1; the kit contains a method for detecting the watermelon powdery mildew resistance gene Clpm-2WF A primer pair and DdeI restriction endonuclease, the nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID NO: 3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

4.

2. The use according to claim 1, characterized in that: The kit also contains PCR buffer, dNTPs, MgCl2, TaqDNA polymerase and ddH2O.

3. A method for detecting watermelon resistant to powdery mildew, characterized in that: Using watermelon genomic DNA as a template, PCR amplification is performed using the primer pair or kit described in claim 1, the amplified product is digested with DdeI restriction endonuclease, and the digested product is detected. If only a 168 bp band appears, the watermelon to be tested is resistant to powdery mildew.

4. The method according to claim 3, characterized in that: The PCR amplification reaction conditions are as follows: pre-denaturation at 94°C for 2 minutes; denaturation at 94°C for 30 seconds, annealing at 62°C for 30 seconds, extension at 72°C for 30 seconds, for a total of 35 cycles; and final extension at 72°C for 2 minutes.

Images