A method for identifying the insertion site of a transgenic element

Abstract

The present invention discloses a method for identifying a transgenic element insertion site, and relates to the field of biotechnology. The method for identifying a transgenic element insertion site of the present invention does not require genome fragmentation, linker connection or biotin labeling, but uses an in vitro transcription method to convert the flanking sequence information of the insertion site into RNA, and then removes the genome template by DNA enzyme, thereby simultaneously achieving the enrichment of effective information and the removal of background noise; the constructed amplicon library is suitable for high-throughput second-generation sequencing and long-read third-generation sequencing, and achieves deep sequencing and analysis of the flanking sequence of the insertion site at a lower cost and higher efficiency. The method for identifying a transgenic element insertion site of the present invention has the advantages of low cost and high accuracy.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a method for identifying a transgenic element insertion site. Background Art

[0002] In the study of gene function in plants and animals, molecular breeding, and gene therapy, it is often necessary to transfer and integrate exogenous gene fragments into the host cell genome. For the sake of safety, effectiveness, and rigor, it is very necessary to identify the insertion site of transgenic elements. Early studies used Southern hybridization to assess the copy number of transgenic elements, but this method had low resolution and could not determine the specific insertion site. Subsequently, various PCR-based methods were invented to identify insertion sites, including inverse PCR, splinkerette PCR, thermal asymmetric staggered PCR, linker ligation PCR, linear amplification PCR, etc. These methods were combined with Sanger sequencing to achieve effective identification of the insertion site of transgenic elements. However, these methods mostly use restriction endonucleases to interrupt the genome and connect linkers, or perform multiple rounds of PCR in complex templates, which have certain technical preferences and systematic errors, and the information of multiple insertion sites in the same sample needs to be disassembled by single clone sequencing, which greatly increases the workload.

[0003] The second-generation sequencing can obtain tens of millions of sequence results in a single machine test, and its library construction method also provides an anchor point for PCR enrichment of flanking sequences. On this basis, the identification of the insertion site of the transgenic element has achieved a new resolution. The identification of the insertion site based on high-throughput sequencing can be summarized into four main strategies: (1) Whole genome sequencing: that is, the genomic DNA of the transgenic sample is interrupted, and the second-generation sequencing library is constructed according to the standard process to obtain the sequencing information of the whole genome, and then the sequencing reads that are simultaneously aligned to the genome and the insertion element are extracted from it to determine the insertion site; (2) Adapter-ligation PCR enrichment method: Based on the Truseq second-generation sequencing library construction process, the genome is mechanically or enzymatically disrupted, and then the sequencing adapters are connected to the two ends of the DNA fragments. Subsequently, the specific primers on the insert element and a linker primer are used to perform two rounds of PCR reactions to enrich the DNA fragments containing the insert element, and then the DNA fragments are subjected to second-generation sequencing; (3) Tag-PCR enrichment method: Based on the Nextera second-generation sequencing library construction process, the genome is disrupted using Tn5 transposase, and asymmetric sequencing adapters are connected to both sides of the disrupted fragments. Subsequently, the specific primers on the insert element and a linker primer are used to perform two rounds of PCR reactions to enrich the DNA fragments containing the insert element, and then the DNA fragments are subjected to second-generation sequencing; (4) Biotin labeling enrichment method: During the execution of the above method, biotin-labeled oligonucleotides can be added to specifically identify the DNA fragments containing the insert element, and then affinity chromatography is performed using streptavidin magnetic beads to separate the effective information fragments from the background information fragments to achieve purification and enrichment.

[0004] The above-mentioned insertion site identification method based on high-throughput sequencing has the following shortcomings: (1) The coverage of the insertion site region by whole genome sequencing is very low, and the proportion of sequencing data containing the flanking sequence information of the insertion site accounts for less than 0.01% of the total sequencing data. In addition, the larger the genome, the lower the data utilization rate, which greatly increases the sequencing cost and is not suitable for routine high-throughput identification. (2) Although the adapter-ligation PCR and tag-PCR enrichment methods can enrich the insertion site region and greatly reduce the sequencing cost, 30-40 PCR cycles in a complex template system will produce a large number of chimeric molecules, resulting in false positive results and reduced accuracy. (3) Although the enrichment method based on biotin labeling can simplify the template of the PCR system to a certain extent and reduce the background noise signal, it requires additional hybridization incubation and affinity chromatography operations, which on the one hand increases the material, time and labor costs, and on the other hand, it will also cause template loss due to the limitation of affinity, which is not suitable for the identification of low template amount samples.

[0005] In summary, the identification method of transgenic element insertion sites needs to be further developed and improved to achieve the goals of efficiency, accuracy, convenience and economy, and to assist in the assessment and supervision of transgenic crops and biosafety. Summary of the invention

[0006] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a method for identifying the insertion site of a transgenic element.

[0007] To achieve the above object, the technical solution adopted by the present invention is: a method for identifying the insertion site of a transgenic element, comprising the following steps:

[0008] (1) Integrate the T7 promoter sequence and sequencing adapter 1 at both ends of the transgenic element, screen the positive strains and extract DNA to obtain genomic DNA;

[0009] (2) performing in vitro transcription using the genomic DNA from step (1) as a template, and purifying and recovering RNA;

[0010] (3) Reverse transcription of the RNA in step (2) to synthesize one strand to obtain cDNA;

[0011] (4) using primers to perform PCR amplification on the cDNA of step (3), and obtaining an amplicon library after purification;

[0012] (5) The amplicon library is subjected to magnetic bead sorting, and the recovered small fragments are subjected to high-throughput second-generation sequencing, and the large fragments are subjected to long-read third-generation sequencing to obtain sequencing data;

[0013] (6) Analyze the sequencing data and identify the insertion site of the transgenic element.

[0014] The present invention develops a new method for identifying the insertion site of a transgenic element. The method does not require genome fragmentation, linker ligation or biotin labeling. Instead, the flanking sequence information of the insertion site is converted into RNA by an in vitro transcription method, and then the genome template is removed by DNA enzyme, thereby simultaneously achieving the enrichment of effective information and the removal of background noise. The constructed amplicon library is suitable for high-throughput second-generation sequencing and long-read third-generation sequencing, and achieves deep sequencing and analysis of the flanking sequences of the insertion site at a lower cost and higher efficiency.

[0015] As a preferred embodiment of the method for identifying the insertion site of a transgenic element of the present invention, the T7 promoter sequence and sequencing adapter 1 are located at both ends of the insertion element and face the genome.

[0016] As a preferred embodiment of the method for identifying the insertion site of a transgenic element of the present invention, the T7 promoter sequence includes the sequences shown in SEQ ID NO.1 and SEQ ID NO.2.

[0017] As a preferred embodiment of the method for identifying the insertion site of a transgenic element of the present invention, the sequence of the sequencing adapter 1 includes the sequence shown in SEQ ID NO.3.

[0018] As a preferred embodiment of the method for identifying the insertion site of a transgenic element of the present invention, the reverse transcription single-strand synthesis in the step (3) uses a random primer with a sequencing adapter 2 and a reverse transcriptase with a strand displacement activity to synthesize multiple single-stranded DNA molecules using an RNA molecule as a template. These synthesized single-stranded cDNA molecules have different 5-end starting positions but the same 3-end termination positions, and the 5-end and 3-end contain sequencing adapter 2 and sequencing adapter 1, respectively.

[0019] As a preferred embodiment of the method for identifying the insertion site of a transgenic element of the present invention, the sequence of the sequencing adapter 2 includes the sequence shown in SEQ ID NO.4.

[0020] As a preferred embodiment of the method for identifying the insertion site of a transgenic element of the present invention, the primers in step (4) include primer i5 as shown in SEQ ID NO.5 and primer i7 as shown in SEQ ID NO.6. N in primers i5 and i7 is a specific barcode sequence, and each sample is distinguished using a unique combination of i5 and i7.

[0021] As a preferred embodiment of the method for identifying the insertion site of a transgenic element of the present invention, the large fragments (more than 1 kb) obtained by magnetic bead sorting in step (5) are used for PacBio third-generation sequencing, and the small fragments (about 500 bp) obtained by magnetic bead sorting are used for second-generation sequencing in PE150 mode.

[0022] As a preferred embodiment of the method for identifying the insertion site of a transgenic element of the present invention, the analysis of step (6) is specifically as follows: the sequencing data of each sample is split from the original sequencing data according to the barcode sequence, and the entry containing the insertion element boundary sequence in read1 in the second-generation sequencing result is extracted, and it is aligned to the genome reference sequence to locate the insertion site; the result of the third-generation sequencing is aligned to the genome and the insertion element reference sequence to analyze the sequence characteristics near the insertion site.

[0023] The present invention also provides application of the method for identifying the insertion site of a transgenic element in identifying the insertion site of a transgenic element.

[0024] The transgenic element insertion includes virus or viroid-mediated transgenic insertion, transposon-mediated transgenic insertion or recombination-mediated transgenic insertion. More preferably, the transgenic element includes Agrobacterium-mediated T-DNA insertion, PiggyBac transposon-mediated transgenic element insertion, or homologous recombination-mediated transgenic element insertion.

[0025] Beneficial effects of the present invention: The present invention provides a new method for identifying the insertion site of a transgenic element, which has the following advantages: (1) Lower cost: The method for identifying the insertion site of a transgenic element of the present invention can separate and enrich the flanking sequence of the insertion site through in vitro transcription and reverse transcription, and construct an amplicon library suitable for second-generation sequencing, without the need for steps such as genome fragmentation, linker connection, and biotin labeling; (2) Higher accuracy: The method for identifying the insertion site of a transgenic element of the present invention only requires one round of PCR for the entire process, and the genome fragments have been removed, so the template in the PCR reaction is simple; the above two points can greatly reduce the generation of chimeric molecules in the PCR process, improve data utilization, and significantly reduce false positive results; (3) The constructed library can be used for both second-generation sequencing and third-generation sequencing. On the one hand, the high-throughput characteristics of second-generation sequencing are utilized to deeply explore the information of the insertion site, and on the other hand, the long read length of third-generation sequencing is utilized to fully detect the sequence structure variation near the insertion site. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The present invention is a flow chart of the method for identifying the insertion site of a transgenic element.

[0027] Figure 2 This is a capillary electrophoresis analysis diagram of the RNA library obtained by in vitro transcription in Example 1.

[0028] Figure 3 This is a capillary electrophoresis analysis diagram of the cDNA library obtained by reverse transcription in Example 1.

[0029] Figure 4 This is a capillary electrophoresis analysis diagram of the amplicon library in Example 1.

[0030] Figure 5 This is the data comparison of the T-DNA insertion site of the T2 sample in Example 1 and the PCR identification results.

[0031] Figure 6 Schematic diagram of sequence structural variation near the T-DNA insertion site detected by third-generation sequencing in Example 1.

[0032] Figure 7 This is the identification result of PiggyBac insertion at multiple sites in the genome in Example 2.

[0033] Figure 8This is the identification result of the site-directed insertion strain mediated by homologous recombination in Example 3.

[0034] Fig. 9 This is the capillary electrophoresis diagram of the amplicon library of Comparative Example 1.

[0035] Fig.10 This is the capillary electrophoresis diagram of the amplicon library of Comparative Example 2.

[0036] Fig.11 This is a statistical graph of the second-generation sequencing data of Example 1 and Comparative Example 1 and Comparative Example 2.

[0037] Fig.12 This is a statistical result graph of the read length of the effective data of the second-generation sequencing of Example 1, Comparative Example 1 and Comparative Example 2.

[0038] Fig.13 The following is a comparison of the identification results of Example 1, Comparative Examples 1 and 2 on the same transgenic sample. DETAILED DESCRIPTION

[0039] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention.

[0040] Example 1

[0041] This example describes a specific method for applying the present invention to the identification of T-DNA element insertion sites in transgenic plants, comprising the following steps:

[0042] 1. Construction of T-DNA-mediated transgenic materials

[0043] The T-DNA fragment was randomly inserted into the Arabidopsis genome using Agrobacterium-mediated transgenic method, wherein the T7 promoter sequence and sequencing adapter 1 were installed at 70 bp from the left and right borders of the T-DNA and oriented toward the outer genome.

[0044] The sequences of the T7 promoter and sequencing adapter 1 are as follows:

[0045] T7 promoter sequence 1 (SEQ ID NO. 1): TAATACGACTCACTATAGGGAAATA;

[0046] T7 promoter sequence 2 (SEQ ID NO. 2): TAATACGACTCACTATAGGGATAAT;

[0047] Sequencing adapter 1 (SEQ ID NO. 3): TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG.

[0048] 2. In vitro transcription

[0049] Extract genomic DNA from the positive transgenic plants obtained by resistance screening, and the extracted DNA must not contain RNA and other impurities. Take 100ng-1000ng of the above-extracted DNA for in vitro transcription reaction at 37°C. The amount of the starting template can be increased as the genome increases, and the reaction time can be adjusted between 2h-16h as needed. A 2-hour reaction can reach 90% saturation, and a 16-hour reaction will not cause the reaction system to be unstable. The specific reaction system is shown in Table 1. After the in vitro reaction is completed, add 2μl of DNase I directly to the system, and continue the reaction at 37°C for 15min to fully degrade the template genomic DNA.

[0050] Use magnetic beads to purify the RNA obtained by in vitro transcription. Add 30 μl of magnetic beads equilibrated to room temperature to the above reaction system, mix thoroughly and let stand at room temperature for 5 minutes. Place the sample tube on a magnetic rack and let stand for 2 minutes. Aspirate and discard the supernatant. Wash twice with 80% alcohol. Dry the magnetic beads at room temperature for 1 minute and dissolve and recover the sample with RNase Free water. The RNA fragments purified and recovered in this step in the embodiment are distributed between 1 kb and 2.5 kb. The capillary electrophoresis results are as follows: Figure 2 The length distribution of RNA products obtained by in vitro transcription from templates of different sources may vary.

[0051] Table 1 In vitro transcription reaction system

[0052] Element volume Genomic DNA 8μl (100ng-1000ng) 10x Buffer 2μl T7 polymerase 2μl ATP 2μl UTP 2μl CTP 2μl GTP 2μl Total 20μl

[0053] 3. Reverse transcription

[0054] The recovered RNA is reverse transcribed to synthesize a single strand of cDNA. In this process, a random primer with a sequencing adapter 2 (SEQ ID NO. 4) should be used, and a reverse transcriptase with strand displacement activity is preferably used to synthesize multiple single-stranded DNA molecules using an RNA molecule as a template. These synthesized single-stranded cDNA molecules have different 5-end starting positions, but have the same 3-end termination positions, and the 5-end and 3-end contain sequencing adapter 2 and sequencing adapter 1, respectively. The reverse transcription primer sequence is as follows, where the underline shows the sequencing adapter 2 sequence, N represents any one of the four bases of ATCG, and 6 Ns form a random sequence:

[0055] Reverse transcription primer (SEQ ID NO.4): GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT NNNNNN

[0056] The reverse transcription reaction system is shown in Table 2. The reaction was carried out on a PCR instrument, and the reaction program was: 25°C, 10 min; 42°C, 45 min; 75°C, 2 min; 4°C, insulation. The reverse transcription product was purified using 0.8x magnetic beads, and the obtained cDNA library was recovered for capillary electrophoresis analysis. It can be seen that the fragments are distributed between 400bp and 1200bp. The results are shown in Figure 3 shown.

[0057] Table 2 Reverse transcription reaction system

[0058]

[0059]

[0060] 4. Library Amplification

[0061] The reverse transcription product was amplified by PCR for 10-20 cycles using primers i5 (SEQ ID NO.5) and i7 (SEQ ID NO.6). PCR can be performed in a qPCR instrument by adding fluorescent dyes. The specific number of amplification cycles can be determined in real time based on the amplification curve, that is, the PCR reaction is stopped when the amplification curve reaches exponential growth. The sequences of i5 and i7 primers are shown below, where N is a specific barcode sequence. Each sample uses a unique barcode combination to distinguish samples:

[0062] i5(SEQ ID NO.5):AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGTCAGATGTGTA

[0063] i7(SEQ ID NO.6):CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGT

[0064] The PCR system is shown in Table 3. The PCR product was purified and recovered using 0.7x magnetic beads, and the concentration was determined using the QUBIT HS assay kit. All samples were mixed in equal molar numbers according to the concentration. The mixed library fragment showed a main peak of about 1 kb. The capillary electrophoresis diagram was shown in Figure 4 shown.

[0065] Table 3 Library amplification system

[0066] Element system 2x PCR Mix 15μl i5 1μl i7 1μl cDNA 10μl 10x SYBR Green 3μl Total 30μl

[0067] 5. Sequencing

[0068] The mixed library was sorted with 0.5x-0.7x magnetic beads: first, 0.5x magnetic beads were added to the system, mixed thoroughly and allowed to stand for 2 minutes; the sample tube was placed on a magnetic stand to separate the magnetic beads and liquid, the liquid was aspirated into the new sample tube 2, and the magnetic beads in the old sample tube 1 were retained. 0.2x (a total of 0.7x) magnetic beads were added to sample tube 2, mixed thoroughly and allowed to stand for 5 minutes, the magnetic beads were separated, and the liquid was aspirated. Both magnetic beads were washed twice with 80% alcohol, dried and dissolved in ultrapure water. Relatively large fragments in the library were recovered in sample tube 1 for third-generation sequencing; relatively small fragments in the library were recovered in sample tube 2 for second-generation sequencing.

[0069] 6. Insertion site analysis

[0070] 1) For the second-generation sequencing data, extract the double-end sequencing results of read 1 starting with the insertion element boundary sequence and align it to the reference genome; 2) Filter out low-quality alignment results and multi-position alignment results, extract flanking sequence information from the remaining high-quality alignment results, and then determine the insertion site; 3) Align the second-generation sequencing results and the third-generation sequencing results to the insertion element reference sequence to analyze the duplication and rearrangement characteristics of the insertion element.

[0071] According to the above implementation method, the insertion site analysis was performed on 12 independently obtained positive transgenic seedlings, and the flanking sequence information obtained is shown in Table 4, wherein the numbers represent the genomic positions covered by the flanking sequences, LB represents the left border of the insertion element, RB represents the right border of the insertion element, and V represents the vector backbone sequence outside the insertion element LB-RB.

[0072] Table 4 Analysis results of insertion sites of 8 samples

[0073]

[0074] In the example, two insertion sites were identified in the T2 sample, and the left and right borders of the insertion element were intact. The second-generation sequencing comparison file of the T2 sample was imported into the IGV software to directly observe the distribution of the sequencing data near the insertion site ( Figure 5 ), it can be clearly seen that the flanking sequence of RB is located upstream of the insertion site, and the flanking sequence of LB is located downstream of the insertion site. Further identification primers were designed about 500 bp upstream and downstream of the insertion site ( Figure 5 P1, P2, P3, P4), and the border primers of the inserted element ( Figure 5 LB and RB) were paired for PCR identification, and the electrophoresis results showed that the upstream and downstream identifications of the two insertion sites were positive ( Figure 5 ), proving that the insertion site identified using the present invention is authentic.

[0075] From the identification results, it can be seen that LB and RB are incomplete or tandemly repeated, which is consistent with the known T-DNA insertion characteristics. Since the second-generation sequencing can only obtain the information of 150bp before and after the fragment, in order to obtain the complete and continuous insertion site flanking sequence information, this example further performed long-read third-generation sequencing on the obtained amplicon library, and detected the structural variation of some insertion elements and insertion sites ( Figure 6 ), including genomic sequence rearrangements on either side of the insertion site and complete or incomplete tandem duplications of the inserted element.

[0076] Example 2

[0077] This example describes a specific method for applying the present invention to transposon-mediated multi-site insertion identification, comprising the following steps:

[0078] 1. Construction of transgenic clones mediated by PiggyBac transposon

[0079] The transgenic fragment was loaded between the 5'ITR and 3'ITR sequences of the PiggyBac plasmid, and the T7 promoter sequence and sequencing adapter 1 were inserted between the ITR and the transgenic fragment, so that they were oriented toward the ITR. The sequences of the T7 promoter and sequencing adapter 1 were the same as those in Example 1. The plasmid was transfected into the host cell, and clones with successful transposition were screened.

[0080] 2. The in vitro transcription step is the same as in Example 1.

[0081] 3. The reverse transcription step is the same as in Example 1.

[0082] 4. The library amplification steps are the same as those in Example 1.

[0083] 5. The sequencing steps are the same as those in Example 1.

[0084] 6. The insertion site analysis steps are the same as those in Example 1.

[0085] According to the above implementation method, the insertion sites of the three monoclonal clones were analyzed, and the obtained insertion sites were distributed on the genome as follows Figure 7 shown. Figure 7 A schematic diagram of one of the typical insertion sites IGV is further shown, and it can be seen that the sequencing data is distributed on both sides of the insertion site. The insertion site sequence is TTAA, which conforms to the typical PiggyBac recognition sequence characteristics, indicating that the present invention can accurately identify transposon-mediated multi-site insertions.

[0086] Example 3

[0087] This example first inserts exogenous fragments into two specific positions of the yeast genome, and then uses the method of the present invention to identify them. The purpose is to demonstrate the accuracy of the method. The specific implementation steps are as follows:

[0088] 1. Site-directed insertion clone construction

[0089] Homologous recombination was used to knock two screening gene fragments into the positions of Saccharomyces cerevisiae ChrVI:223040-223370 and ChrXV:546920-547670. T7 promoter sequence and sequencing adapter 1 were added to both sides of the insert fragment and oriented toward the genome. The sequences of T7 promoter and sequencing adapter 1 were the same as those in Example 1.

[0090] 2. The in vitro transcription step is the same as in Example 1.

[0091] 3. The reverse transcription step is the same as in Example 1.

[0092] 4. The library amplification steps are the same as those in Example 1.

[0093] 5. The sequencing steps are the same as those in Example 1.

[0094] 6. The insertion site analysis steps are the same as those in Example 1.

[0095] The insertion sites of the three single clones were analyzed according to the above steps. Figure 8 As shown, the three monoclones were successfully identified to the two preset insertion sites, and only the two preset sites were identified, indicating that the present invention has extremely high accuracy and signal-to-noise ratio for identification of transgenic element insertion sites.

[0096] The insertion site identification methods commonly used in the prior art are mainly based on the library construction process of Truseq, Nextera or other second-generation sequencing, and their common characteristics are: adding sequencing adapters to the ends of the interrupted genomic fragments, and then performing 2 rounds of PCR to enrich the fragments containing the insertion site. The 8 samples in Example 1 were identified using this method and two commonly used methods in the prior art, namely Comparative Example 1 and Comparative Example 2.

[0097] Comparative Example 1

[0098] Comparative Example 1 is a second-generation library construction process based on Truseq, and the insertion site identification is performed on the same transgenic sample in Example 1. The specific steps are: 1) using ultrasonic fragmentation to break the genome into fragments of about 500bp-1kb; 2) performing end repair on the fragments; 3) connecting an asymmetric sequencing adapter to both ends of the DNA fragment, the asymmetric sequencing adapter is formed by annealing two primers, and the sequences are SEQ ID NO.7 and SEQ ID NO.8, respectively, where p represents phosphorylation modification:

[0099] 5′-p-GATCGGAAGAGCACACGTCTGAACTCCAGTC-3′ (SEQ ID NO.7)

[0100] 5′-ACACTCTTTCCCTACACGACCGCTTCCGATCT-3′ (SEQ ID NO. 8);

[0101] 4) Use the specific primer on the insertion element (SEQ ID NO.9: TCGTCGGCAGCGTCAGATGTGTA) and the adapter primer (SEQ ID NO.10: GTGACTGGAGTTCAGACGTGT) to perform 20 cycles of PCR reaction to amplify the fragment containing the insertion site sequence; 5) Take 1ul of the first round of PCR reaction product as a template, use primers i5 (SEQ ID NO.5) and i7 (SEQID NO.6) to perform 20 cycles of second round PCR reaction to amplify the library, and use the barcode sequence in the primers to label the sample; 6) The subsequent PCR product recovery, library quantification and mixing, as well as second-generation sequencing and data analysis are the same as in Example 1. The capillary electrophoresis results of the amplicon library of Comparative Example 1 constructed by this method are as follows: Fig. 9 shown.

[0102] Comparative Example 2

[0103] Comparative Example 2 adds a biotin labeling enrichment step on the basis of Comparative Example 1, wherein steps (1)-(3) are the same as those of Comparative Example 1, and step (4) uses the biotin-labeled specific primer SEQ ID NO.9 and the linker primer (SEQ ID NO.10) to perform 8-10 cycles of PCR reaction; 5) the first round of PCR reaction products are purified using 0.8x magnetic beads; 6) the purified products are incubated with streptavidin magnetic beads for 4 hours, after the incubation is completed, the supernatant is discarded, the magnetic beads are washed, and the enriched DNA fragments are eluted from the magnetic beads by heating at 95 degrees for 5 minutes; 7) using the eluted product as a template, using primers i5 (SEQ ID NO.5) and i7 (SEQ ID NO.6) to perform a second round of PCR reaction for 20-30 cycles, amplifying the library, and labeling the sample using the barcode sequence in the primers; 8) the subsequent PCR product recovery, library quantification and mixing, as well as second-generation sequencing and data analysis are the same as those in Example 1 and Comparative Example 1. The capillary electrophoresis results of the amplicon library of Comparative Example 2 constructed in this way are as follows: Fig.10 Table 5 Comparison of single sample experimental costs of Example 1, Comparative Example 1 and Comparative Example 2.

[0104] Table 5

[0105]

[0106] The second-generation sequencing data of Example 1, Comparative Example 1 and Comparative Example 2 were analyzed and processed with the same parameters, and the results were divided into high-quality alignment data (specifically aligned to a unique position of the reference genome), low-quality alignment data (aligned to multiple sites of the reference genome, caused by PCR chimeric reactions), and invalid data (data that does not contain the boundary sequence of the inserted element). Fig.11 It shows that the high-quality comparison data of Example 1 reaches an average of 50%, that of Comparative Example 1 is less than 20%, and that of Comparative Example 2 is about 30%, that is, the data signal-to-noise ratio of Example 1 is significantly higher than that of Comparative Example 1 and Comparative Example 2.

[0107] Extract the read length information of the effective data in Example 1 and Comparative Example 1 and Comparative Example 2 ( Fig.12 ), statistics show that the read length of Example 1 is mainly distributed between 400bp-550bp, while the read lengths of Comparative Examples 1 and 2 are mainly distributed within 350bp, that is, the effective read length of Example 1 is significantly longer than that of Comparative Examples 1 and 2. This result ( Fig.12 ) and capillary electrophoresis ( Figure 4 , Fig. 9 , Fig.10 ), indicating that this method can provide longer flanking sequence information based on the same amount of effective data. Since T-DNA insertion often causes rearrangement and inversion of genomic sequences near the insertion site, longer flanking sequence information can more clearly and accurately illustrate the variation of genomic structure near the insertion site ( Figure 6 ), thereby providing richer information for evaluating the impact of transgenics on crop genomes.

[0108] Fig.13 The results of the identification of transgenic Arabidopsis sample T2 obtained by the methods of Example 1, Comparative Example 1, and Comparative Example 2 are shown. Each circle in the figure represents an identified insertion site, and the size of the circle represents the relative coverage of the site. The three methods successfully identified the same two sites, and the authenticity of these two sites has been confirmed by PCR identification ( Figure 5 ). In Example 1, only these two real insertion sites were identified, while the data of Comparative Examples 1 and 2 also contained several false positive sites with slightly lower coverage. The false positive results are most likely caused by chimeric molecules caused by multiple rounds of PCR in complex templates. However, since this method only performs one round of PCR and the PCR template is simple, the background signal of PCR can be greatly reduced, and sequencing results with a high signal-to-noise ratio can be obtained, achieving more accurate identification results with a lower amount of data.

[0109] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A method for identifying a transgenic element insertion site, characterized in that: The following steps are involved: (1) Integrate the T7 promoter sequence and sequencing adapter 1 at both ends of the transgenic element, screen the positive strains and extract DNA to obtain genomic DNA; (2) performing in vitro transcription using the genomic DNA from step (1) as a template, and purifying and recovering RNA; (3) Reverse transcription of the RNA in step (2) to synthesize one strand to obtain cDNA; (4) using primers to perform PCR amplification on the cDNA of step (3), and obtaining an amplicon library after purification; (5) performing magnetic bead sorting on the amplicon library, recovering the small fragments for high-throughput second-generation sequencing, and recovering the large fragments for long-read third-generation sequencing; the small fragments are fragments with a length of 500 bp; the large fragments are fragments with a length greater than 1 kb; (6) Analyze the sequencing data and identify the insertion site of the transgenic element; Wherein, the T7 promoter sequence and sequencing adapter 1 are located at both ends of the insertion element and face the genome; the sequence of the sequencing adapter 1 includes the sequence shown in SEQ ID NO.3; The reverse transcription one-strand synthesis in step (3) uses a random primer with a sequencing adapter 2; the sequence of the sequencing adapter 2 includes the sequence shown in SEQ ID NO.

4.

2. The method for identifying the insertion site of a transgenic element according to claim 1, characterized in that: The T7 promoter sequence includes the sequence shown in SEQ ID NO.1 or SEQ ID NO.

2.

3. The method for identifying the insertion site of a transgenic element according to claim 1, characterized in that: The primers in step (4) include primer i5 as shown in SEQ ID NO.5 and primer i7 as shown in SEQ ID NO.

6.

4. The method for identifying the insertion site of a transgenic element according to claim 1, characterized in that: The analysis of step (6) is specifically as follows: the sequencing data of each sample is split from the original sequencing data, the entries in the second-generation sequencing results whose read1 contains the insertion element boundary sequence are extracted, and the entries are aligned to the genome reference sequence to locate the insertion site; the results of the third-generation sequencing are aligned to the genome and the insertion element reference sequence to analyze the sequence features near the insertion site.

5. Use of the method for identifying the insertion site of a transgenic element according to any one of claims 1 to 4 in identifying the insertion site of a transgenic element.

Images