A method for identifying a new species of Dictyophora rubra

Abstract

The present invention discloses a method for identifying a novel red bamboo fungus species, comprising the following steps: culturing mycelium, extracting genomic DNA, developing SSR molecular marker primers, screening and detecting SSR molecular markers, synthesizing fluorescent marker primers, performing PCR product gel electrophoresis detection and GeneMapper data detection, and obtaining the fragment size and signal value of the corresponding site. The present invention provides a design SSR marker and fingerprint identification method for strain Bailu No. 2 based on genomic information. Compared with other conventional identification methods, the fingerprint has the advantages of short identification cycle, high accuracy, wide coverage and good repeatability.

Description

Technical Field

[0001] The invention relates to the technical field of plant fungus species identification, and more specifically, to an identification method for a novel red-sprung bamboo fungus species. Background Art

[0002] Red-stemmed bamboo fungus is delicious and rich in various biologically active ingredients, such as polysaccharides, inorganic salts and vitamins. It has the effects of health care, enhancing liver function, protecting the liver and removing free radicals from the human body. It is a precious edible and medicinal fungus.

[0003] Red-suspension bamboo fungus was successfully cultivated in 1983. The cultivation started in Zhijin, Guizhou, and developed rapidly across the country. It reached its peak in 2020, with a total scale of more than 60,000 acres. At present, it is planted in parts of Guizhou, Anhui, Henan, Yunnan, Sichuan, Guangxi, Guangdong, Fujian, Zhejiang, Hainan, etc. Red-suspension bamboo fungus has gradually been presented to the world as a popular product, becoming a high-quality variety leading the national bamboo fungus industry. However, while the red-suspension bamboo fungus industry and basic research are developing rapidly, there are still a series of problems. For example, the authenticity of the red-suspension bamboo fungus strains has seriously restricted the development of the industry. There are some conventional identification methods on the market for the identification of strains, but they often have disadvantages such as long identification cycles and low accuracy.

[0004] Therefore, a new solution needs to be proposed to solve this problem. Summary of the invention

[0005] In view of the deficiencies in the prior art, the present invention solves at least one of the above problems and provides a method for culturing and identifying a new type of red-suspension bamboo fungus species.

[0006] The present invention provides a method for identifying a novel species of Dictyophora rubra, comprising the following steps:

[0007] S1. Cultivate mycelium: transfer the new red bamboo fungus strain to a special culture medium, and collect the mycelium after culturing at 25°C for 21 days;

[0008] S2. Extraction of genomic DNA: DNA was extracted using a fungal DNA extraction kit (OMEGA). The operation steps were carried out according to the instructions of the kit. The purity and integrity of the DNA were tested by PCR product gel electrophoresis and Nanodrop one method. Then, the concentration of DNA of all samples was homogenized and stored in a -20 ℃ refrigerator for later use.

[0009] S3, SSR molecular marker primer development: The DNA extracted in step S2 was purified and sheared to construct a small fragment 300 bp sequencing library, and high-throughput sequencing was performed on the Illumina platform. The amount of data was 2G. After data filtering, SPAdes-3.15.2 was used for genome assembly. Polymorphic sequences were selected based on the software MISA and primer3, and corresponding SSR primers were designed;

[0010] S4. Screening and detection of SSR molecular markers: Screen sites with dibase repeats more than 10 times and tribase repeats more than 6 times, synthesize common primers according to the designed SSR primer sequences, and perform PCR amplification verification;

[0011] S5, synthesizing fluorescent labeled primers, and further performing gel electrophoresis detection of PCR products;

[0012] S6. GeneMapper performs data detection to obtain the fragment size and signal value of the corresponding site. In summary, the present invention has the following beneficial effects:

[0013] The present invention provides a method for cultivating a new type of red-tube bamboo fungus (red-tube bamboo fungus Bailu No. 2 fungus), which has a short growth cycle, high yield, and superior properties to other varieties on the market. It can greatly improve the cultivation efficiency of red-tube bamboo fungus, has good properties, and has considerable market prospects. (This strain was deposited in the Guangdong Institute of Microbiology on June 26, 2023, address: Guangdong Academy of Sciences Institute of Microbiology, Guangzhou, China.)

[0014] The present invention provides an identification method for a new type of red-stemmed bamboo fungus species, which provides a designed SSR marker and fingerprint identification method for the strain Bailu No. 2 based on genome information. Compared with other conventional identification methods, the fingerprint has the advantages of short identification cycle, high accuracy, wide coverage and good repeatability. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation of the present invention. In the accompanying drawings:

[0016] Figure 1 The relative molecular weight peaks obtained by detecting primer 1 in strain Bailu 2 and five major commercial varieties on the market (from top to bottom are Bailu 2, 1, 2, 3, 4, and 5).

[0017] Figure 2The relative molecular weight peaks obtained by detecting primer 2 in strain Bailu 2 and five major commercial varieties on the market (from top to bottom are Bailu 2, 1, 2, 3, 4, and 5).

[0018] Figure 3 The relative molecular weight peaks obtained by detecting primer 5 in strain Bailu 2 and five major commercial varieties on the market (from top to bottom are Bailu 2, 1, 2, 3, 4, and 5).

[0019] Figure 4 The relative molecular weight peaks obtained by detecting primer 4 in strain Bailu 2 and five major commercial varieties on the market (from top to bottom are Bailu 2, 1, 2, 3, 4, and 5).

[0020] Figure 5 The relative molecular weight peaks obtained by detecting primer 5 in strain Bailu 2 and five major commercial varieties on the market (from top to bottom are Bailu 2, 1, 2, 3, 4, and 5). Implementation

[0021] In order to clearly and completely describe the objectives and technical solutions of the present invention and make the advantages more clearly understood, the embodiments of the present invention are further described in detail below with reference to the accompanying drawings.

[0022] For the purpose of simplicity and illustration, the principles of the embodiments are described primarily by reference to examples. In the following description, many specific details are presented to provide a thorough understanding of the embodiments. However, it is apparent that, for those of ordinary skill in the art, these embodiments may not be limited to these specific details in practice. In some instances, known methods and structures are not described in detail to avoid making these embodiments unnecessarily difficult to understand, and in addition, all embodiments may be used in combination with each other.

[0023] The present invention is described in detail below in conjunction with the accompanying drawings and embodiments.

[0024] The present invention provides a method for identifying a novel species of Bamboo Shoot Fungus, which specifically includes the following contents:

[0025] S1. Cultivate mycelium: transfer the new red bamboo fungus strain to a special culture medium, and collect the mycelium after culturing at 25°C for 21 days;

[0026] S2. Extraction of genomic DNA: DNA was extracted using a fungal DNA extraction kit (OMEGA). The operation steps were carried out according to the instructions of the kit. The purity and integrity of the DNA were tested by PCR product gel electrophoresis and Nanodrop one method. Then, the concentration of DNA of all samples was homogenized and stored in a -20 ℃ refrigerator for later use.

[0027] S3, SSR molecular marker primer development: The DNA extracted in step S2 was purified and sheared to construct a small fragment 300 bp sequencing library, and high-throughput sequencing was performed on the Illumina platform. The amount of data was 2G. After data filtering, SPAdes-3.15.2 was used for genome assembly. Polymorphic sequences were selected based on the software MISA and primer3, and corresponding SSR primers were designed;

[0028] S4. Screening and detection of SSR molecular markers: Screen sites with dibase repeats more than 10 times and tribase repeats more than 6 times, synthesize common primers according to the designed SSR primer sequences, and perform PCR amplification verification;

[0029] S5, synthesizing fluorescent labeled primers, and further performing gel electrophoresis detection of PCR products;

[0030] S6. GeneMapper performs data detection to obtain the fragment size and signal value of the corresponding site.

[0031] Through the screening of 12 pairs of primers, the map consists of 5 pairs of SSR markers. SSR primers are developed based on the simple repetitive sequence fragments of the red bamboo fungus genome, and the amplification bands are good and the SSR primers are highly repeatable. The detailed information of the markers is shown in Table 1:

[0032] Serial number Primer name Forward / reverse primers SSR type and number of repetitions 1 NODE-3 GGGCGACAACAGATACACCTGCAATTGGGGTTGTAGCACT (AAG)13 2 NODE-30 GGTCGTTTGGTGCGATAAGTATTTCAGGTAACGCGGTGTC (CTC)14 3 NODE-33 AAATGCAGGGTAGGTTCACGGGTTCTTGCGACATTACCGT (ATT)14 4 NODE-68 CACCGAATTCAACGTGTTTGACACCTGTCGTTGACATGGA (TGT)10 5 NODE-78 AGATAGTCCCAACGGCACACCATACGCAGCATCCTTAGCA (ACT)17

[0033] The present invention discloses a method for identifying a novel red-suspension bamboo fungus species, which is to use 12 pairs of SSR primers developed from simple repeat sequence fragments of the red-suspension bamboo fungus genome. The present invention screens a large number of SSR primers, and compares the SSR primer band type amplification of 5 main cultivars (respectively marked as No. 1, No. 2, No. 3, No. 4, and No. 5), determines the number of allele fragments amplified by the 5 pairs of SSR primers in each red-suspension bamboo fungus cultivar and numbers them (Table 2), and can effectively identify the Bailu No. 2 fungus species in the 5 main cultivars collected through the number combination of different SSR allele sites. By counting the SSR fragments, the amplified fragment sizes of Bailu No. 2 in the 5 pairs of primers are 133 bp and 139 bp, 133 bp, 107 bp, 129 bp, and 122 bp, respectively, and the amplified bands are obviously different from other market samples.

[0034] Compared with traditional morphological detection, antagonism test and cultivation and fruiting test, the SSR marker identification method of the present invention is simple to operate, stable and reliable, can effectively distinguish the red-tube bamboo fungus Bailu No. 2 strain on the market, and has certain application prospects for strain identification.

[0035] Table 2 Summary of allelic fragment information amplified by SSR primers

[0036] Serial number The number of alleles Allelic fragment number, molecular weight and corresponding sample 1 7 1→133-133.99→Bailu No. 22→139-139.99→Bailu No. 23→201-201.99→No. 34→203-203.99→No. 45→204-204.99→No. 26→205-205.99→No. 57→208-208.99→No. 1 2 4 1→127-127.99→No. 1-52→132-132.99→No. 1, No. 2, No. 4, No. 53→133-133.99→Bai Lu No. 23→134-134.99→No. 3 3 9 1→107-107.99→Bailu No. 22→256-256.99→No. 53→257-257.99→No. 44→259-259.99→No. 3, No. 55→260-260.99→No. 2, No. 46→261-261.99→No. 17→262-262.99→No. 38→263-263.99→No. 29→264-264.99→No. 1 4 6 1→123-123.99→Bai Lu No. 22→124-124.99→No. 43→125-125.99→No. 3, No. 54→126-126.99→No. 1, No. 25→127-127.99→No. 46→129-129.99→Bai Lu No. 2 5 2 1→122-122.99→Bailu No. 2 2→243-243.99→No. 1, No. 2, No. 4, No. 5 2→245-245.99→No. 3

[0037] The above is only a preferred embodiment of the present invention, and the protection scope of the present invention is not limited to the above embodiments. All technical solutions under the concept of the present invention belong to the protection scope of the present invention. It should be pointed out that for ordinary technicians in this technical field, some improvements and modifications without departing from the principle of the present invention should also be regarded as the protection scope of the present invention.

Claims

1. A method for identifying the strain of Bamboo Spatholobi rubra Bailu No. 2, characterized in that: The following SSR primer pair combinations were used: Forward / reverse primers for NODE-3: 5′-GGGCGACAACAGATACACCT-3′; 5′-GCAATTGGGGTTGTAGCACT-3′; Forward / reverse primers for NODE-30: 5′-GGTCGTTTGGTGCGATAAGT-3′; 5′-ATTTCAGGTAACGCGGTGTC-3′; Forward / reverse primers for NODE-33: 5′-AAATGCAGGGTAGGTTCACG-3′; 5′-GGTTCTTGCGACATTACCGT-3′; Forward / reverse primers for NODE-68: 5′-CACCGAATTCAACGTGTTTG-3′; 5′-ACACCTGTCGTTGACATGGA-3′; Forward / reverse primers for NODE-78: 5'-AGATAGTCCCAACGGCACAC-3' 5′-CATACGCAGCATCCTTAGCA-3′; The sizes of the fragments amplified by the above five pairs of primers of the Bailu 2 strain of Hongtuo Zhushen were 133 bp, 139 bp, 133 bp, 107 bp, 129 bp and 122 bp respectively.

Images