Molecular markers related to seed setting rate of broccoli and their application

Abstract

The invention discloses a molecular marker related to the seed setting rate of broccoli seeds and its application. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1. The 51st position of the sequence has a C / T polymorphism. The SNP is located at the 37728588th position of the C6 chromosome of the broccoli HDEM (verson 1.0) reference genome. When the base sequence mutates from C to T, the corresponding broccoli seed setting rate is improved. The SNP molecular marker is used to screen broccoli germplasm with a high seed setting rate. The KASP primer is used for PCR amplification. The primer excites HEX fluorescence in broccoli materials with a low seed setting rate, and the SNP excites FAM fluorescence in broccoli materials with a high seed setting rate, thereby realizing early and rapid identification of broccoli germplasm resources by molecular biological means.

Description

Technical Field

[0001] The invention relates to a molecular marker related to a fruit setting rate, and in particular to a molecular marker related to a fruit setting rate of broccoli seeds and an application thereof. Background Art

[0002] Broccoli (Brassica oleracea.var.italica) is rich in nutrients such as glucosinolates. The relatively backward seed production and breeding technology and the serious shortage of seed production are important problems facing the broccoli industry.

[0003] At present, the research on crop seed setting rate is mainly focused on the model plant rice. Related genes such as POLLEN TUBEBLOCKED 1 (PTB1) can positively regulate the rice panicle setting rate by promoting pollen tube growth (LiS, Li W, Huang B, et al. Natural variation in PTB1 regulates rice seed setting rate by controlling pollen tube growth. Nat Commun. 2013; 4(1): 2793.); OsCNGC13 gene can positively regulate the rice panicle setting rate by changing the Ca content in the stigma. 2+The content of OsCNGC13 promotes double fertilization and seed setting in rice (Xu Y, Yang J, Wang Y, et al. OsCNGC13 promotes seed-setting rate by facilitating pollen tube growth instylar tissues. Palanivelu R, ed. PLOS Genet. 2017; 13(7): e1006906). Recently, it was discovered that a mutation in a new gene LOWSEED SETTINGRATE1 (LSSR1) in rice can cause abnormal pollen germination, thereby affecting the seed setting rate of rice (Xiang X, Zhang P, Yu P, et al. LSSR1 facilitates seed setting rate by promoting fertilization in rice. Rice. 2019; 12(1): 31). In Brassica crops, the phenomenon of "self-incompatibility" is considered to be an important factor affecting seed setting rate. Numerous studies have shown that broccoli and other Brassica crops are typical sporophyte self-incompatibility types, which are genetically controlled by an S locus with multiple alleles, also known as the S unit type. Only when the male determining factor (SCR, serine / threonine receptor kinase) of the father and the female determining factor (SRK, cysteine-rich protein) of the mother belong to different S unit types, can the pollen falling on the stigma germinate and grow, complete fertilization and produce seeds. In addition to the S locus, there are many other genes involved in the self-incompatibility reaction, including MLPK (M locus protein kinase), ARC1 (arm span repeat protein), THL1 / 2 (thioredoxin h-like), Exo70A1 (exocytosis complex), GLO1 (glyoxalase) and other genes. These genes work after SCR and SRK recognize each other, forming a signaling pathway, which ultimately leads to self-incompatibility. Recent studies have found that pollen in crops such as cabbage can activate the downstream FERONIA receptor kinase signaling pathway through the stigma SRK receptor, increase the reactive oxygen in the stigma, and thus inhibit exogenous pollen from entering the pollen tube (Huang J, Yang L, Yang L, et al. Stigma receptors control intraspecies and interspecies barriers in Brassicaceae. Nature. 2023; 614(7947): 303-308).Our study found that the main domestic broccoli varieties and breeding materials contain 19 S unit types. More importantly, some breeding parents, even if they contain different S unit types, also show a very low fruit set rate (Yu HF, Zhao ZQ, Sheng XG, et al. Identification of S-haplotypes in DH-lines of broccoli (Brassica oleracea L. var. italica). J Hortic Sci Biotechnol. 2014; 89 (4): 430-434), suggesting that this trait may also be controlled by other unknown genetic loci and regulatory networks.

[0004] Therefore, exploring the gene loci related to seed setting rate in broccoli and developing molecular markers closely linked to the gene can efficiently and accurately identify the seed setting rate of broccoli, increase broccoli seed yield, and provide important technical support for ensuring the localization process of broccoli varieties. Summary of the invention

[0005] The purpose of the present invention is to provide a molecular marker related to the seed setting rate of broccoli seeds and its application, and to screen broccoli germplasm with high seed setting rate by using SNP molecular markers, so as to realize early and rapid identification of broccoli germplasm resources by molecular biological means.

[0006] In order to achieve the above object, the present invention provides a molecular marker related to the seed setting rate of broccoli seeds, the nucleotide sequence of which is shown in SEQ ID NO.1; the 51st position of the sequence has a C / T polymorphism, and when the base sequence mutates from C to T, the corresponding broccoli seed setting rate is improved.

[0007] Another object of the present invention is to provide a primer set for the molecular marker, the nucleotide sequence of the primer set is shown in SEQ ID NOs. 2-4.

[0008] Preferably, the 5' end of the primer with the nucleotide sequence as shown in SEQ ID NO.2 is added with a universal linker sequence as shown in SEQ ID NO.5; the 5' end of the primer with the nucleotide sequence as shown in SEQ ID NO.3 is added with a universal linker sequence as shown in SEQ ID NO.6.

[0009] Another object of the present invention is to provide a KASP kit related to broccoli seed setting rate, wherein the primer set in the KASP kit is the primer set described above.

[0010] Another object of the present invention is to provide the use of the molecular marker or the primer set in detecting broccoli genotypes, screening high seed setting rates or molecular marker-assisted selection breeding.

[0011] Another object of the present invention is to provide a method for identifying the seed setting rate of broccoli seeds, the method comprising:

[0012] (1) extracting genomic DNA from broccoli to be tested;

[0013] (2) performing PCR amplification using the primer set as described in claim 2 or 3;

[0014] (3) The PCR amplification products were analyzed by a fluorescence detector, and the seed setting rate of the broccoli seeds was determined according to the genotyping results: if the genotyping result was CC, it was a broccoli with a low seed setting rate; if the genotyping result was TT, it was a broccoli with a high seed setting rate; if the genotyping result was CT, it was between the broccoli with a low seed setting rate and the broccoli with a high seed setting rate.

[0015] Preferably, the primer excites HEX fluorescence in broccoli materials with a low fruit setting rate, and excites FAM fluorescence in broccoli materials with a high fruit setting rate.

[0016] Preferably, the PCR reaction program is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 30 s, annealing and extension at 60-55°C for 60 s, with the annealing temperature decreasing by 0.6°C in each cycle, for a total of 10 cycles; denaturation at 95°C for 30 s, annealing and extension at 55°C for 60 s, for a total of 26 cycles.

[0017] Preferably, the PCR reaction system comprises: a PCR premix, a mixture of the primer set according to claim 2 or 3, and a template DNA.

[0018] The molecular markers related to the seed setting rate of broccoli seeds and their application of the present invention have the following advantages:

[0019] The present invention constructs a high-density genetic linkage map containing 4425 markers, locates the gene controlling the seed setting rate in the 698.9-725.4cM interval of the C6 chromosome, the LOD value of the QTL is 36.2, and the phenotypic variation that can be explained is 59.8%. The reliability of the site is verified, indicating that the co-located QTL plays a stable regulatory role in the seed setting rate of broccoli seeds under different genetic backgrounds.

[0020] The present invention develops a SNP marker KM268 that is closely linked to the seed setting rate of broccoli. The SNP is located at the base C or T at the 37728588th position of the C6 chromosome of the broccoli HDEM (verson 1.0) reference genome. When the base sequence mutates from C to T, the corresponding seed setting rate of broccoli is significantly improved, thereby realizing early and rapid identification of broccoli germplasm resources by molecular biological means. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It is the phenotype and genetic map used for positioning the QTL of fruit set rate; wherein, A is the fruit set rate phenotype of the three parental materials used in the present invention and the F2 population constructed by hybridization; B is the distribution histogram of the fruit set rate phenotype of the BJ-F2 population; C is the distribution of SNP markers of the BJ-F2 population on the chromosome; the color represents the density of the marker within the 10cM interval.

[0022] Figure 2 This is the QTL mapping result for the fruit set rate trait in the BJ-F2 population.

[0023] Figure 3 This is the QTL mapping result for the fruit set rate trait in the BC-F2 population.

[0024] Figure 4 It is a scatter plot of the gene distribution of the GSL-OH gene SNP primers based on the KASP technology; wherein the horizontal axis is the FAM fluorescence value and the vertical axis is the HEX fluorescence value.

[0025] Figure 5 Box plot of the phenotypic distribution of marker KM268, which is closely linked to broccoli seed setting rate, in the F2 population. DETAILED DESCRIPTION

[0026] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0027] Experimental Example 1 Development of molecular markers related to seed setting rate based on QTL mapping in different genetic populations

[0028] 1. QTL Mapping of Broccoli Seed Setting Rate

[0029] The present invention uses broccoli materials B58-6 and J1402 with significant differences in self-fertilization rate to cross and construct a BJ-F2 population containing 214 strains ( Figure 1A). According to the number of seeds set on each plant, the fruit set rate of the BJ-F2 population was divided into five levels (0, 1, 2, 3, 4). Statistics showed that the population phenotype showed a normal distribution ( Figure 1 B), the single plant fruiting rate showed a genetic segregation ratio of 1:3 (χ 2 =0.22, P>0.05), indicating that the fruiting rate of this population is controlled by a single gene. The present invention uses the broccoli 40K SNP liquid phase chip developed in the early stage to perform genotyping on this population and constructs a high-density genetic linkage map containing 4425 markers (see Figure 1 ). Using WinQTL2.5 software, the gene controlling seed setting rate was located in the 698.9-725.4 cM interval of chromosome C6 (see Figure 2 ), the LOD value of this QTL was 36.2, and the phenotypic variation it could explain was 59.8%.

[0030] To verify the reliability of this locus, the broccoli farmer varieties BR06 and C4101 were crossed to construct a BC-F2 population of 212 lines. Through genetic analysis, a major QTL was also located on chromosome C6 (see Figure 3 ), explaining 23.7% of the phenotypic variation. The seed setting rate-related QTLs located in BJ-F2 and BC-F2 were aligned to the HDEM reference genome, showing that the physical positions of the three QTLs overlapped, indicating that the co-located QTLs play a stable regulatory role in the seed setting rate of broccoli seeds under different genetic backgrounds.

[0031] 2. Develop KASP markers related to broccoli seed setting rate within the QTL interval

[0032] Using the QTL interval obtained above, the genetic position of the interval was aligned to the HDEM (verson1.0) reference genome to obtain its physical position. According to the results of parental resequencing, SNP sites with different genotypes in the physical interval were selected and developed into KASP markers. Through further screening and verification of the genetic population, the KASP marker KM268 with good genotyping results and closely related to the seed setting rate of broccoli was selected as a molecular marker for the seed setting rate of broccoli for rapid and accurate phenotypic screening. The SNP is located at the base C or T at position 37728588 of the C6 chromosome of the broccoli HDEM (verson 1.0) reference genome (see Figure 4 ). When the base sequence mutated from C to T, the corresponding broccoli seed setting rate increased significantly.

[0033] KASP marker KM268 (SEQ ID NO. 1), specifically as follows:

[0034] TTGTCAGCCTGATCATTCACCTCACCGTTGTCAGAAACAGACATCT CCTTCTGAGAAATCTCAACGCACAAGTCTTTCGTCCAAGAGGTAACAA TTTCCAT.

[0035] The primers for KM268 are as follows:

[0036] The nucleotide sequence of the forward primer FAM (SEQ ID NO.2) is:

[0037] GTGCGTTGAGATTTCTCAA;

[0038] The nucleotide sequence of the forward primer HEX (SEQ ID NO.3) is:

[0039] GTGCGTTGAGATTTCTCAG;

[0040] Reverse primer (SEQ ID NO.4):

[0041] CAAGGACATTCCAGCTAGACAA.

[0042] Universal adapter sequences were added to the 5' ends of the two upstream primers, as follows:

[0043] The universal linker sequence (SEQ ID NO.5) added by the forward primer FAM is:

[0044] GAAGGTGACCAAGTTCATGCT;

[0045] The universal linker sequence (SEQ ID NO.6) added by the forward primer HEX is:

[0046] GAAGGTCGGAGTCAACGGATT.

[0047] The two forward primers in the above primer pair have base differences at the 3' end, which can competitively bind to the target site and display corresponding FAM or HEX fluorescence. After signal amplification, the genotype of the target site can be determined.

[0048] Experimental Example 2: Verification of the broccoli seed setting rate-related marker KM268 in a segregating population

[0049] 1. Extraction and purification of DNA from isolated populations to be tested

[0050] The BJ-F2 population consisting of 214 plants was selected for self-pollination of plants with chromosome recombination in the QTL interval to construct a BJ-F2:3 segregating population. 150 plants were randomly selected, and leaf DNA was extracted using the CTAB method, and the quality and concentration of DNA were detected using a spectrophotometer.

[0051] 2. Genotyping of segregating populations using KM268

[0052] Add specific KASP Primermix (KASP primer mixture) and universal KASP Mastermix to the above-extracted DNA template for PCR amplification. KASP Mastermix contains the following components: universal FRETcassette fluorescent primer, ROX internal reference dye, KlearTaq DNA polymerase, dNTP and MgCl2; the PCR reaction system for KASP detection is: 5μL PCR premix, 0.14μL KASP primer mixture (where the final concentration of each primer is 5nM) and 5μL 20ng / μL template DNA; the PCR reaction conditions are: 94℃ pre-denaturation for 15min; 94℃ denaturation for 20s, 61-55℃ annealing and extension for 60s, the annealing temperature is reduced by 0.6℃ for each cycle, for a total of 10 cycles; 94℃ denaturation for 20s, 55℃ annealing and extension for 60s, for a total of 26 cycles;

[0053] The results are shown in Table 1. Among the 150 individual strains, 30 strains had a genotype of CC, 48 strains had a genotype of TT, and 72 strains had a genotype of CT.

[0054] Table 1

[0055]

[0056]

[0057]

[0058] 3. Determination of seed setting phenotype of segregating population

[0059] The number of seeds per 20 siliques in 150 individual plants was measured, and the seed setting rate of each individual plant was calculated (seed setting rate = total number of seeds / number of siliques). The seed setting rate ranged from 0 to 17, as shown in Table 1.

[0060] The strains of KM268 with different genotypes were counted and box plots were constructed, such as Figure 5The average seed setting rate of CC genotype plants was 0.18, while the average seed setting rate of TT genotype plants was 10.91. The t-test showed that there was a significant difference between the phenotypes of the two different genotypes (P<0.001), indicating that the marker can be used to distinguish the seed setting rate of broccoli seeds efficiently and accurately.

[0061] Although the content of the present invention has been described in detail through the above preferred embodiments, it should be appreciated that the above description should not be considered as a limitation of the present invention. After reading the above content, it will be apparent to those skilled in the art that various modifications and substitutions of the present invention will occur. Therefore, the protection scope of the present invention should be limited by the appended claims.

Claims

1. A molecular marker associated with broccoli seed setting rate, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1; the 51st position of the sequence has a C / T polymorphism, and when the base sequence mutates from C to T, the corresponding broccoli seed setting rate is improved.

2. The molecular marker primer set according to claim 1, characterized in that: The nucleotide sequences of the primer set are shown in SEQ ID NOs. 2-4.

3. The primer set according to claim 2, characterized in that The nucleotide sequence of the primer shown in SEQ ID NO.2 is added to the 5' end with a universal linker sequence shown in SEQ ID NO.5; the nucleotide sequence of the primer shown in SEQ ID NO.3 is added to the 5' end with a universal linker sequence shown in SEQ ID NO.

6.

4. A KASP kit related to broccoli seed setting rate, characterized in that: The primer set in the KASP kit is the primer set as claimed in claim 2 or 3.

5. Use of the molecular marker according to claim 1 or the primer set according to claim 2 or 3 in detecting broccoli genotypes, screening broccoli with high seed setting rate or broccoli molecular marker-assisted selection breeding.

6. A method for identifying the seed setting rate of broccoli, characterized in that: The method includes: (1) extracting genomic DNA from broccoli to be tested; (2) performing PCR amplification using the primer set as described in claim 2 or 3; (3) Analyze the PCR amplification product using a fluorescence detector, and determine the broccoli seed setting rate based on the genotyping results: If the genotyping result is CC, it is a broccoli with low fruiting rate; If the genotyping result is TT, it is a broccoli with a high fruiting rate; If the genotyping result is CT, it is between the broccoli with low fruit set rate and the broccoli with high fruit set rate.

7. The method according to claim 6, characterized in that The primers excite HEX fluorescence in broccoli materials with low fruit setting rates, and excite FAM fluorescence in broccoli materials with high fruit setting rates.

8. The method according to claim 6, characterized in that The PCR reaction program is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 30 s, annealing and extension at 60-55°C for 60 s, with the annealing temperature decreasing by 0.6°C in each cycle, for a total of 10 cycles; denaturation at 95°C for 30 s, annealing and extension at 55°C for 60 s, for a total of 26 cycles.

9. The method according to claim 6, characterized in that The PCR reaction system comprises: a PCR premix, a mixture of the primer set according to claim 2 or 3, and a template DNA.

Images