KASP molecular markers for major QTL QWgc.cau-2D in wheat wet gluten content and its application

Abstract

The present invention provides a KASP molecular marker of the main effect QTL QWgc.cau‑2D of wheat wet gluten content and its application. The main effect QTL of wheat wet gluten content is located on wheat chromosome 2D and is named QWgc.cau‑2D; the 36th base of the SNP marker AX‑108822109 closely linked to the main effect QTL has a G / T polymorphic site; the KASP molecular marker developed according to the linkage marker is KASPWgc.cau‑2D, the corresponding physical position is 2D: 3533015, and the linkage interval is IWGSCv1.0_chr2D: 1,643,964‑6,115,557bp. When KASP is identified as TT, the wet gluten content of wheat flour is higher; when KASP is identified as GG, the wet gluten content of wheat flour is lower. The wet gluten content QTL locus of the present invention‑Log 10 The (p) value is 3.045-6.314, the variation explanation rate is 7.223%-9.630%, and the wet gluten content of flour is increased by 7.51%-10.23%. The molecular marker of the present invention can be used for wheat auxiliary breeding, identification or auxiliary identification of wheat grain wet gluten content, and comparison of the wet gluten content of wheat grains to be tested.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular genetics, and specifically relates to a KASP molecular marker of a major effect QTL QWgc.cau-2D of wheat wet gluten content and an application thereof. Background Art

[0002] Wheat is not only the raw material for staple foods such as bread, noodles and pastries, but is also used in industry to make feed, brew beer and produce alcohol. Its unique gluten component gives it a unique position in food processing. Gluten is a protein network composed of alcohol-soluble proteins and glutenin, which has excellent viscoelasticity, making wheat an ideal raw material for making a variety of flour-based foods.

[0003] The content and quality of wheat gluten is one of the key indicators for evaluating the quality of wheat flour, and is crucial to the processing performance of dough and the quality of steamed and baked foods. Different foods have different requirements for gluten strength. For example, low-gluten flour is suitable for making biscuits and pastries, medium-strong gluten flour is suitable for making steamed buns and noodles, and high-gluten flour is suitable for making high-quality bread. Therefore, research related to wheat gluten content is crucial to understanding the genetic laws of wheat gluten. It is not only of great value to the grain field, but also has a far-reaching positive impact on the entire food industry and the national economy, and has broad research prospects.

[0004] Genome-wide association analysis is an emerging research method for exploring the genetic basis of wet gluten content in wheat. Unlike traditional QTL analysis methods, its advantage lies in the construction of a wide variety of association populations, which allows the inclusion of wheat varieties in different regions and ecological conditions, and more comprehensively captures the genetic diversity of wet gluten content. In addition, the wheat materials of the association population are relatively stable, and the target traits can be measured under conditions of many years and multiple locations, which helps to improve the repeatability and reliability of the study. Therefore, the significantly associated loci and genes identified from the whole genome association analysis are more widely applicable and stable, and can be used for the improvement and breeding of wheat varieties. Finally, the whole genome association analysis relies on high-density SNP markers, which have been developed on the basis of the gradual improvement of the whole genome sequence of wheat and its closely related species, providing more refined genetic positioning, which helps to more accurately identify genes related to wet gluten content. Therefore, the whole genome association analysis provides a new perspective and method for the study of wheat wet gluten content, which is expected to provide more powerful support for the improvement and optimization of wheat varieties and promote further progress in wheat research. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a KASP molecular marker of the main effect QTL QWgc.cau-2D of wheat wet gluten content and its application in view of the deficiencies of the above-mentioned prior art. The present invention uses Jimai 22, Liangxing 99, Liangxing 66, Shiluan 02-1 and Taikoo nuclear sterile lines as parents to construct a related population consisting of 189 strains as a genetic population, conducts genome-wide association analysis with wheat flour wet gluten content through wheat 55K gene chip, searches for sites and genes stably associated with wheat wet gluten content, and develops KASP molecular markers of the main effect QTL of wheat wet gluten content; the molecular markers can be used for auxiliary selection breeding, and wheat strains with high wet gluten content can be quickly screened out, thereby accelerating the molecular process of high-yield wheat breeding.

[0006] In order to solve the above technical problems, the technical solution adopted by the present invention is: a SNP marker tightly linked to the main effect QTL of wheat wet gluten content, wherein the main effect QTL is QWgc.cau-2D; the SNP marker is AX-108822109, located at 3,533,015 bp of wheat 2DS chromosome, and the nucleotide sequence is shown in SEQ ID NO.1;

[0007] There is a polymorphic site of G / T allele mutation at the 36th base of the SNP marker sequence.

[0008] When the 36th base is T, the genotype of AX-108822109 is TT, the nucleotide sequence is shown in SEQ ID NO.2, and the wheat grain trait is high in moisture gluten content;

[0009] When the 36th base is G, the genotype of AX-108822109 is GG, the nucleotide sequence is as shown in SEQ ID NO.3, and the wheat grain trait is low in moisture gluten content.

[0010] The KASP molecular marker developed according to the tightly linked marker QWgc.cau-2D, the main effect QTL of wheat wet gluten content, is KASPWgc.cau-2D, the corresponding physical position is 2D: 3533015, and the linkage interval is IWGSCv1.0_chr2D: 1,643,964-6,115,557bp; the primer sequence of the KASP molecular marker is:

[0011] The nucleotide sequence of forward primer 1 is shown in SEQ ID NO.4;

[0012] The nucleotide sequence of forward primer 2 is shown in SEQ ID NO.5;

[0013] The nucleotide sequence of the reverse primer is shown in SEQ ID NO.6.

[0014] The present invention also provides a method for genotyping the major effect QTL of wheat wet gluten content using the KASP molecular marker, the method comprising:

[0015] Extracting wheat genomic DNA, and performing PCR amplification on the wheat genomic DNA using a working solution of KASP molecular marker primers containing sequences shown in SEQ ID NO.4-6;

[0016] The KASP molecular marker primer working solution consists of forward primer 1, forward primer 2, reverse primer and sterile water; wherein the concentration of the forward primer 1 is 12 μmol / mL, the concentration of the forward primer 2 is 12 μmol / mL, and the concentration of the reverse primer is 30 μmol / mL;

[0017] The PCR amplification reaction system is: DNA 50-100ng, KASP molecular marker primer working solution 0.1μL, HiGeno2×Probe Mix 4.0μL, and sterile water to 8μL;

[0018] The PCR reaction program is: pre-denaturation at 95°C for 10 minutes; denaturation at 95°C for 20 seconds, annealing / extension at 61-55°C for 40 seconds, wherein 61-55°C gradient PCR, decreasing -0.6°C per cycle, for a total of 10 cycles; denaturation at 95°C for 20 seconds, annealing / extension at 55°C for 40 seconds, for a total of 28 to 34 cycles; and storage at 12°C.

[0019] The present invention also provides an application of the KASP molecular marker, which can be used for breeding or screening wheat plants or strains or lines or varieties with high or low wet gluten content, identifying or assisting in identifying the wet gluten content of wheat grains, or comparing the wet gluten content of wheat grains to be tested.

[0020] The present invention also provides a wheat wet gluten content detection kit, which comprises the KASP molecular marker of the major effect QTL QWgc.cau-2D of the wheat wet gluten content.

[0021] Compared with the prior art, the present invention has the following advantages:

[0022] 1. The present invention uses an association population consisting of 189 wheat lines, and through genome-wide association analysis, a major effect QTL QWgc.cau.2D related to the wet gluten content of wheat is excavated, and its closely linked SNP marker is AX-108822109, which is located at 3,533,015bp on chromosome 2DS; a KASP molecular marker KASPWgc.cau-2D is developed for the marker, and the corresponding physical position is 2D:3533015, and the linkage interval is IWGSCv1.0_chr2D:1,643,964-6,115,557bp. There is a polymorphic site of G / T allele mutation at the 36th base of the marker. The polymorphic genotyping analysis of the site shows that when the genotype of AX-108822109 in the wheat material is TT, the wet gluten content of wheat flour is high; when the genotype is GG, the wet gluten content of wheat flour is low.

[0023] 2. Compared with the prior art, the present invention uses a whole genome association analysis method to obtain a KASP molecular marker for the major effect QTL QWgc.cau-2D of wheat wet gluten content, which is more widely applicable than previous QTL analysis and can be used to study wheat varieties across different environmental conditions. This marker can be used to identify various wheat materials, including local varieties, historical cultivars, modern cultivars, and breeding backbone parents; especially in the field of wheat breeding, the application of this marker can effectively screen and identify characteristics related to wet gluten content, thereby providing new resources and tools for improving wheat processing quality and cultivating high-quality new wheat varieties. This discovery is expected to play an important role in wheat variety improvement, further improve the quality and adaptability of wheat, and meet the ever-changing market demand and national food security requirements.

[0024] The present invention is further described in detail below with reference to the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 It is the distribution histogram of the wet gluten content phenotype of flour from wheat related populations planted in different years.

[0026] Figure 2 It is the Manhattan plot of the genome-wide association analysis of the BLUP values ​​of wet gluten content using a mixed linear model.

[0027] Figure 3 Violin and box plots of wet gluten content of wheat flour between alleles GG and TT of AX-108822109 under different environments.

[0028] Figure 4 This is a schematic diagram of the genotyping of the KASPWgc.cau-2D association population. DETAILED DESCRIPTION

[0029] Example 1

[0030] This example is the development of a KASP molecular marker for a major QTL for wheat wet gluten content.

[0031] 1. Related groups

[0032] An associated population of 189 lines constructed with Jimai 22, Liangxing 99, Liangxing 66, Shiluan 02-1 and Taikoo genic male sterile lines as parents.

[0033] The associated populations were planted at the Jieze Experimental Station of China Agricultural University in Handan, Hebei Province in October 2020 and October 2021 (2020-2021WGC, 2021-2022WGC). A randomized block design was used for each environment with 2 replicates. The associated populations were planted in double rows with a row length of 2m and a row spacing of 30cm. 40 seeds were sown in each row. Field management was carried out according to the standards for ordinary field production.

[0034] 2. Phenotypic measurement and statistical analysis

[0035] After wheat matured, the whole row of each family of the 189 line association population was harvested, threshed and dried naturally, and ground using the ALMB experimental mill produced by Buhler Grain Inspection Instrument Wuxi Co., Ltd. The gluten quantity and quality index determination system produced by Sweden PERTEN and Beijing Dongfu Jiuheng Instrument Technology Co., Ltd. was used to determine the wet gluten content of wheat flour. Two replicates were used for each line, and the average value was taken for data statistical analysis. The wet gluten content phenotypic data of the association population were statistically analyzed using SPSS version 20.0 (SPSS, Chicago, IL, USA).

[0036] Figure 1 This is a distribution histogram of the wet gluten content phenotype of flour from wheat-associated populations planted in different years. The horizontal axis represents the wet gluten content, the vertical axis represents the distribution density, the blue dotted line represents the data fitting normal distribution curve, and the red dotted line represents the normal fitting curve under ideal conditions; WGC21 and WGC22 represent the planting years of 2020-2021 and 2021-2022, respectively, and WGCave represents the average value. It was found that the wet gluten content of wheat flour under different environments basically conforms to the normal distribution ( Figure 1), with an average value of 39.57% and 38.74%; the minimum value was 31.50% and 29.06%; the maximum value was 48.90% and 48.57% (Table 1). The best linear unbiased estimation of wet gluten content was performed using the R language lmer4 package, and the BLUE value was between 29.07% and 48.08%, with an average value of 38.86% (Table 1). The results show that the association population has a wide range of phenotypic variation and is suitable for association analysis.

[0037] Table 1 Descriptive statistics of wet gluten content in related groups under different environments

[0038]

[0039]

[0040] 3. SNP genotyping

[0041] The genomic DNA of the associated population was extracted, and the two parents and the RILs population were genotyped using the wheat 55K SNP array (Affymetrix 55K SNP Array, CapitalBio Technology Company, Beijing, China) chip, which detected a total of 21,128 polymorphic SNP markers in the population.

[0042] 4. Genome-wide association analysis and identification of major QTL for wet gluten content

[0043] TASSEL 5.0 software was used for association analysis. First, the genotype minor allele loci were filtered (MAF<0.05). Kinship matrix (Kinship matrix) and principal component (PCA) analysis were performed based on the filtered genotypes. The first three principal components were used for mixed linear model analysis. The Manhattan plot threshold was 3 as the basis for selecting significant loci, and the SNP loci detected in different environments were used as significant loci. The detected loci were significantly correlated with the wet gluten content of wheat flour.

[0044] Figure 2 The Manhattan plot of the wet gluten content BLUP value for genome-wide association analysis using a mixed linear model. The BLUP value is the best linear unbiased estimate of wet gluten content calculated under different environments. The dotted line in the figure is -Log 10 (p) = 3, the dot pointed by the arrow represents the significant marker AX-108822109 identified in the present invention. Figure 2It shows that by analyzing the QTLs significantly related to the wet gluten content of wheat flour identified in different environments, a major QTL QWgc.cau.2D that is stable in multiple environments was identified on chromosome 2DS. 10 The (p) values ​​were 3.045-6.314, and 7.223%, 9.013% and 9.630% of the explained phenotypic variation were detected in 2020-2021, 2021-2022 and BLUE values, respectively (Table 2). By comparing and analyzing the effective SNPs screened in this interval, the closely linked significant SNP site was AX-108822109. According to the Chinese Spring reference genome sequence information (IWGSC refseqv1.0), the significant site AX-108822109 is located at 3,533,015bp nucleotides on chromosome 2DS ( Figure 2 ), the nucleotide sequence is shown in SEQID NO.1; linkage decay analysis determined the interval to be IWGSCv1.0_chr2D:1,643,964-6,115,557bp, including 8 linked SNPs.

[0045] SEQ ID NO.1:

[0046] GGGTACCGGGATTTGCATGGTGGTGAGGACGGTGGA[G / T]AGTAGTATGCCGGCTTTGCAGCAGAAATTTGTGTC.

[0047] Table 2. Correlation analysis results of QWgc.cau.2D in different environments

[0048]

[0049] 5. Verification of the genetic effect of the main QTL QWgc.cau.2D for wet gluten content

[0050] The analysis of the wet gluten content of wheat flour in wheat grains of the associated population showed that there were significant differences in the wet gluten content of wheat flour between different alleles in different environments. When the genotype of AX-108822109 was TT, its nucleotide sequence was shown in SEQ ID NO.2, and the wheat grain trait was high in wet gluten content; when the genotype of AX-108822109 was GG, its nucleotide sequence was shown in SEQ ID NO.3, and the wheat grain trait was low in wet gluten content.

[0051] Figure 3This is a violin and box plot of the wet gluten content of wheat flour between the alleles GG and TT of AX-108822109 in different environments. The blue represents the GG type, the orange represents the TT type sample, and the t test p value is marked as a subtitle (ns represents that both are not significant, "*" represents p<0.05, "**" represents p<0.05, and "***" represents p<0.001). Under different environments, the wet gluten content of wheat grain flour in the wheat material with the genotype AX-108822109_TT is extremely significantly higher than that of the AX-108822109_GG wheat material. The wet gluten content of wheat flour in the wheat materials containing the AX-108822109_TT genotype in 2020-2021WGC, 2021-2022WGC and BLUE environments was 39.91%, 39.65% and 39.73%, respectively, while the wet gluten content of wheat flour in the wheat materials containing the Whaas53100_GG genotype was 37.12%, 35.88% and 36.05% (Table 3). Comparative analysis showed that the wheat materials with the AX-108822109_TT genotype increased by 7.51%, 10.50% and 10.23% respectively compared with the wheat materials with the AX-108822109_GG genotype. The results showed that the AX-108822109_TT genotype was a favorable genotype for increasing the wet gluten content of wheat flour in wheat grains.

[0052] Table 3 Effect of different genotypes of AX-108822109 on the wet gluten content of wheat flour

[0053] WGC TT GG Increase / decrease rate (%) P-value 2020-2021WGC 39.91％ 37.12％ 7.51％ 2.57E-04 2021-2022WGC 39.65％ 35.88％ 10.50％ 1.57E-06 BLUE 39.73％ 36.05％ 10.23％ 4.86E-07

[0054] Note: The increase or decrease rate is calculated based on the increase in the wet gluten content in the TT genotype wheat material compared to the wet gluten content in the GG genotype wheat material, divided by the wet gluten content of the GG genotype, that is, the increase or decrease rate (%) = (TT-GG) / GG*100%.

[0055] 6. Development of KASP molecular markers in the QWgc.cau.2D QTL interval

[0056] According to the chromosome location of the tightly linked marker sequence QWgc.cau.2D, the SNP information of the parental sequence was converted into the KASP (Kompetitive allele specific PCR) molecular marker KASPWgc.cau-2D. The specific process and primer sequence information are as follows:

[0057] The primer sequences SEQ ID NO.7 and SEQ ID NO.8 were obtained by reverse complementation at 20 bp downstream of SNP. FAM and HEX fluorescent group linker sequences were connected to the 5' ends of the sequences SEQ ID NO.7 and SEQ ID NO.8, respectively, and used as forward primers for KASPWgc.cau-2D molecular markers to detect the polymorphism of the single nucleotide marker (SNP) of the major effect QWgc.cau.2D tightly linked marker KASPWgc.cau-2D, wherein the allele was T type connected with FAM fluorescent group, and the allele was G type connected with HEX fluorescent group, and forward primer 1 and forward primer 2 were obtained, the nucleotide sequence of forward primer 1 was shown in SEQ ID NO.4, and the nucleotide sequence of forward primer 2 was shown in SEQ ID NO.5; the nucleotide sequence of the reverse primer of the KASPWgc.cau-2D molecular marker was shown in SEQ ID NO.6.

[0058] Example 2

[0059] This example is a method for genotyping using KASP molecular markers for major effect QTL of wheat wet gluten content, and the specific steps are as follows:

[0060] (1) Extract wheat genomic DNA.

[0061] In this example, the wheat genomic DNA template comes from Beijing Jiacheng Biotechnology Co., Ltd., China, and the product concentration is 50-100 ng / μL.

[0062] (2) KASP primer preparation: The newly synthesized primers were diluted to a concentration of 100 μmol / mL and the KASP primer working solution was prepared according to the proportions in Table 4.

[0063] Table 4 KASP primer working solution composition, volume and concentration

[0064]

[0065] (3) PCR amplification

[0066] The total volume of the PCR reaction system is 8 μL: 50-100 ng DNA template, 0.1 μL KASP primer working solution, 4.0 μL HiGeno 2×Probe Mix, and sterile water to 8 μL;

[0067] PCR reaction program: 95℃ pre-denaturation for 10min; 95℃ denaturation for 20s, 61-55℃ annealing / extension for 40s, 61-55℃ gradient PCR, -0.6℃ reduction per cycle, 10 cycles in total; 95℃ denaturation for 20s, 55℃ annealing / extension for 40s, 28-34 cycles in total; 12℃ storage;

[0068] After the PCR amplification cycle was completed, the fluorescence signal value was read using a Bio-rad CFX-96instrument real-time PCR instrument in the endpoint fluorescence mode at 37°C for 1 min.

[0069] Figure 4 This is a schematic diagram of the genotyping of the KASPWgc.cau-2D associated population in this example, where the ordinate and abscissa numbers represent the intensity of the HEX and FAM fluorescence signals, respectively; dots represent T alleles (high-humidity gluten type); squares represent G alleles (low-humidity gluten type); and the lower left triangle is the NTC negative control.

[0070] The molecular marker KASPWgc.cau-2D of the present invention can be effectively used for the identification of the wet gluten content of wheat, and can effectively screen the wheat materials in the early breeding generations. Selecting the wheat materials of the genotype AX-108822109_TT for the cultivation of high wet gluten content wheat can shorten the breeding time and improve the breeding process.

[0071] The above is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent change made to the above embodiment according to the technical essence of the invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. A SNP marker tightly linked to a major QTL for wheat wet gluten content, characterized in that: The major effect QTL is QWgc.cau-2D; the SNP marker is AX-108822109, located at 3,533,015 bp of wheat 2DS chromosome, and the nucleotide sequence is shown in SEQ ID NO.1; There is a polymorphic site of G / T allele mutation at the 36th base of the SNP marker sequence. When the 36th base is T, it is a TT genotype with high moisture gluten content, and the nucleotide sequence is shown in SEQ ID NO.

2. When the 36th base is G, it is a GG genotype with low wet gluten content, and the nucleotide sequence is shown in SEQ ID NO.

3.

2. The KASP molecular marker developed from the tightly linked marker of the major QTL QWgc.cau-2D for wheat wet gluten content according to claim 1, characterized in that: The KASP molecular marker is KASPWgc.cau-2D, the corresponding physical position is 2D: 3533015, and the linkage interval is IWGSCv1.0_chr2D: 1,643,964-6,115,557bp; the primer sequence of the KASP molecular marker is: The nucleotide sequence of forward primer 1 is shown in SEQ ID NO.4, The nucleotide sequence of forward primer 2 is shown in SEQ ID NO.

5. The nucleotide sequence of the reverse primer is shown in SEQ ID NO.

6.

3. A method for genotyping major QTL of wheat wet gluten content using the KASP molecular marker according to claim 2, characterized in that: The method is: Extracting wheat genomic DNA, and performing PCR amplification on the wheat genomic DNA using a working solution of KASP molecular marker primers containing sequences shown in SEQ ID NO.4-6; The KASP molecular marker primer working solution consists of forward primer 1, forward primer 2, reverse primer and sterile water; wherein the concentration of the forward primer 1 is 12 μmol / mL, the concentration of the forward primer 2 is 12 μmol / mL, and the concentration of the reverse primer is 30 μmol / mL; The PCR amplification reaction system is: DNA 50-100ng, KASP molecular marker primer working solution 0.1μL, HiGeno 2×Probe Mix 4.0μL, and sterile water to 8μL; The PCR reaction program is: pre-denaturation at 95°C for 10 minutes; denaturation at 95°C for 20 seconds, annealing / extension at 61-55°C for 40 seconds, wherein 61-55°C gradient PCR, decreasing -0.6°C per cycle, for a total of 10 cycles; denaturation at 95°C for 20 seconds, annealing / extension at 55°C for 40 seconds, for a total of 28 to 34 cycles; and storage at 12°C.

4. Application of the KASP molecular marker according to claim 2 in auxiliary breeding related to the wet gluten content of wheat grains.

5. The use according to claim 4, characterized in that: The application includes breeding or screening wheat plants, lines, strains or varieties with high or low wet gluten content.

6. Use of the KASP molecular marker according to claim 2 in identifying or assisting in identifying the wet gluten content of wheat grains.

7. Use of the KASP molecular marker according to claim 2 in comparing the wet gluten content of wheat grains to be tested.

8. A wheat wet gluten content detection kit, characterized in that: The kit includes KASP molecular marker primers of the major effect QTL QWgc.cau-2D of wheat wet gluten content, and the sequence of the KASP molecular marker primers is: The nucleotide sequence of forward primer 1 is shown in SEQ ID NO.4, The nucleotide sequence of forward primer 2 is shown in SEQ ID NO.

5. The nucleotide sequence of the reverse primer is shown in SEQ ID NO.6.

Images