Saccharomyces cerevisiae INM3117 capable of reducing bitterness and application of saccharomyces cerevisiae INM3117 in whole wheat products

Abstract

The invention provides a Saccharomyces cerevisiae strain INM3117 capable of reducing bitterness and application of the Saccharomyces cerevisiae strain INM3117 in whole wheat products, the Saccharomyces cerevisiae strain INM3117 is preserved in Guangdong Microbial Culture Collection Center on August 13, 2024, the preservation number is GDMCC NO: 65003, the preservation number is CGMCC NO: 65003, and the Saccharomyces cerevisiae strain INM3117 is preserved in Guangdong Microbial Culture Collection Center on August 13, 2024. The preservation address is the fifth floor of the building 59, No.100 courtyard, Xianlie Middle Road, Guangzhou City. The method has the advantages that the content of postnatal acid in whole-wheat dough fermentation can be effectively reduced, the taste of whole-wheat products is improved, and bitter taste is reduced.

Description

Technical Field

[0001] The invention relates to a strain of brewer's yeast INM3117 capable of reducing bitterness and application thereof in whole-wheat products. Background Art

[0002] 9,12,13-trihydroxy-10-octadecenoic acid is a chemical substance with a molecular formula of C8H34O5, a molecular weight of 330.46, and a density of 1.074g / cm3. In 2016, Bin et al. showed that 9,12,13-trihydroxy-10-octadecenoic acid is closely related to the bitterness of whole wheat products. The content of 9,12,13-trihydroxy-10-octadecenoic acid in whole wheat flour is very low, but the content in flour water and after baking increases by 30 times, which means that a large amount of 9,12,13-trihydroxy-10-octadecenoic acid is produced during the fermentation process, making the whole wheat product very bitter.

[0003] Saccharomyces cerevisiae, also known as baker's yeast or budding yeast, is generally spherical, oval, elliptical, and some are cylindrical, lemon-shaped, etc. At present, Saccharomyces cerevisiae and yeast derivatives have been widely used in food (winemaking, baking and Chinese fermentation, seasoning production, etc.), medicine and chemical industry (instant nutritional yeast, yeast glutathione, RNA, B vitamins, yeast polysaccharides, ergosterol, etc.), agriculture (single-cell protein feed, agricultural fertilizer, probiotics, etc.), bioenergy (fuel ethanol), bioengineering (receptor bacteria for genetic engineering), and other fields. Studies have shown that Saccharomyces cerevisiae can effectively metabolize a variety of organic acids, effectively helping fruits, grains and other raw materials to reduce the types and quantities of organic acids. In 2020, Chen Sirui published the paper "Screening and Identification of Highly Efficient Citric Acid Degrading Yeast and Its Acid Reducing Properties in Red Raspberry Juice", proving that yeast can effectively degrade citric acid. In 2003, Zhao Yuping published "Research on Reducing Organic Acid Content in Hawthorn Juice by Yeast Fermentation", which also proved that yeast can effectively reduce total acid, citric acid and malic acid in hawthorn. This also provides the theoretical basis for this patent.

[0004] At present, there are few studies on the metabolism of tenacin by brewer's yeast. Patent: Preparation and application of a traditional Chinese medicine hairy fruit liver protection active ingredient - CN202410417717.X. This invention involves the presence of tenacin in the extract of the traditional Chinese medicine hairy fruit, and does not involve yeast fermentation to reduce tenacin, so it is different from the application direction of this patent. Only one related patent mentioned tenacin above, which shows that the impact of tenacin on whole wheat products is still in a blank stage in China. It can be seen that developing a safe and effective strain that reduces tenacin to reduce the bitterness of whole wheat products has a very broad application prospect.

[0005] There are still some deficiencies in the practical application research of taurateuric acid: (1) The microorganisms involved in the degradation of taurateuric acid by microorganisms are still unknown. (2) In industrial use, there is still a lack of a yeast that can be directly used to degrade taurateuric acid in the production process of whole wheat products. Summary of the invention

[0006] In view of the above problems, the present invention provides a strain of brewer's yeast INM3117 for reducing bitterness and its application in whole-wheat products. On the basis of not changing the existing process, the whole-wheat flour is fermented by brewer's yeast to produce a method for reducing the content of taurateuric acid in whole-wheat products, which not only reduces the content of taurateuric acid in the whole-wheat products, but also improves the flavor and quality of the whole-wheat products. The whole-wheat products produced by the preparation do not affect the overall process of the whole-wheat products after fermentation, which not only improves the taste of the whole-wheat products but also reduces the adverse factors brought by the whole-wheat products.

[0007] The object of the invention is achieved through the following scheme: A strain of brewer's yeast with reduced bitterness, brewer's yeast (Saccharomyces cerevisiae) INM3117, was deposited in Guangdong Provincial Microbiological Culture Collection Center on August 13, 2024, with the deposit number: GDMCC NO: 65003; the deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0008] Furthermore, the colony characteristics of brewer's yeast are as follows: after culturing on solid malt wort plate medium for 48 hours, the colony diameter reaches 5-6 mm, the colonies are milky white, raised, round, with a smooth surface and neat edges.

[0009] A method for preparing brewer's yeast with reduced bitterness,

[0010] Step 1: Isolation of brewer's yeast: Isolate and screen yeast from fermented yogurt samples, make yogurt products into a slurry, add it to sterile water, and dilute it to a concentration of 10 5 -10 6 , evenly spread the dairy products of different dilution concentrations on the solid malt juice medium, put it in an incubator at 30℃ for 48 hours, and then select the white colonies on the solid malt juice medium and the yeasts with the same morphology for screening;

[0011] Step 2: Saccharomyces cerevisiae screening: The obtained Saccharomyces cerevisiae was cultured to the logarithmic growth phase, and then inoculated with 1% of the strain, and the final concentration of the strain was 1×10 6 cfu / mL, inoculated into the screening culture medium solution, placed in 30℃ for 3 days to obtain the fermentation liquid; the content and type of taurine were measured.

[0012] Furthermore, the formula of the screening culture medium solution is: commercial malt extract culture medium is prepared according to the formula requirements, 0.1 MPa, 121° C. sterilized for 15 minutes; 0.1% taurateuric acid is added when used.

[0013] An application of brewer's yeast INM3117 for reducing bitterness, production application: according to the production process of rice products, the inoculation amount in the fermented rice product liquid is 10 4 -10 8 cfu / mL of the bitterness-reducing Saccharomyces cerevisiae INM3117. After the fermentation time was 3 days and the fermentation temperature was 37°C, arginine, ethyl caprylate and their sensory quality in the fermentation broth were detected.

[0014] An application of brewer's yeast INM3117 for effectively reducing the content of thymic acid in whole-wheat dough after fermentation and reducing bitterness.

[0015] Application of brewer's yeast INM3117 for reducing bitterness in whole-wheat products.

[0016] Advantages of the present invention: (1) The bitterness-reducing brewer's yeast INM3117 of the present invention can effectively reduce the content of thymic acid in whole-wheat dough after fermentation, thereby improving the taste of whole-wheat products and reducing bitterness.

[0017] (2) The screening method for brewer's yeast INM3117 that reduces bitterness is universal and can be widely used in the screening of strains that reduce the content of taurine in whole-wheat products.

[0018] (3) The bitterness-reducing brewer's yeast INM3117 has substances that can reduce the bitterness of whole wheat, and the whole wheat product after fermentation will not have any peculiar smell. It can be mixed with other grain flours in the later stage, which means that the nutrition and flavor of whole wheat are retained without any safety risks. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Flow chart of strain screening.

[0020] Figure 2 Morphological observation diagram of brewer's yeast INM3117 for reducing bitterness.

[0021] Figure 3 Microscopic observation of Saccharomyces cerevisiae INM3117 to reduce bitterness.

[0022] Figure 4 This is a graph showing the results of the stability test of Example 2.

[0023] Figure 5 This is the result diagram of the whole wheat baker's acid content in Example 3.

[0024] Figure 6The inoculation concentration in Example 3 is 1.0×10 7 Schematic diagram of the reduction of taurine content in CFU / mL.

[0025] Figure 7 The results of screening different yeasts for degrading taurine in Example 1 are shown in FIG. DETAILED DESCRIPTION

[0026] The present invention will be further described below in conjunction with specific embodiments:

[0027] Unless otherwise specified, the experimental methods used in the following embodiments are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial channels.

[0028] Example 1, see attached Figure 1-7 , a strain of brewer's yeast that reduces bitterness, Saccharomyces cerevisiae INM3117, was deposited in Guangdong Provincial Microbiological Culture Collection Center on August 13, 2024, with the deposit number: GDMCC NO: 65003; the deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0029] A strain of brewer's yeast that reduces bitterness. The colony characteristics of the brewer's yeast are as follows: after culturing on a solid malt wort plate for 48 hours, the colony diameter reaches 5-6 mm, the colony is milky white, raised, round, with a smooth surface and neat edges.

[0030] A method for preparing brewer's yeast INM3117 with reduced bitterness, 1. Processing of raw materials

[0031] Take yogurt from Hezuo City, Gannan Tibetan Autonomous Prefecture, add sterile saline and dilute to 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 Concentration, make bacterial dilution, take 0.1mL from each concentration dilution and evenly spread it on the malt juice solid culture medium plate, culture at 30℃ for 48h, select single colonies with white colonies, raised colonies, smooth surface and neat colony edges, streak the colonies on the malt juice solid culture medium for secondary purification, culture at 30℃ for 48h, pick single colonies for glycerol preservation, and name them GQY1901~GQY1909 respectively. The screening process is as follows Figure 1 ;

[0032] 2. Preliminary screening of bacterial strains

[0033] The 9 strains were inoculated into malt juice liquid medium at 1% inoculum and cultured at 30°C with a shaker at 220 rpm / min for 24 h. Then, they were inoculated into screening medium at 1% inoculum and cultured statically at 30°C for 24 h until the final cell density reached 10 6 Take samples from each tube, centrifuge at 10,000 rpm / min for 10 min, and obtain the supernatant as the sample.

[0034] The formula of the screening medium is: commercial malt extract medium is prepared according to the formula requirements, 0.1MPa, sterilized at 121℃ for 15min. 0.1% celecoxib is added when using.

[0035] Detection method of tianshi acid: Agilent liquid chromatography-mass spectrometry equipment is used to detect tianshi acid.

[0036] HPLC conditions: 2 μL of sample was injected into an ACQUITY UPLC BEH C18 1.7 μm column (2.1 mm × 50 mm) (Waters, Milford, MA) at 25 °C with a mobile phase of 0.1% formic acid in water (A) and acetonitrile (B) at a flow rate of 0.3 mL / min. The elution gradient started from 5% B (0-1 min), increased linearly to 50% B (1-6 min), then increased to 100% B (6-8 min), maintained at 100% B (8-10 min), and re-equilibrated to 5% B (10-15 min).

[0037] Mass spectrometry conditions: The ion source was a negative electrospray ionization source (ESI - ), mass scanning range m / z50-500Da, scanning time 0.2s, ionization source temperature 120℃, desolvation gas temperature 450℃, desolvation gas flow rate 800L / h, cone voltage 40V, capillary voltage 2.2kV, collision gas argon, high collision energy 20-75eV. According to Bin et al. (2016), the parent ion and daughter ion of Tianshi acid were respectively 329 for parent ion mass-to-nuclear ratio (m / z) and 211 for daughter ion mass-to-nuclear ratio, and qualitative and quantitative analysis was performed.

[0038] The three strains GQY1901, GQY1905 and GQY1909 with the highest degradation rate of taurine were selected for rescreening.

[0039] 3. Strain rescreening

[0040] The yeast strains GQY1901, GQY1905 and GQY1909 selected in the initial screening were reactivated and cultured, and the medium seed was prepared according to the national standard GB / T14612-2008 method, with a cell concentration of 10 6 cfu / mL, fermentation time 12h, fermentation temperature 30℃, made into whole wheat bread for sensory evaluation, the results are shown in Table 1

[0041] Table 1 Sensory analysis of fermented bread

[0042] Species name bitterness Flavor Average score GQY1901 5.0 5.0 5.0 GQY1903 5.0 4 4.5 GQY1907 4.0 4.5 4.25

[0043] Note: The maximum score for each indicator is 5 points, and the higher the score, the better the result.

[0044] From the results in Table 1, it can be seen that GQY1901 has the best sensory evaluation result. As the target strain for rescreening, the morphological observation of this strain on the solid maltose plate medium is as follows: Figure 2 As shown, the colony diameter is 4-5mm, the colony is milky white, the colony is convex and round, the surface is smooth, and the colony edge is neat. After Gram staining, it is observed under a microscope. The results are as follows Figure 3 shown.

[0045] The GQY1901 obtained by the above screening was subjected to ITS sequencing identification. After comparative analysis, the 28SrRNA region sequence obtained from the strain of the present invention was 99.83% similar to that of Saccharomyces cerevisiae. It can be determined that the strain is a strain of Saccharomyces cerevisiae, which can be used in the food fermentation industry. It is named Saccharomyces cerevisiae INM3117. The strain was deposited in the Guangdong Provincial Microbiological Culture Collection Center on August 13, 2024, with the deposit number: CGMCC65003. Therefore, INM3117 and GQY1901 refer to the same strain in this application. The GQY1901 strain of the present invention was genetically identified, and its gene sequence is as follows:

[0046] GACGGGCGGCATATAACCATTATGCCAGCATCCTTGACTTACGTCGCAGTCCTCAGTCCCAGC

[0047] TGGCAGTATTCCCACAGGCTATAATACTTACCGAGGCAAGCTACATTCCTATGGATTTATCCT

[0048] GCCACCAAAACTGATGCTGGCCCAGTGAAATGCGAGATTCCCCTACCCACAAGGAGCAGAGGG

[0049] CACAAAACACCATGTCTGATCAAATGCCCTTCCCTTTCAACAATTTCACGTACTTTTTCACTC

[0050] TCTTTTCAAAGTTCTTTTCATCTTTCCATCACTGTACTTGTTCGCTATCGGTCTCTCGCCAAT

[0051] ATTTAGCTTTAGATGGAATTTACCACCCACTTAGAGCTGCATTCCCAAACAACTCGACTCTTC

[0052] GAAGGCACTTTACAAAGAACCGCACTCCTCGCCACACGGGATTCTCACCCTCTATGACGTCCT

[0053] GTTCCAAGGAACATAGACGAGGAACGGCCCCAAAGTTGCCCTCTCCAAATTACAACTCGGGCA

[0054] CCGAAGGTACCAGATTTCAAATTGAGCTTTTGCCGCTTCACTCGCCGTTACTAAGGCAATCC

[0055] CGGTTGGTTTCTTTTCCTC

[0056] Example 2, genetic stability detection of Saccharomyces cerevisiae INM3117

[0057] The brewer's yeast INM3117 in Example 1 was propagated for 10 generations on the screening liquid culture medium. The first, fifth and tenth generation samples were centrifuged at 10,000 rpm / min for 10 min to obtain the supernatant, which was used as the sample for physical and chemical index detection. The method for detecting the content of celestial acid was referred to Example 1. At the same time, a sensory evaluation was performed to determine its stability in propagation. The specific data is shown in Figure 4 .

[0058] Figure 4 The results showed that the fermentation performance of different generations of Saccharomyces cerevisiae INM3117 was normal, the change of the rate of reduction of thiamethoxam acid was within 10%, the strain had good genetic stability and met the requirements for production and use.

[0059] Example 3, making bread with yeast INM3117

[0060] Saccharomyces cerevisiae INM3117 was inoculated into the fermented dough to make whole wheat flour and whole wheat bread according to the national standard GB / T14612-2008. The inoculated fermentation bacteria concentration was 10 4 -10 8 CFU / mL, whole wheat bread was made respectively, and no experimental yeast was added as the control group.

[0061] Extraction of taurine: 5g whole wheat bread was dissolved in 75% ethanol (10 times its weight), centrifuged at 8000rpm / min, 5℃ for 10min, filtered through a 0.45μm filter membrane, freeze-dried, and dissolved in 10% methanol (1 times its weight). The method for detecting taurine in bread was as described in Example 1. The results were as follows: Figure 5 shown.

[0062] Table 2 Sensory evaluation results of whole wheat bread

[0063]

[0064] Note: Each assessment has a maximum score of 10 points, with a scoring interval of 0.1. The comprehensive score is the sum of all items. The higher the score, the better the result.

[0065] Depend on Figure 5 As shown in Table 2, the inoculation concentration of Saccharomyces cerevisiae INM3117 in whole wheat bread can significantly reduce the content of taurine in whole wheat bread, and the more inoculation amount, the lower the content of taurine. However, too high inoculation concentration of Saccharomyces cerevisiae INM3117 affects the flavor of bread because the metabolism of Saccharomyces cerevisiae affects the sourness, bitterness and taste of bread. The most suitable inoculation concentration is 1.0×10 7 CFU / mL, the concentration of this strain can effectively reduce the content of taurine (20.58mg / Kg, the test results are as follows Figure 6 ), and can improve the flavor and taste of whole wheat bread.

[0066] Example 4: Preparation of whole-wheat toast using yeast INM3117

[0067] The final concentration of Saccharomyces cerevisiae INM3117 was 10 7 CFU / mL was used to make whole wheat flour seeds, and then whole wheat toast was made according to the national standard GB / T14612-2008 method, with no experimental strain added as the control group. After the fermentation was completed, the hardness of the whole wheat toast was tested, and the content of taurine was measured according to the method in Example 1. At the same time, professional appraisers were invited to conduct sensory evaluation on the flavor of the whole wheat toast, and the results are recorded in Table 3.

[0068] Hardness test: Use flat-bottom cylindrical probe P / 36R. Test conditions are as follows: pre-test rate: 1mm / s; test rate: 1mm / s; post-test rate: 3mm / s; compression degree: 50%; dwell interval: 5s; trigger value: 5g. Each test is repeated 5 times.

[0069] Table 3 Whole wheat toast testing and sensory evaluation results

[0070]

[0071] Note: Each sensory evaluation item has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item.

[0072] From the results in Table 3, we can see that 10 7 CFU / mL brewer's yeast INM3117 can significantly reduce the content of taurine in whole wheat toast; in addition, it can also improve the sensory evaluation of toast, increase the aroma of toast, improve the flavor and taste of toast, and make the toast fragrant, sweet and sour.

[0073] Example 5, Preparation of European bread with Saccharomyces cerevisiae INM3117

[0074] The final concentration of Saccharomyces cerevisiae INM3117 was 10 7 CFU / mL of whole wheat flour seeds were prepared, and then European bread was prepared according to the national standard GB / T14612-2008 method, and no experimental strain was added as the control group. After the fermentation was completed, the content of thymic acid in the whole wheat European bread was detected according to the method in Experimental Example 1, and the hardness of the whole wheat European bread was detected according to the method in Experimental Example 4. Professional appraisers were invited to conduct sensory evaluation on the flavor of the whole wheat European bread, and the results are recorded in Table 4.

[0075] Table 4 Testing and sensory evaluation results of whole wheat European bread

[0076]

[0077] Note: Each sensory evaluation item has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item.

[0078] From the results in Table 4, we can see that in whole wheat, 10 7 CFU / mL brewer's yeast INM3117 can significantly reduce the content of thymic acid in whole-wheat European bread; in addition, it can also improve the sensory evaluation of whole-wheat European bread, increase the aroma of whole-wheat European bread, and improve the flavor and taste of whole-wheat European bread, making the whole-wheat European bread fragrant and sweet and sour.

[0079] Example 6, making meal buns with yeast INM3117 dough

[0080] The final concentration of Saccharomyces cerevisiae INM3117 was 10 7 The whole wheat flour inoculation concentration was prepared with a dose of 1000 CFU / mL, and another group of people were inoculated with GQY1904 as the control group, and then meal packs were made according to the national standard GB / T14612-2008 method.

[0081] After fermentation, the content of taurine in the whole-wheat buns was detected according to the method in Experimental Example 1, and the hardness of the whole-wheat buns was detected according to the method in Experimental Example 4. At the same time, professional appraisers were invited to conduct sensory evaluation on the flavor of the European buns, and the results are recorded in Table 5.

[0082] Table 5 Testing and sensory evaluation results of whole wheat meal bread

[0083]

[0084] Note: Each sensory evaluation item has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item.

[0085] From the results in Table 5, we can see that in whole wheat, 10 7 CFU / mL brewer's yeast INM3117 can significantly increase the types and content of cetrimonial acid in the fermented dough; in addition, it can also improve the sensory evaluation of lunch buns, increase the aroma of lunch buns, improve the flavor and taste of whole-wheat lunch buns, and make the whole-wheat lunch buns fragrant, sweet and sour.

[0086] Based on the results of the above embodiments, the brewer's yeast (Saccharomyces cerevisiae) INM3117 provided by the present invention is applied to the fermentation of whole-wheat flour. On the basis of not changing the existing process, it can significantly increase the types and contents of taurateurine in the relevant whole-wheat flour, while also improving the aroma and taste of the whole-wheat product, and significantly improving the quality of the whole-wheat grain product.

[0087] The above-mentioned embodiments only express several implementation methods of the present invention, and the description is relatively specific and detailed, but it cannot be understood as limiting the scope of the invention patent. It should be pointed out that for ordinary technicians in this field, several modifications and improvements can be made without departing from the concept of the present invention. Therefore, the protection scope of the patent of the present invention shall be based on the attached claims.

Claims

1. A strain of Saccharomyces cerevisiae with reduced bitterness, characterized in that: Saccharomyces cerevisiae INM3117 was deposited in Guangdong Provincial Microbiological Culture Collection Center on August 13, 2024, with the deposit number: GDMCC NO: 65003; the deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

2. The bitterness-reducing yeast according to claim 1, characterized in that: The colony characteristics of brewer's yeast are as follows: after culturing on solid malt wort plate medium for 48 hours, the colony diameter reaches 5-6mm, the colonies are milky white, raised, round, with a smooth surface and neat edges.

3. A method for preparing the bitterness-reducing brewer's yeast according to claim 1, characterized in that: Step 1: Isolation of brewer's yeast: Isolate and screen yeast from fermented yogurt samples, make yogurt products into a slurry, add it to sterile water, and dilute it to a concentration of 10 5 -10 6 , evenly spread the dairy products of different dilution concentrations on the solid malt juice medium, put it in an incubator at 30℃ for 48 hours, and then select the white colonies on the solid malt juice medium and the yeasts with the same morphology for screening; Step 2: Saccharomyces cerevisiae screening: The obtained Saccharomyces cerevisiae was cultured to the logarithmic growth phase, and then inoculated with 1% of the strain, and the final concentration of the strain was 1×10 6 cfu / mL, inoculated into the screening culture medium solution, placed in 30℃ for 3 days to obtain the fermentation liquid; the content and type of taurine were measured.

4. The method for preparing the bitterness-reducing Saccharomyces cerevisiae INM3117 according to claim 1, characterized in that: The formula of the screening culture medium solution is as follows: commercial malt extract culture medium is prepared according to the formula requirements, 0.1 MPa, sterilized at 121°C for 15 minutes. 0.1% taurateuric acid is added when used.

5. A use of the bitterness-reducing Saccharomyces cerevisiae INM3117 according to claim 1, characterized in that: Production application: According to the production process of rice products, the inoculation amount in the fermented rice product liquid is 10 4 -10 8 cfu / mL of the bitterness-reducing Saccharomyces cerevisiae INM3117. After the fermentation time was 3 days and the fermentation temperature was 37°C, arginine, ethyl caprylate and their sensory quality in the fermentation broth were detected.

6. An application of the brewer's yeast INM3117 according to claim 1 for effectively reducing the content of thymic acid in whole-wheat dough after fermentation and reducing bitterness.

7. Use of the bitterness-reducing Saccharomyces cerevisiae INM3117 according to claim 1 in whole-wheat products.

Images