KASP molecular markers related to zinc content in millet grains and their application

Abstract

This case involves a KASP molecular marker related to zinc content in millet grains, wherein primers are designed according to target SNP sites, and at least include an upstream primer set and a downstream primer; the upstream primer set includes a first upstream primer and a second upstream primer, and the ends of the first upstream primer and the second upstream primer are respectively set to different allelic variant bases based on the target SNP site. The KASP molecular marker related to zinc content in millet grains of the present invention designs primers according to target SNP sites, and utilizes specific matching of primer terminal bases to type the corresponding SNP. The KASP molecular marker of the present invention can detect multiple samples in high throughput, greatly improving detection efficiency, reducing time and labor costs, and is very beneficial for large-scale molecular marker-assisted screening of zinc-rich millet breeding materials in the field, thereby improving breeding efficiency.

Description

Technical Field

[0001] The invention relates to the technical field of millet breeding, and in particular to a KASP molecular marker related to zinc content in millet grains and an application thereof. Background Art

[0002] Millet originated in the Yellow River Basin of my country and has a history of 8,000 years of cultivation in my country. It has had a profound impact on my country's agricultural civilization, and its cultivated area in China ranks first in the world. Millet has high nutritional value. Its grains contain a large amount of protein, essential amino acids, minerals and vitamins, especially mineral elements such as iron and zinc, which are 4-5 times that of staple crops such as rice and wheat.

[0003] Adequate supply and reasonable management of trace elements in crops have an important impact on crop growth and yield. Appropriate trace elements can improve crop resistance, increase yield and quality, and also help enhance crop resistance to diseases and pests. However, excessive or insufficient trace elements can lead to abnormal crop growth, reduced yields, and even accumulation of harmful substances. Humans ingest trace elements through crops, so the content of trace elements in crops has an important impact on human health. Due to the general lack of trace nutrients in staple food crops, hidden hunger is prevalent around the world, resulting in a weak human immune system.

[0004] Zinc is an essential trace element in plants and animals. It can maintain the normal physiological activities and functions of plants and animals. Many enzymes in the life activities of plants and animals must be involved in zinc to function. For plants, the symptoms of zinc deficiency are mainly manifested in the chlorotic and yellowing of plant leaves, significantly smaller leaf shape, slow growth, small leaves, shortened stem internodes, and even complete cessation of internode growth. For the human body, people with zinc deficiency are prone to decreased digestive function, delayed growth and development, reduced immune function, and delayed intellectual development. The human body ingests trace elements through crops, so appropriately increasing the zinc content in millet grains and cultivating zinc-rich millet varieties are of great significance to human health.

[0005] In millet, only two studies have used genome-wide association studies (GWAS) to identify key quantitative trait loci (QTLs) associated with trace element content in millet grains, of which there are eight QTL loci associated with zinc content, distributed on chromosomes 2, 7, and 9 (Jaiswal et al., 2019; Jaiswal et al., 2024). In addition, a study identified and validated seven SiZIP gene family members (SiZIP1-7) in millet through transcriptome analysis. These genes encode functional zinc or iron transporters, four of which (Si02298m.g, Si03557m.g, Si010244m.g, and Si013901m.g) can significantly improve the bioavailability of zinc and iron in millet grains (Alagarasan et al., 2017). However, the above studies have not yet used relevant genetic markers for molecular breeding of millet.

[0006] Competitive Allele-Specific PCR (KASP) is a molecular biology technique used for genotyping that can detect single nucleotide polymorphisms (SNPs) and insertions and deletions (InDels) in DNA samples. KASP uses primers specific to alleles to competitively amplify target DNA sequences containing specific genetic variations during the PCR process. It can accurately determine SNPs or InDels that are widely present in genomic DNA. It is a high-throughput, low-cost, and low-error rate SNP typing technology.

[0007] Therefore, it is of great value to explore QTLs and candidate genes related to zinc content in millet grains and develop KASP molecular markers for them to screen millet varieties rich in zinc content, which is of great value for assisted selection breeding of millet. Summary of the invention

[0008] In view of the shortcomings of the prior art, the present invention aims to develop and provide a KASP molecular marker related to the zinc content in millet grains based on the use of GWAS to explore QTLs and candidate genes related to the zinc content in millet grains. The KASP molecular marker is applied to the selection of millet varieties and can be used to identify or assist in the identification of the zinc content in millet, providing excellent gene resources and selection tools for the molecular breeding of zinc-rich millet, thereby improving the selection efficiency.

[0009] To achieve the above object, the present invention provides the following technical solutions:

[0010] A KASP molecular marker related to zinc content in millet grains, wherein primers are designed according to a target SNP site, and at least include an upstream primer set and a downstream primer; the upstream primer set includes a first upstream primer and a second upstream primer, and the ends of the first upstream primer and the second upstream primer are respectively set to different allele variant bases based on the target SNP site;

[0011] Wherein, the sequence of the first upstream primer is 5'-GAAGGTGACCAAGTTCATGCTCCTCCACGTCTTCAAGGGCC-3',

[0012] The sequence of the second upstream primer is 5'-GAAGGTCGGAGTCAACGGATTCCTCCACGTCTTCAAGGGCT-3';

[0013] The sequence of the downstream primer is 5'-GATGGGGTAATAGCTCACGA-3'.

[0014] Furthermore, the 5' end of the first upstream primer is connected to a FAM fluorescent tag sequence "GAAGGTGACCAAGTTCATGCT".

[0015] Furthermore, the 5' end of the second upstream primer is connected to the HEX fluorescent tag sequence "GAAGGTCGGAGTCAACGGATT".

[0016] Furthermore, the downstream primer is set to control the length of the amplification product to be 60-120 bp.

[0017] The present invention further provides an application of the above-mentioned KASP molecular marker related to zinc content in millet seed in millet variety breeding, comprising the following steps:

[0018] The whole genome DNA of millet test materials is extracted, and the DNA is used as a template, and the KASP molecular marker is used for PCR amplification, and the obtained amplification products are scanned for fluorescence signals, and different genotypes are distinguished according to the fluorescence signals, and the zinc content of millet grains corresponding to different genotypes is obtained according to the phenotypes of the test materials; the zinc content of the grains in the materials with genotypes GG and GA is significantly higher than that in the materials with genotypes AA;

[0019] The whole genome DNA of the millet variety or strain to be tested is extracted and used as a template. The KASP molecular marker is used for PCR amplification. The obtained amplification product is scanned for fluorescence signals, and millet varieties with a genotype with a higher grain zinc content are selected according to the fluorescence signals.

[0020] The beneficial effects of the present invention are as follows: the KASP molecular marker related to zinc content in millet grains of the present invention designs primers according to target SNP sites, utilizes specific matching of primer terminal bases to type corresponding SNPs, obtains KASP molecular marker related to zinc content in millet grains, applies it to millet variety breeding, and can be used to identify or assist in identifying the zinc content in millet; the KASP molecular marker of the present invention can detect multiple samples with high throughput, greatly improves detection efficiency, reduces time and labor costs, is very beneficial to large-scale molecular marker-assisted screening of zinc-rich millet breeding materials in the field, and improves breeding selection efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0022] Figure 1 This is the result of genome-wide association analysis between zinc content in millet grains and SNP markers.

[0023] Figure 2 This is a graph showing the detection results of the KASP molecular marker for the allele type related to the zinc content in the test group of millet.

[0024] Figure 3 This is a graph showing the determination results of zinc content in grains of different genotype materials. DETAILED DESCRIPTION

[0025] The technical solution of the present invention will be described clearly and completely below in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0026] In addition, the technical features involved in the different embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0027] Embodiment 1:

[0028] [Exploring significant association loci controlling zinc content in millet grains through genome-wide association analysis]:

[0029] Materials: The natural population used for association analysis consisted of 408 millet varieties collected from 15 provinces, municipalities and autonomous regions in China, including 73 from Shanxi Province, 59 from Hebei Province, 41 from Henan Province, 32 from Shandong Province, 16 from Liaoning Province, 6 from Jilin Province, 5 from Inner Mongolia Autonomous Region, 5 from Gansu Province, 4 from Heilongjiang Province, 3 from Beijing, 3 from Taiwan Province, 2 from Shaanxi Province, 2 from Jiangsu Province, 1 from Tibet Autonomous Region and 1 from Ningxia Hui Autonomous Region. The sources of the remaining materials are unknown.

[0030] Field trial: The natural populations were planted at the Shenfeng Experimental Base of Shanxi Agricultural University (112°60′E, 37°44′N) in 2019, 2020 and 2021. Under normal field management conditions, a randomized complete block design was adopted with three replicates. Each material was planted in four rows, with a row length of 2.0 meters and a row spacing of 0.5 meters. The number of plants per row was controlled at 20. Field management was carried out in accordance with local standard management, including fertilization, irrigation, weeding and pest control.

[0031] Phenotypic identification: Millet was harvested and zinc content was determined at maturity in 2019, 2020 and 2021 with 5 plants per row. Millet was shelled after harvesting, and then the grains were ground into powder in a grinder. Take 0.2g of powdered material and add 6mL nitric acid (HNO3) and 2mL hydrogen peroxide (H2O2), and perform digestion in a microwave digester, set the power to 1300W, and experience 180℃ high temperature and high pressure for 20 minutes. When the digestion solution was acid-dried to 1mL of solution under the condition of 170℃ in the electric heating digester, double deionized water was used to make the volume 10mL. After disposable needle membrane filtration, the zinc content in the digestion solution was determined by inductively coupled plasma mass spectrometry (ICP-MS). To control the inter-sample error, each group of 20 samples included a blank sample and a standard reference sample. To control the intra-sample error, each sample was measured three times, and the average of the three observations was used to represent the zinc content in each sample.

[0032] Genome-wide association analysis: Genotyping and sequencing (GBS) of the natural population was performed using 'Yugu1' as the reference genome. Vcftools v0.1.16 was used to remove SNPs with a missing rate of more than 50% and a minor allele frequency (MAF) of less than 1%, and 27,379 SNPs were retained for GWAS analysis. Plink v1.9 was used for LD filtering with the parameter "--indep-pairwise 50 5 0.2", and 7,793 independent SNPs were retained for the number of effective SNPs. GWAS analysis was performed using a mixed linear model using GEMMA v0.98.3. The first three PCs were added as the S matrix and the kinship matrix as the K matrix in the mixed linear model. To control the false positives of GWAS, materials with zinc content exceeding three standard deviations from the mean were discarded. Based on the Bonferroni correction, the significance threshold was determined to be 1 / 7793=1.28×10 -4 , that is -log 10 (P) = 3.89.

[0033] GWAS detected a total of 27 significant association loci (MTAs) related to zinc content. MTAs with a physical distance of less than 100kb were considered to be a QTL region, with a total of 25 zinc content-related QTLs. Among them, qZn2.1 and qZn4.4 were detected in both environments and were stable QTLs. A total of 29 candidate genes were detected in the two stable QTLs, among which SETIT_006464mg is noteworthy. This gene has a G to A SNP site (4_34732725) in the exon region, and the zinc content of the GG genotype is significantly higher than that of the AA genotype. In addition, SETIT_006464mg is highly expressed in the stems and ears of millet, and is also expressed in the roots, indicating that the gene is involved in the process of zinc absorption from the roots to the transportation and distribution of the aboveground parts. Results can be found in Figure 1 .

[0034] Embodiment 2:

[0035] Development of KASP molecular markers related to zinc content in millet grains:

[0036] According to the characteristics of SNP mutation information, a specific set of KASP primers was designed, consisting of the first upstream primer, the second upstream primer and the downstream primer. The 3' end of the upstream primer set is the allelic variant base C / T, and the sequence of the downstream primer is selected to ensure that the length of the amplification product is 60-120bp. The sequence of the first upstream primer is 5'-GAAGGTGACCAAGTTCATGCTCCTCCACGTCTTCAAGGGCC-3', the sequence of the second upstream primer is 5'-GAAGGTCGGAGTCAACGGATTCCTCCACGTCTTCAAGGGCT-3'; the sequence of the downstream primer is 5'-GATGGGGTAATAGCTCACGA-3'. Among them, the 5' end of the first upstream primer is connected to the FAM fluorescent label sequence "GAAGGTGACCAAGTTCATGCT", and the 5' end of the second upstream primer is connected to the HEX fluorescent label sequence "GAAGGTCGGAGTCAACGGATT".

[0037] All primers used were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0038] Embodiment 3:

[0039] [Application of KASP molecular markers in identification of zinc content-related alleles in millet]:

[0040] Test materials and genomic DNA extraction: 90 millet varieties were used as the test group. Leaf tissues of the millet to be tested were taken and whole genome DNA was extracted using the CTAB method.

[0041] Preparation of KASP molecular marker primer working solution: Take 12 μL (100 μM) of upstream primer and 30 μL (100 μM) of downstream primer, add sterile ultrapure water to 100 μL, and use as KASP molecular marker primer working solution.

[0042] PCR amplification reaction system: contains 5 μL DNA template (20-30 ng / μL), 1 μL primer working solution, 5 μL KASP 1×Master Mix (LGC Biotechnology Company, UK), supplemented to 11 μL with sterile ultrapure water. KASP 1×Master Mix consists of fluorescent probe A, fluorescent probe B, quenching probe A and quenching probe B, as well as high-fidelity Taq enzyme, dNTP, etc.

[0043] Reaction procedure: the first step was pre-denaturation at 94°C for 15 min; the second step was denaturation at 94°C for 20 s, 61-55°C (0.6°C decrease for each cycle) for 60 s, for a total of 10 cycles; the third step was denaturation at 94°C for 20 s, renaturation at 55°C for 60 s, for 26 cycles; and stored at 10°C.

[0044] In the experiment, sterile ultrapure water without adding template DNA into the reaction system was set up as a blank control, and one or more blank controls were set up for each PCR plate.

[0045] KASP molecular marker detection: test results refer to Figure 2 , sterile ultrapure water was used as a blank control, and its typing results were clustered in the lower left corner of the fluorescence signal coordinate system, displayed in black; 36 millet cultivars typing results were clustered in yellow, with the genotype being GG; another 17 millet cultivars typing results were clustered in blue, with the genotype being AA; the genotype of the sample in the middle displayed in green was GA, with 37 samples. In R, the Wilcoxon test was used to evaluate the zinc content of the grains in 90 materials with different genotypes. The results are shown in Figure 3 As shown, the zinc content in the grains of the materials with genotypes GG and GA was significantly (p<0.001) higher than that of the material with genotype AA, indicating that the above-mentioned KASP molecular markers had a high correlation with the zinc content in the grains.

[0046] The millet grain zinc content-related KASP marker of the present invention and application thereof are obtained by mining the millet grain zinc content-related QTL and candidate genes through whole genome association study. The KASP molecular marker of the present invention is accurate and reliable, convenient and fast, improves the selection efficiency, and accelerates the millet zinc-rich variety breeding process.

[0047] Attached primers amplify the full length of the sequence:

[0048] CCTCCACGTCTTCAAGGGC[C / T]GCGCCCGGCGCCGACGCCGAGGCG CCCGCCAGGGCCATCGAGCGCGCGCTGGCCGCCGCGCTCGTGAGCTATT ACCCCATC

[0049] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and the implementation modes, and they can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to the specific details and the illustrations shown and described herein.

Claims

1. A KASP molecular marker related to zinc content in millet grains, characterized in that: Designing primers according to the target SNP site, including at least an upstream primer set and a downstream primer; the upstream primer set includes a first upstream primer and a second upstream primer, and the ends of the first upstream primer and the second upstream primer are respectively set to different allele variant bases based on the target SNP site; The sequence of the first upstream primer is 5'-GAAGGTGACCAAGTTCATGCTCCTCCACGTCTTCAAGGGCC-3', The sequence of the second upstream primer is 5'-GAAGGTCGGAGTCAACGGATTCCTCCACGTCTTCAAGGGCT-3'; The sequence of the downstream primer is 5'-GATGGGGTAATAGCTCACGA-3'; The 5' end of the first upstream primer is connected to the FAM fluorescent tag sequence "GAAGGTGACCAAGTTCATGCT"; The 5' end of the second upstream primer is connected to the HEX fluorescent tag sequence "GAAGGTCGGAGTCAACGGATT".

2. The use of the KASP molecular marker related to zinc content in millet grains according to claim 1 in millet variety breeding, characterized in that: The steps include: The whole genome DNA of millet test materials is extracted, and the DNA is used as a template, and the KASP molecular marker is used for PCR amplification, and the obtained amplification products are scanned for fluorescence signals, and different genotypes are distinguished according to the fluorescence signals, and the zinc content of millet grains corresponding to different genotypes is obtained according to the phenotypes of the test materials; the zinc content of the grains in the materials with genotypes GG and GA is significantly higher than that in the materials with genotypes AA; The whole genome DNA of the millet variety or strain to be tested is extracted and used as a template. The KASP molecular marker is used for PCR amplification. The obtained amplification product is scanned for fluorescence signals, and millet varieties with a genotype with a higher grain zinc content are selected according to the fluorescence signals.

Images