Application of MexL protein in regulating toxicity of pseudomonas aeruginosa

Abstract

The invention discloses application of MexL protein in regulating toxicity of pseudomonas aeruginosa, and belongs to the technical field of biology. The technical problem to be solved by the invention is how to reduce the toxicity of pseudomonas aeruginosa and enhance the sensitivity of pseudomonas aeruginosa to antibiotics. In order to solve the technical problem, the invention provides the application of the MexL protein in regulating and controlling the toxicity of the pseudomonas aeruginosa. The invention also provides a method for regulating and controlling the toxicity of the pseudomonas aeruginosa and / or regulating and controlling the sensitivity of the pseudomonas aeruginosa to a drug, and the method comprises the step of regulating and controlling the toxicity of the pseudomonas aeruginosa or / and regulating and controlling the sensitivity of the pseudomonas aeruginosa to the drug by regulating and controlling the expression of the MexL protein in the pseudomonas aeruginosa or regulating and controlling the content of the MexL protein. The invention discloses the effect of MexL protein in regulating and controlling the toxicity of the pseudomonas aeruginosa or / and the sensitivity of the pseudomonas aeruginosa to drugs for the first time. The method provided by the invention can effectively reduce the toxicity of the pseudomonas aeruginosa and enhance the sensitivity of the pseudomonas aeruginosa to antibiotics.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to application of MexL protein in regulating the toxicity of Pseudomonas aeruginosa. Background Art

[0002] Pseudomonas aeruginosa is a Gram-negative conditional pathogen that is widely present in the natural environment. The bacterium can cause infection in humans or animals. It is very easy to infect patients with low immunity and patients with burns and scalds, causing serious infections and leading to a high mortality rate. The bacterium has strong environmental adaptability and is very easy to form biofilms. It is one of the common drug-resistant bacteria in clinical practice and a common pathogen of hospital-acquired infections.

[0003] The quorum sensing (QS) regulatory system is a way for microorganisms to regulate gene expression by sensing population density. It is of great significance in regulating the virulence, motility, antibiotic tolerance and biofilm formation of Pseudomonas aeruginosa. Developing and utilizing small molecule compounds to interfere with bacterial quorum sensing to reduce bacterial virulence, rather than directly killing bacteria, is a new strategy for controlling bacterial infections. Pseudomonas aeruginosa MexL protein is a transcription factor of the TetR family that negatively regulates the expression of the drug efflux pump MexJK-OprM. Summary of the invention

[0004] The technical problem to be solved by the present invention is: how to reduce the infection of Pseudomonas aeruginosa and / or enhance the sensitivity of Pseudomonas aeruginosa to antibiotics.

[0005] To solve the above technical problems, in a first aspect, the present invention provides the use of a protein or a substance that regulates the content of the protein or a substance that regulates the activity of the protein or a substance that regulates gene expression in any of the following items, wherein the gene encodes the protein, and the protein may be a MexL protein;

[0006] A1) Application in regulating the toxicity of Pseudomonas aeruginosa;

[0007] A2) Application in the preparation of products for regulating the toxicity of Pseudomonas aeruginosa;

[0008] A3) Application in regulating the sensitivity of Pseudomonas aeruginosa to drugs;

[0009] A4) Application in the preparation of products for regulating the sensitivity of Pseudomonas aeruginosa to drugs;

[0010] A5) Application in regulating the production of pyocyanin from Pseudomonas aeruginosa;

[0011] A6) Application in the preparation of products for regulating the production of pyocyanin in Pseudomonas aeruginosa;

[0012] A7) Application in the research and development or preparation of drugs against Pseudomonas aeruginosa infection;

[0013] A8) Application in microbial breeding or microbial assisted breeding;

[0014] The MexL protein may be a wild-type MexL protein or a mutant MexL protein, and the wild-type MexL protein is any one of the following proteins a1)-a3):

[0015] a1) The amino acid sequence is the protein shown in Sequence 1 in the sequence list;

[0016] a2), a protein related to the toxicity of Pseudomonas aeruginosa obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in a1), which has more than 80% identity with the amino acid sequence shown in a1);

[0017] a3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of a1) or a2).

[0018] The regulation of the protein activity may be regulation of the activity of the MexL protein binding to the promoter of the gene regulated by the MexL protein.

[0019] Furthermore, in the above-mentioned applications, the substance regulating the protein content or the substance regulating the protein activity or the substance regulating gene expression may be a substance that inhibits, reduces or down-regulates gene expression or a substance that inhibits, reduces or down-regulates the protein content or activity or the gene expression. The regulation of Pseudomonas aeruginosa toxicity may be to inhibit, reduce or down-regulate the toxicity of Pseudomonas aeruginosa. The regulation of the sensitivity of Pseudomonas aeruginosa to drugs may be to promote, increase or up-regulate the sensitivity to drugs. The regulation of the production of pyocyanin in Pseudomonas aeruginosa may be to inhibit, reduce or down-regulate the production of pyocyanin.

[0020] Furthermore, in the above application, the mutant MexL protein may be MexL A47D Protein, the MexL A47D The protein may be a protein whose amino acid sequence is sequence 3 in the sequence list.

[0021] MexL A47D The protein is a protein whose amino acid sequence is the protein shown in sequence 1 in the sequence list through A47D mutation, that is, the 47th alanine of the protein shown in sequence 1 in the sequence list is mutated to aspartic acid.

[0022] Furthermore, in the above application, the protein may be derived from Pseudomonas aeruginosa.

[0023] Among them, SEQ ID No.1 and SEQ ID No.3 are composed of 212 amino acid residues respectively.

[0024] The above proteins can be artificially synthesized, or their encoding genes can be synthesized first and then expressed biologically.

[0025] The protein tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The protein tag can be a Flag protein tag, a His protein tag, an MBP protein tag, an HA protein tag, a myc protein tag, a GST protein tag and / or a SUMO protein tag, etc.

[0026] Furthermore, in the above application, the drug may be a drug or / and a drug composition targeting MexL protein.

[0027] Furthermore, in the above application, the drug may be an antibiotic or / and an antibiotic combination targeting the MexL protein.

[0028] Furthermore, in the above application, the drug may be ciprofloxacin, pyocyanin or tetracycline or / and a combination of any two or three thereof.

[0029] The product may be a reagent or a kit.

[0030] The product contains the protein or the substance regulating gene expression or the substance regulating the protein content.

[0031] Furthermore, in the above application, the substance that regulates the protein content or the substance that regulates gene expression is a biological material, and the biological material is any one of the following:

[0032] B1), nucleic acid molecule encoding wild-type MexL protein;

[0033] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0034] B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0035] B4), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);

[0036] B5), coding MexL A47D Nucleic acid molecules of proteins;

[0037] B6), an expression cassette containing the nucleic acid molecule described in B5);

[0038] B7), a recombinant vector containing the nucleic acid molecule described in B5), or a recombinant vector containing the expression cassette described in B6);

[0039] B8), a recombinant microorganism containing the nucleic acid molecule described in B5), or a recombinant microorganism containing the expression cassette described in B6), or a recombinant microorganism containing the recombinant vector described in B7);

[0040] The substance that regulates the activity of the protein is selected from tetracycline, triclosan, erythromycin and / or pyocyanin.

[0041] Furthermore, in the above application, the nucleic acid molecule described in B1) may be a DNA molecule described in any of the following:

[0042] g1), the coding sequence of the coding strand is the DNA molecule of sequence 2 in the sequence list;

[0043] g2), a DNA molecule that has more than 80% identity with the DNA molecule described in g1) and is associated with the toxicity of Pseudomonas aeruginosa.

[0044] Furthermore, in the above application, the nucleic acid molecule described in B5) may be a DNA molecule described in any of the following:

[0045] g3), the coding sequence of the coding strand is the DNA molecule of sequence 4 in the sequence list;

[0046] g4), a DNA molecule that has more than 80% identity with the DNA molecule described in g3), and is associated with the toxicity of Pseudomonas aeruginosa.

[0047] In the present invention, identity refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST 2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and searching for the identity of a pair of amino acid sequences for calculation, the value of identity (%) can be obtained.

[0048] In the present invention, the above 80% identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0049] In a second aspect, the present invention provides a method for regulating the toxicity of Pseudomonas aeruginosa and / or regulating the sensitivity of Pseudomonas aeruginosa to drugs, the method comprising regulating the toxicity of Pseudomonas aeruginosa and / or regulating the sensitivity of Pseudomonas aeruginosa to drugs by regulating the expression of the MexL protein in Pseudomonas aeruginosa or regulating the content or activity of the MexL protein.

[0050] Furthermore, in the above method, the regulation of the expression of the MexL protein in Pseudomonas aeruginosa or the regulation of the content of the MexL protein may be M1) or M2):

[0051] M1), inhibiting or reducing the expression of the wild-type MexL protein encoding gene in the recipient Pseudomonas aeruginosa or inhibiting or reducing the content of the wild-type MexL protein in the recipient Pseudomonas aeruginosa, to obtain the target Pseudomonas aeruginosa having lower toxicity than the recipient Pseudomonas aeruginosa or / and higher drug sensitivity than the recipient Pseudomonas aeruginosa;

[0052] M2), the wild-type MexL protein in the recipient Pseudomonas aeruginosa was mutated to A47D;

[0053] The regulating the activity of the MexL protein in Pseudomonas aeruginosa may be inhibiting, reducing or down-regulating the activity of the MexL protein in Pseudomonas aeruginosa.

[0054] Furthermore, in the above method, the activity of the MexL protein may be the activity of the MexL protein binding to the promoter of the gene regulated by the MexL protein.

[0055] In a third aspect, the present invention provides a method for preparing Pseudomonas aeruginosa with reduced toxicity and / or increased drug sensitivity, the method comprising M1) or M2):

[0056] M1), inhibiting or reducing the expression of the wild-type MexL protein encoding gene in the recipient Pseudomonas aeruginosa or inhibiting or reducing the content of the wild-type MexL protein in the recipient Pseudomonas aeruginosa, to obtain the target Pseudomonas aeruginosa with lower toxicity than the recipient Pseudomonas aeruginosa and / or higher drug sensitivity than the recipient Pseudomonas aeruginosa;

[0057] M2) The wild-type MexL protein in the recipient Pseudomonas aeruginosa was mutated to A47D.

[0058] Furthermore, in the above method, the drug may be a drug or / and a drug composition targeting MexL.

[0059] Furthermore, in the above method, the drug may be an antibiotic or / and an antibiotic combination targeting MexL.

[0060] Furthermore, in the above method, the drug contains a substance that inhibits, reduces or down-regulates the expression of the MexL protein gene, or a substance that inhibits, reduces or down-regulates the content of the MexL protein.

[0061] Furthermore, in the above method, the drug may also include ciprofloxacin or tetracycline.

[0062] In a fourth aspect, the present invention provides the recombinant Pseudomonas aeruginosa prepared by the above method.

[0063] In a fifth aspect, the present invention provides an application, wherein the application is any one of the following:

[0064] P1) Use of a substance that inhibits the activity of the above-mentioned MexL protein in the development or preparation of a drug for resisting Pseudomonas aeruginosa infection.

[0065] P2) Use of the above-mentioned recombinant Pseudomonas aeruginosa in screening drugs for preventing and / or treating Pseudomonas aeruginosa infection;

[0066] P3) Application of the above-mentioned recombinant Pseudomonas aeruginosa in the study of the mechanism of MexL protein and toxicity or drug sensitivity of Pseudomonas aeruginosa.

[0067] Furthermore, in the above application, the medicine in P1) contains antibiotics and substances that inhibit the activity of the above MexL protein, including but not limited to tetracycline, triclosan, erythromycin and / or pyocyanin.

[0068] In a sixth aspect, the present invention provides a drug for preventing infection by Pseudomonas aeruginosa, wherein the drug contains an antibiotic and a substance that inhibits the activity of the above-mentioned MexL protein.

[0069] Furthermore, in the medicine, the substances include but are not limited to tetracycline, triclosan, erythromycin and / or pyocyanin.

[0070] Furthermore, in the drug, the activity of the MexL protein may be the activity of the MexL protein binding to the promoter of the gene regulated by the MexL protein.

[0071] Furthermore, in the drug, the genes regulated by the MexL protein include but are not limited to mexJ (Genebank: AAG07065.1), phz1 gene cluster, phz2 gene cluster and / or phzM (Genebank: AAG07596.1). The phz1 gene cluster includes phzA1 (AAG07597.1), phzB1 (AAG07598.1), phzC1 (AAG07599.1), phzD1 (AAG07600.1), phzE1 (AAG07601.1), phzF1 (AAG07602.1) and phzG1 (AAG07604.1); the phz2 gene cluster includes phzA2 (AAG05288.1), phzB2 (AAG05289.1), phzC2 (AAG05290.1), phzD2 (AAG05291.1), phzE2 (AAG05292.1), phzF2 (AAG05293.1) and phzG2.

[0072] The promoter of the mexJ gene is a DNA molecule whose nucleotide sequence is shown in SEQ ID No.5, the promoter of the phz1 gene cluster is a DNA molecule whose nucleotide sequence is shown in SEQ ID No.6, the promoter of the phz2 gene cluster is a DNA molecule whose nucleotide sequence is shown in SEQ ID No.7, and the promoter of the phzM gene is a DNA molecule whose nucleotide sequence is shown in SEQ ID No.9.

[0073] In a seventh aspect, the present invention provides the protein in the above application and / or the biomaterial in the above application.

[0074] In the present invention, the toxicity of Pseudomonas aeruginosa mainly refers to the virulence factors secreted by Pseudomonas aeruginosa, such as pyocyanin, hydrocyanic acid, rhamnolipid, lectin, elastase, etc. Pyocyanin is a type of secondary metabolite produced by Pseudomonas aeruginosa, an important virulence factor, and plays an important role in Pseudomonas aeruginosa infecting the host.

[0075] In the present invention, the substance that regulates gene expression may be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcription level of the gene; 2) regulation after transcription of the gene (that is, regulation of the splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (that is, regulation of the transport of the mRNA of the gene from the nucleus to the cytoplasm); 4) regulation of the translation of the gene; 5) regulation of the degradation of the mRNA of the gene; 6) regulation of the gene after translation (that is, regulation of the activity of the protein translated by the gene).

[0076] The beneficial technical effects achieved by the present invention are as follows:

[0077] 1) Our research group found that the loss of MexL significantly reduced the production of phenazines in Pseudomonas aeruginosa and many virulence factors regulated by the quorum sensing system. In addition, the MexL-deficient mutant of Pseudomonas aeruginosa is more sensitive to some antibiotics. This patent provides a strategy or method for treating Pseudomonas aeruginosa infection using MexL protein as a potential drug target.

[0078] 2) Experiments have shown that the deletion of MexL in Pseudomonas aeruginosa significantly reduces the production of pyocyanin and many virulence factors regulated by the quorum sensing system. In addition, the MexL deletion mutant of Pseudomonas aeruginosa is more sensitive to some antibiotics.

[0079] 3) MexL, as a transcription factor, mainly functions by binding to the promoter region of the regulated gene to enhance or weaken the gene expression level. Experiments have shown that tetracycline, erythromycin, triclosan and pyocyanin can all affect the ability of MexL to bind to the promoter of the regulated gene, which will upregulate the expression of MexJK-OprM and downregulate the expression of the quorum sensing system and virulence factors of Pseudomonas aeruginosa. Therefore, antibiotics (pyogenes, tetracycline, erythromycin, triclosan and / or ciprofloxacin) that can affect the ability of MexL to bind to the promoter of the regulated gene and substances with MexL protein as drug targets (substances that inhibit, reduce or downregulate the expression of the MexL protein gene and substances that inhibit, reduce or downregulate the content of the MexL protein) are combined for drug therapy, which targets the MexL protein, thereby reducing bacterial virulence and treating Pseudomonas aeruginosa infection.

[0080] 4) Using MexL protein as a drug target can be used to develop or prepare drugs for preventing and / or treating Pseudomonas aeruginosa infection. Substances that inhibit, reduce or downregulate the expression of the MexL protein gene and substances that inhibit, reduce or downregulate the content of the MexL protein can be used in combination with antibiotics to prepare drugs for preventing and / or treating Pseudomonas aeruginosa infection. The inhibition, reduction or downregulation of the activity of the MexL protein can be to reduce the ability of MexL to bind to the promoter of the regulated gene.

[0081] 5) The combined use of pyocyanin, tetracycline, erythromycin, triclosan and ciprofloxacin or the development of small molecule inhibitors of MexL to form a combination drug can reduce bacterial virulence by targeting the MexL protein, thereby reducing the inflammatory response and treating Pseudomonas aeruginosa infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0082] Figure 1It is the phenazine synthesis pathway and the expression of genes related to phenazine synthesis in the MexL-deficient bacteria ΔmexL. Figure 1 A in the middle is the phenazine synthesis pathway in Pseudomonas aeruginosa; Figure 1 Middle B shows the expression of genes related to phenazine synthesis in the ΔmexL transcriptome data. Figure 1 The “-” in the figure represents down-regulated expression relative to the wild-type strain PAO1.

[0083] Figure 2 The results of detecting the relative expression levels of phenazine-related genes in wild-type PAO1 and mexL deletion strain ΔmexL. Figure 2 Figures AE are the results of using GFP promoter fluorescent reporter plasmid to measure the promoter activities of the phz1 gene cluster (A), phz2 gene cluster (B), phzM gene (C), phzH gene (D) and phzS gene (E) in the wild type and mexL deletion strain ΔmexL. Figure 2 Figure F shows the transcription levels of phzA1, phzM and phzA2 genes in PAO1 wild type (PAO1 / pUCP20), mexL deletion strain (ΔmexL / pUCP20) and complemented strain (ΔmexL / pUCPmexL) detected by RT-qPCR.

[0084] Figure 3 The results of measuring phenazine production in PAO1 and ΔmexL are shown in Figure 2 . Figure 3 A in the middle is the determination of pyocyanin (PYO) content in the culture supernatant of the wild-type, deletion strain and complemented strain by chloroform extraction method; Figure 3 Figure B shows the LC-MS / MS determination of phenazine-1-carboxylic acid (PCA) and pyocyanin (PYO) in the culture supernatant of the wild-type, deletion strain and complemented strain.

[0085] Figure 4 This is a verification result that alanine at position 47 of MexL plays an important role in regulating the synthesis of pyocyanin. Figure 4 A in the figure is RT-qPCR measurement of the transcription levels of phenazine synthesis-related genes in wild-type, deletion-type, complemented-type and point mutation-complemented strains. Figure 4 Figure B shows the chloroform extraction method for determining the pyocyanin (PYO) content in the supernatant of the wild type, deletion strain, complemented strain and point mutation complemented strain.

[0086] Figure 5 The expression of genes related to quorum sensing system and virulence factors in the transcriptome data of ΔmexL. “-” represents down-regulated expression.

[0087] Figure 6The results of RT-qPCR detection of the relative expression levels of quorum sensing and virulence-related genes in PAO1, ΔmexL and complemented strains. Figure 6 A in the figure shows the RT-qPCR detection of PAO1 and ΔmexL and the complemented strains in the logarithmic phase (OD 600 =0.8) relative expression levels of genes related to the las system and the rhl system; Figure 6 B is RT-qPCR detection of PAO1 and ΔmexL and the early stable phase of complementation strains (OD 600 =2.5) relative expression levels of genes related to the las system and the rhl system; Figure 6 Middle C is RT-qPCR detection of PAO1 and ΔmexL and the early stable phase of complementation strains (OD 600 =2.5) relative expression levels of genes related to the pqs system; Figure 6 D in the figure is the RT-qPCR detection of PAO1 and ΔmexL and the early stable phase of the complemented strain (OD 600 =2.5) Relative expression levels of virulence genes regulated by the quorum sensing system.

[0088] Figure 7 Toxicity test of PAO1, ΔmexL and complemented strains. Figure 7 A in the figure shows flow cytometry detection of PAO1, ΔmexL and complemented strains infecting human lung adenocarcinoma cell A549, with the apoptosis rate of A549 cells being used as a marker of bacterial toxicity. Figure 7 Figure B shows the inhibitory effects of the extracts from the fermentation supernatant of PAO1, ΔmexL and complemented strains on Staphylococcus aureus. The numbers in the figure represent the diameter of the inhibition circle.

[0089] Figure 8 The expression of MexEF-OprN efflux pump genes in the ΔmexL transcriptome data. “-” represents down-regulated expression.

[0090] Fig. 9 The expression of the MexEF-OprN efflux pump was downregulated in response to MexL deletion. Fig. 9 A in the figure shows the transcription levels of mexT and mexE detected by RT-qPCR in the wild type, deletion strain and complemented strain. Fig. 9 B in the figure shows the sensitivity of PAO1, ΔmexL and ΔmexEF to ciprofloxacin.

[0091] Fig.10 Comparison of transcriptome data of mexL deletion strain (ΔmexL) and mexS deletion strain (ΔmexS). Fig.10 A in the middle is a volcano plot of differentially expressed genes comparing the mexL deletion strain (ΔmexL) and the wild-type PAO1. Fig.10Middle B is a volcano plot of differentially expressed genes comparing the mexS deletion strain (ΔmexS) and the wild-type PAO1.

[0092] Fig.11 EMSA was used to detect the effects of tetracycline, triclosan, erythromycin and pyocyanin on the binding of MexL to the mexJ promoter. Fig.11 A in the middle is the test result when tetracycline is added into the system; Fig.11 B in the figure is the test result when triclosan is added into the system; Fig.11 C in the middle is the test result when erythromycin is added into the system; Fig.11 D in the middle is the test result when pyocyanin is added into the system;

[0093] Fig.12 RT-qPCR was used to detect the transcription level of mexJ in wild-type PAO1 in the presence of tetracycline, triclosan, erythromycin and pyocyanin. In the figure, wild-type represents no addition of PAO1; wild-type + tetracycline represents PAO1 added with a final concentration of 100 μg / mL tetracycline (corresponding to a molar concentration of 208 μM); wild-type + triclosan represents PAO1 added with a final concentration of 1.5 mg / mL triclosan (corresponding to a molar concentration of 5.18 mM); wild-type + erythromycin represents PAO1 added with a final concentration of 1.5 mg / mL erythromycin (corresponding to a molar concentration of 2 mM); wild-type + pyocyanin represents PAO1 added with a final concentration of 500 μM pyocyanin.

[0094] Fig.13 The effect of different concentrations of erythromycin, tetracycline and triclosan on the pyocyanin production of PAO1. DETAILED DESCRIPTION

[0095] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0096] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0097] Pseudomonas aeruginosa PAO1, Escherichia coli S17-1λpir, pUCP20, and GFP fusion reporter plasmid pROBE-AT' were all stored in our laboratory and were used in the paper "Wei Q, Leclercq S, Bhasme P, Xu A, Zhu B, Zhang Y, Zhang M, Wang S, Ma LZ. Diguanylate Cyclases and Phosphodiesterases Required for Basal-Level c-di-GMP in Pseudomonas aeruginosa as Revealed by SystematicPhylogenetic and Transcriptomic Analyses. Appl Environ Microbiol. 2019Oct 16;85(21):e01194-19." pEX18Gm is also kept in this laboratory and is disclosed in the paper "Construction and phenotypic analysis of Fur-induced expression mutants of Pseudomonas aeruginosa iron uptake regulator. Chinese Journal of Biotechnology, 2021, 37(9):3253-3267." The public may obtain the biological material from the applicant in accordance with the relevant national biosafety regulations. The above-mentioned biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0098] Phenazine-1-carboxylic acid (PCA) standard was purchased from Shanghai Yuanye Biotechnology Co., Ltd., catalog number: S66397.

[0099] Pyocyanin (PYO) standard was purchased from Cayman Company, USA, with the catalog number: 10009594.

[0100] Human lung adenocarcinoma cell A549 was kindly donated by Fang Min's research group at the Key Laboratory of Pathogenic Microbiology and Immunology, Institute of Microbiology, Chinese Academy of Sciences, and was disclosed in the document "Zhu L, Zhao W, Lu J, Li S, Zhou K, Jiang W, Duan X, Fu L, Yu B, Cai KQ, Gao GF, Liu W, Fang M. Influenza virus matrix protein M1 interacts with SLD5 to block host cell cycle. Cell Microbiol. 2019Aug; 21(8): e13038." The public may obtain the biological material from the applicant in accordance with relevant national biosafety regulations. The obtained biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0101] The composition of DMEM-10% FBS is: 10% FBS (v / v), and the rest is DMEM medium.

[0102] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent companies unless otherwise specified. The quantitative tests in the following examples are repeated three times, and the results are averaged.

[0103] The following examples were processed using SPSS11.5 statistical software, and the experimental results were expressed as mean ± standard deviation. One-way ANOVA test was used, * indicates a significant difference (P < 0.05), ** indicates a very significant difference (P < 0.01), *** indicates a very significant difference (P < 0.001), and ns indicates no significant difference.

[0104] Table 1: Primer sequences of target genes and reference genes involved in RT-qPCR

[0105]

[0106]

[0107] Example 1. Method for strain construction

[0108] This example provides a MexL deletion strain (ΔmexL / pUCP20), a complementation strain (ΔmexL / pUCPmexL), and a MexL protein alanine 47 mutant strain (ΔmexL / pUCPmexL A47D ), mexEF knockout strain (ΔmexEF) and mexS knockout strain (ΔmexS).

[0109] The construction of target gene deletion mutation mainly adopts the method of scarless knockout, that is, a large fragment is deleted within the gene, and the number of bases knocked out is a multiple of 3, so it will not affect the transcription of its upstream and downstream genes.

[0110] 1.1. Construction of the MexL deletion strain ΔmexL

[0111] Using PAO1 genomic DNA as template ( www.pseudomonas.com ), using mexL-up-Fw / mexL-up-R and mexL-down-Fw / mexL-down-Rv as primers, respectively amplified 500 bp fragments of the upstream and downstream of the mexL gene, wherein there were homology arms between the upstream and downstream fragments and the plasmid, and cloned into the pEX18Gm plasmid by the Gibson one-step ligation method (ligation reagent was II One Step Cloning Kit, purchased from Nanjing Novogene Biotech Co., Ltd., catalog number: C112-02), to obtain the knockout plasmid pEX18Gm-mexL. The structure of the knockout plasmid pEX18Gm-mexL is as follows: the 500bp fragments upstream and downstream of the mexL gene are connected by the middle homology arm, and the small fragment between the EcoRI and HindIII restriction recognition sites of the pEX18Gm plasmid is replaced, and the other nucleotide sequences of the pEX18Gm plasmid are kept unchanged to obtain the recombinant expression vector. Secondly, the knockout plasmid was transformed into Escherichia coli S17-1λpir; the OD of the overnight cultured S17 / pEX18Gm-mexL was compared with that of the PAO1 bacterial solution cultured overnight. 600 Adjust to 0.8, take 100μL S17 / pEX18Gm-mexL and 200μL PAO1 bacterial solution and mix them, take 15μL mixed bacterial solution and drop it on LB solid plate, wait for the bacterial solution to air dry, transfer it to 37℃ incubator for overnight culture. Then, streak the bacterial mud on LB double-antibody plate (final concentration Irgasan 25μg / mL, purchased from Sigma, catalog number: 72779; Gentamycin 20μg / mL, purchased from Sigma, catalog number: G100391), and culture at 37℃ until a single colony grows. Finally, a single colony was picked and streaked on an LB solid plate containing 20% ​​sucrose (Sucrose, purchased from Sigma, catalog number: V900116) to obtain a single colony; a single colony was picked and streaked on an LB solid plate and an LB solid plate containing Gentamycin with a final concentration of 10 μg / mL at the same time, and the colony that only grew on the antibiotic-free LB plate but not on the Gentamycin plate was selected for the next PCR verification, and finally the MexL deletion strain ΔmexL was screened.

[0112] The MexL deletion strain ΔmexL cannot express the MexL protein whose amino acid sequence is sequence 1 in the sequence list.

[0113] The nucleotide sequence of the primer sequence is as follows:

[0114] mexL-up-Fw(5'-3'):CAGCTATGACCATGATTACGAATTCTCGAGCAAGGTGCGGTAG;

[0115] mexL-up-Rv(5'-3'):CACGTGCCGCTCGCCTTCTTCTGACATGCGCTTATACAATTGA;

[0116] mexL-down-Fw(5'-3'): TCAATTGTATAAGCGCATGTCAGAAGAAGGCGAGCGGCACGTG;

[0117] mexL-down-Rv(5'-3'): ACGACGGCCAGTGCCAAGCTTTCGCCGACCTGCGCGATT.

[0118] 1.2. Construction of complement strain ΔmexL / pUCPmexL and control strain ΔmexL / pUCP20

[0119] First, PAO1 genomic DNA was used as a template, and the mexL gene coding region was amplified using primers mexL-pUCP20-F / mexL-pUCP20-R, and cloned into the pUCP20 vector to obtain the recombinant plasmid pUCP-mexL. The structure of the recombinant plasmid pUCP-mexL is: a small fragment between the EcoRI and HindIII restriction sites of the pUCP20 vector was replaced with a DNA molecule whose nucleotide sequence is sequence 2 in the sequence list, and the other nucleotide sequences of the pUCP20 vector were kept unchanged to obtain a recombinant expression vector. The recombinant plasmid pUCP-mexL can express the MexL protein whose amino acid sequence is sequence 1 in the sequence list.

[0120] Then the recombinant plasmid pUCP-mexL was transferred into the MexL-deficient strain ΔmexL to obtain the complemented strain ΔmexL / pUCPmexL. The complemented strain ΔmexL / pUCPmexL can express the MexL protein whose amino acid sequence is sequence 1 in the sequence table.

[0121] The pUCP20 empty vector was transferred into the wild-type strain PAO1 and the MexL deletion strain ΔmexL, respectively, to obtain the control strains ΔmexL / pUCP20 and PAO1 / pUCP20. The control strain ΔmexL / pUCP20 did not express the MexL protein whose amino acid sequence was sequence 1 in the sequence list. The control strain PAO1 / pUCP20 could express the MexL protein whose amino acid sequence was sequence 1 in the sequence list.

[0122] The nucleotide sequence of the primer sequence is as follows:

[0123] mexL-pUCP20-F(5'-3'):CATGATTACGAATTCATGTCAGAATCCACCTCCTCC;

[0124] mexL-pUCP20-R(5'-3'):GCCAGTGCCAAGCTTTCAGCCGCCCGCGGCGAAGGC.

[0125] 1.3. Alanine 47 mutant strain of MexL protein (ΔmexL / pUCPmexL A47D )

[0126] First, the recombinant plasmid pUCP-mexL was used as a template, and the primers MexL(A47D)-Fw and MexL(A47D)-Rv were used to amplify the entire plasmid. Then, the PCR product was treated with endonuclease DpnI and matching buffer (NEB, product number R0176V) at 37°C for 2 h. Finally, the treated product was transformed into Escherichia coli DH5α, and the point mutation plasmid pUCP-mexL was obtained by PCR identification and sequencing. A47D , point mutation plasmid pUCP-mexL A47D The structure of the recombinant expression vector is: the DNA molecule whose nucleotide sequence is sequence 4 in the sequence list replaces the small fragment between the EcoRI and HindIII restriction enzyme recognition sites of the pUCP20 vector, while keeping the other nucleotide sequences of the pUCP20 vector unchanged. Point mutation plasmid pUCP-mexL A47D The expressible amino acid sequence is MexL of sequence 3 in the sequence list A47D protein.

[0127] pUCP-mexL A47D Transformed into the MexL deletion strain ΔmexL to obtain the mutant strain ΔmexL / pUCPmexL A47D Mutant strain ΔmexL / pUCPmexL A47D The expressible amino acid sequence is MexL of sequence 3 in the sequence list A47D protein.

[0128] The nucleotide sequence of the primer sequence is as follows:

[0129] MexL(A47D)-Fw(5'-3'):CATCGCCTCGGAA GAC GGCGTTTCCAAGC;

[0130] MexL(A47D)-Rv(5'-3'):GCTTGGAAACGCC GTC TTCCGAGGCGATG.

[0131] 1.4. Construction of the mexEF knockout strain ΔmexEF

[0132] The construction method refers to the mexL gene deletion mutant strain ΔmexL, the only difference is the primers used. Primers mexEF-up-Fw and mexEF-up-Rv were used to amplify the upstream fragment of the mexEF gene, and primers mexEF-down-Fw and mexEF-down-Rv were used to amplify the downstream fragment of the mexEF gene.

[0133] The nucleotide sequence of the primer sequence is as follows:

[0134] mexEF-up-Fw(5'-3'):CAGCTATGACCATGATTACGAATTCAGTTCAACGGCCTCGGCA; mexEF-up-Rv(5'-3'):GCGGATGAGGACGTAGAACTGTTCCATGCTTGACTCCGCCAGT; mexEF-down-Fw(5'-3'):ACTGGCGGAGTCAAGCATGGAACAGTTCTACGTCCTCATCCGC;

[0135] mexEF-down-Rv(5'-3'):ACGACGGCCAGTGCCAAGCTTTATCCAGGCCAAGGTCGTA.

[0136] 1.5. Construction of the mexS knockout strain ΔmexS

[0137] The construction method refers to the mexL gene deletion mutant strain ΔmexL, and the only difference is the primers used. Primers mexS-up-Fw and mexS-up-Rv are used to amplify the upstream fragment of the mexS gene, and primers mexS-down-Fw and mexS-down-Rv are used to amplify the downstream fragment of the mexS gene.

[0138] The nucleotide sequence of the primer sequence is as follows (5'-3'):

[0139] mexS-up-Fw:CAGCTATGACCATGATTACGAATTCACAGGTGGGCGAAGATTTCCTGGG; mexS-up-Rv:ACCACCGGCTTGAGCAGGCGATCTCGGGACATCGCAAACCTCTGCAGTGCAT ; mexS-down-Fw:ATGCACTGCAGAGGTTTGCGATGTCCCGAGATCGCCTGCTCAAGCCGGTGGT; mexS-down-Rv:ACGACGGCCAGTGCCAAGCTTCTGGTGAAGATCGAAGGCGACTT.

[0140] Example 2: MexL-deficient strain significantly reduces the production of phenazines by Pseudomonas aeruginosa

[0141] Phenazines are a class of secondary metabolites produced by Pseudomonas aeruginosa, mainly including phenazine-1 carboxylic acid and pyocyanin. Phenazines are important virulence factors and play an important role in the infection of Pseudomonas aeruginosa to the host. Figure 1 As shown in A, the phenazine biosynthesis process uses chorismate produced in the shikimic acid metabolic pathway as a substrate, and synthesizes the phenazine precursor substance phenazine-1-carboxylic acid (PCA) under the catalysis of two relatively independent phenazine biosynthesis gene clusters, namely phzA1-G1 (abbreviated as phz1) and phzA2-G2 (abbreviated as phz2). PCA is catalyzed by PhzM and PhzS to synthesize pyocyanin (PYO). A mexL gene deletion strain was constructed in Pseudomonas aeruginosa PAO1, and the expression of phenazine biosynthesis-related genes in the PAO1 wild type (PAO1) and the mexL deletion strain (ΔmexL) was determined by transcriptome sequencing analysis and promoter GFP reporter plasmid. The relative expression levels of phenazine biosynthesis-related genes in PAO1 wild type (PAO1 / pUCP20), mexL deletion strain (ΔmexL / pUCP20) and complemented strain (ΔmexL / pUCPmexL) were determined by RT-qPCR. The production of phenazine 1-carboxylic acid and pyocyanin in PAO1 wild type (PAO1 / pUCP20), mexL deletion strain (ΔmexL / pUCP20) and complemented strain (ΔmexL / pUCPmexL) was determined by LC-MS / MS.

[0142] 2.1. Transcriptome sequencing analysis and RT-qPCR detection of the expression of genes related to phenazine synthesis

[0143] 2.1.1 Transcriptome Sequencing

[0144] The method of transcriptome sequencing is as follows:

[0145] (1) RNA extraction

[0146] PAO1 wild type (PAO1) and mexL deletion strain (ΔmexL) were extracted at the stationary growth phase (OD 600 =2.5) RNA samples;

[0147] (2) Library construction

[0148] RNA samples were subjected to concentration determination, quality inspection, mRNA enrichment, reverse transcription, end repair, 3' A addition, adapter ligation, PCR enrichment, and library quality control;

[0149] (3) Transcriptome sequencing and data analysis

[0150] After the library inspection was qualified, different libraries were pooled according to the target data volume and sequenced using the Illumina HiSeq platform. The reads after sample filtering were located on the P. aeruginosa reference sequence using Tophat, and then the gene expression levels were standardized using RESM and NOIseq, and the expression of differentially expressed genes between different samples was compared and statistically analyzed.

[0151] 2.1.2. Determination of transcription levels of phenazine biosynthesis-related genes in wild-type PAO1 (PAO1) and mexL deletion strain (ΔmexL) by promoter GFP reporter plasmid method

[0152] The promoter activity of related genes is measured by promoter GFP fusion reporter plasmid, and the activity of the promoter is judged according to the strength of GFP signal, thereby reflecting the changes in the transcription level of the gene. The specific method is as follows:

[0153] (1) Using PAO1 genome as reaction template, PCR primers were used to amplify the first 500 bp of ATG in the coding region of phzA1, phzA2, phzM, phzH and phzS genes by PCR reaction as promoter sequence. The promoter sequence was cloned into GFP fusion reporter plasmid pROBE-AT' to obtain recombinant plasmids pROBE-phz1, pROBE-phz2, pROBE-phzM, pROBE-phzH and pROBE-phzS, respectively. The recombinant plasmids were transformed into the PAO1 wild type (PAO1) and mexL knockout strain (ΔmexL), respectively, to obtain the following strains PAO1 / phz1::gfp, ΔmexL / phz1::gfp, PAO1 / phz2::gfp, ΔmexL / phz2::gfp, PAO1 / phzM::gfp, ΔmexL / phzM::gfp, PAO1 / phzH::gfp, ΔmexL / phzH::gfp, PAO1 / phzS::gfp and ΔmexL / phzS::gfp.

[0154] Among them, the primers for amplifying the promoter sequence and their nucleotide sequences are as follows:

[0155] phz1-gfp-Fw(5'-3'):GGGATCGGAAGCTGAATTCCCTGTTCCAGAGCCTTTTCCT; phz1-gfp-Rv(5'-3'):TCTGCAGTCGACGGATCCGCGCCGCCTCCGAGAGGGCTC;

[0156] The nucleotide sequence of the phz1 promoter obtained by amplification is Sequence 6 in the sequence table.

[0157] phz2-gfp-Fw(5'-3'):GGGATCGGAAGCTGAATTCCATCGGCCTGCTCAACTGAA; phz2-gfp-Rv(5'-3'):TCTGCAGTCGACGGATCCGGTGCGAATCTCCGCCAGTTC;

[0158] The nucleotide sequence of the phz2 promoter obtained by amplification is sequence 7 in the sequence table.

[0159] phzH-gfp-Fw(5'-3'):GGGATCGGAAGCTGAATTCTCGAACGTTGCCACGAAATC; phzH-gfp-Rv(5'-3'):TCTGCAGTCGACGGATCCAGGGAAACTCCTATAATTGAT;

[0160] The nucleotide sequence of the phzH promoter obtained by amplification is Sequence 8 in the sequence listing.

[0161] phzM-gfp-Fw(5'-3'):GGGATCGGAAGCTGAATTCTCATCCCGGGTTTCTTTTGG; phzM-gfp-Rv(5'-3'):TCTGCAGTCGACGGATCCCTTTTATTCTCTCTCGTTAC;

[0162] The nucleotide sequence of the phzM promoter obtained by amplification is Sequence 9 in the sequence listing.

[0163] phzS-gfp-Fw(5'-3'):GGGATCGGAAGCTGAATTCGGCTGAGCCGCCCGTACCAGA; phzS-gfp-Rv(5'-3'):TCTGCAGTCGACGGATCCGGGTGCTTCCTTTTCTCGAGTG;

[0164] The nucleotide sequence of the amplified phzS promoter is Sequence 10 in the sequence listing.

[0165] The structure of the recombinant plasmid pROBE-phz1 is as follows: the phz1 promoter sequence obtained by primer amplification replaces the small fragment between the EcoRI and BamHI restriction recognition sites of the GFP fusion reporter plasmid pROBE-AT', while keeping the other nucleotide sequences of the GFP fusion reporter plasmid pROBE-AT' unchanged to obtain the recombinant plasmid pROBE-phz1.

[0166] The structures of the recombinant plasmids pROBE-phz2, pROBE-phzM, pROBE-phzH and pROBE-phzS are the same as those of the recombinant plasmid pROBE-phz1, the only difference being that the promoter sequence is replaced with the promoter sequence of the corresponding gene.

[0167] (2) The strain was inoculated into 5 mL of LB liquid culture medium (final carbenicillin concentration: 300 μg / mL) and cultured overnight at 37°C and 200 rpm.

[0168] (3) The OD of the strain 600 Adjust to 0.6, inoculate 1% in a conical flask containing 30mL LB medium (final carbenicillin concentration 300μg / mL), and culture at 37°C, 200rpm. In order to detect the transcription level of the target gene throughout the growth cycle, samples can be taken at intervals of 3h for a total of 24h. Use Synergy H4 hybrid reader (BioTek, USA) to measure the GFP intensity and OD of the bacterial solution 600 GFP belongs to green fluorescent protein, and its excitation wavelength is 488nm and emission wavelength is 520nm. GFP / OD 600 Represents the relative expression level of the gene.

[0169] 2.1.3. RT-qPCR determination of the relative expression levels of phenazine biosynthesis-related genes in the PAO1 wild type (PAO1 / pUCP20), mexL deletion strain (ΔmexL / pUCP20), and complementation strain (ΔmexL / pUCPmexL)

[0170] Among them, the method for RT-qPCR detection of the relative expression levels of phenazine biosynthesis-related genes phzA1, phzM and phzA2 in the PAO1 wild type (PAO1 / pUCP20), mexL deletion strain (ΔmexL / pUCP20) and complementation strain (ΔmexL / pUCPmexL) is as follows:

[0171] (1) Total RNA extraction

[0172] ① Pick a single colony from the culture medium plate and inoculate it into LB liquid culture medium, and culture it at 37℃, 200rpm overnight;

[0173] ② Set the OD of the strain to be tested 600 They were adjusted to 0.6, inoculated into a conical flask containing culture medium at 1% inoculum, and cultured at 37°C and 200 rpm;

[0174] ③When the strain grows to the required period, take 1×10 7The total RNA of each bacterium was extracted. RNA was extracted mainly by RNA extraction kit (Tiangen Biochemical, catalog number: dp430). The specific steps can be referred to the instructions of the kit. The extracted RNA was subjected to electrophoresis and concentration determination;

[0175] (2) DNA removal and reverse transcription

[0176] The RNA extraction kit contains a DNA removal step. The further removal and reverse transcription of DNA uses Tiangen Biochemical's FastKing One-Step Genomic cDNA First-Strand Synthesis Premix (Cat. No. KR118-02). This kit can remove genomic DNA and efficiently synthesize first-strand cDNA at the same time.

[0177] (3) RT-qPCR

[0178] LightCycler 480 (Roche) was used for RT-qPCR reactions.

[0179] The primers involved in RT-qPCR are shown in Table 1: phzA1-RT-Fw and phzA1-RT-Rv, phzM-RT-Fw and phzM-RT-Rv, phzA2-RT-Fw and phzA2-RT-Rv.

[0180] RT-qPCR reaction system:

[0181]

[0182] RT-qPCR reagents were purchased from Vazyme, catalog number: Q711-02.

[0183] RT-qPCR reaction procedure:

[0184]

[0185] The phenazine biosynthesis pathway and the expression results of phenazine biosynthesis-related genes in MexL-deficient bacteria are shown in Figure 2 Figure 1 As shown, Figure 1 A is the phenazine synthesis pathway in Pseudomonas aeruginosa; Figure 1 Middle B shows the expression of genes related to phenazine synthesis in the ΔmexL transcriptome data; Figure 1 The “-” in the figure represents down-regulated expression relative to the wild-type strain PAO1. Figure 1 The transcriptome data of medium B showed that after the loss of mexL, the expression of genes related to phenazine synthesis was downregulated.

[0186] The transcriptome data were then verified by GFP promoter fusion reporter plasmid and RT-qPCR. Figure 2 As shown, Figure 2AE in the figure is a GFP promoter fluorescent reporter plasmid. The promoter activities of the phz1 gene cluster (A), phz2 gene cluster (B), phzM gene (C), phzH gene (D) and phzS gene (E) in the wild-type PAO1 and the mexL knockout strain ΔmexL were measured respectively. The results showed that compared with the wild-type PAO1, the promoter activities of the phz1, phz2 gene cluster and phzM gene in the mexL deletion strain ΔmexL were significantly decreased ( Figure 2 A, B and C), while the promoter activities of phzH and phzS genes did not change significantly ( Figure 2 D and E). RT-qPCR validation results are shown in Figure 2 As shown in Figure F, the results show that the transcription levels of phenazine synthesis-related genes phzA1, phzA2, and phzM in the mexL deletion strain (ΔmexL / pUCP20) were significantly downregulated in ΔmexL, while the expression of phzA1, phzM, and phzA2 genes in the complemented strain (ΔmexL / pUCPmexL) can be restored to wild levels. This result is consistent with the results of the transcriptome data. After mexL is deleted, the expression of phenazine synthesis genes will be downregulated.

[0187] The above results indicate that the genes regulated by MexL protein are not limited to mexJ (Genebank: AAG07065.1), phz1 gene cluster, phz2 gene cluster and / or phzM (Genebank: AAG07596.1). The phz1 gene cluster includes phzA1 (AAG07597.1), phzB1 (AAG07598.1), phzC1 (AAG07599.1), phzD1 (AAG07600.1), phzE1 (AAG07601.1), phzF1 (AAG07602.1) and phzG1 (AAG07604.1); the phz2 gene cluster includes phzA2 (AAG05288.1), phzB2 (AAG05289.1), phzC2 (AAG05290.1), phzD2 (AAG05291.1), phzE2 (AAG05292.1), phzF2 (AAG05293.1) and phzG2.

[0188] 2.2. Determination of phenazine content

[0189] Pyocyanin (PYO) is the best-known phenazine pigment. It is synthesized in large quantities during the stable growth period of Pseudomonas aeruginosa and can be secreted outside the cell. The content of pyocyanin in the culture supernatant of the PAO1 wild type (PAO1 / pUCP20), mexL deletion strain (ΔmexL / pUCP20) and complemented strain (ΔmexL / pUCPmexL) was determined by chloroform extraction. The specific method is as follows: First, the OD value of the bacterial solution of the overnight cultured strain to be tested is 0. 600 Adjust to 0.6, inoculate 1% in LB liquid culture medium (final carbenicillin concentration 300μg / mL), culture at 37°C, 200rpm for 18h, take 5mL of bacterial solution, centrifuge at 8000rpm for 10min, take the supernatant, add 3mL of chloroform and vortex to extract for 20min. Then centrifuge the extract at 8000rpm for 10min, take the lower chloroform phase and transfer it to a new tube, add 1mL 0.2M HCl and vortex, centrifuge and take 200μL of the upper pink aqueous phase and add it to a 96-well plate, and measure its absorbance at 520nm. Repeat three times for each strain, and set the OD 520 Multiply by 17.072 to get the pyocyanin (PYO) content in the strain supernatant.

[0190] In order to further clarify whether the loss of MexL would affect the production of phenazine-1-carboxylic acid, a precursor of pyocyanin, the production of phenazine-1-carboxylic acid (PCA) and pyocyanin (PYO) in the culture supernatant was further determined by more accurate LC-MS / MS. The specific method was as follows: first, a concentration standard curve of PCA and PYO was prepared. A series of concentration gradients of PCA and PYO standards were prepared, 200 μg / mL, 100 μg / mL, 20 μg / mL, 10 μg / mL, and 2 μg / mL, respectively, and the solvent was 100% pure acetonitrile. Then, the extracted sample was diluted 100 times with acetonitrile, filtered through a 0.22 μM filter membrane, and analyzed by LC-MS / MS (external standard method) using QTRAP 6500. The reaction conditions of LC-MS / MS are room temperature, the sample volume is 50 μL, C18 reverse HPLC column, the eluent is divided into liquid A and liquid B, wherein liquid A is water-0.01% TFA (trifluoroacetic acid) (pH 3.01), liquid B is acetonitrile-0.01% TFA (trifluoroacetic acid), the flow rate is 0.4 mL per minute, specifically, the linear gradient from 0% to 15% solvent B is 2 min, the linear gradient from 15% to 83% solvent B is 20 min; the linear gradient from 83% to 100% solvent B is 10 min, and the final linear gradient from 100% to 0% solution B is 5 min. The total method usage time is about 38 min. Each sample is repeated 3 times.

[0191] The experimental results are as follows Figure 3 As shown, Figure 3 A in the middle is the chloroform extraction method to determine the content of pyocyanin in the supernatant of the culture medium of the wild-type strain, the deletion strain and the complemented strain; Figure 3 Figure B shows the LC-MS / MS determination of the contents of phenazine-1-carboxylic acid (PCA) and pyocyanin (PYO) in the culture supernatant of the wild-type strain, the deletion strain and the complemented strain. Figure 3 The results of A showed that compared with the wild-type strain (PAO1 / pUCP20), the production of pyocyanin in the mexL deletion strain (ΔmexL / pUCP20) was significantly reduced, and the production of pyocyanin in the complemented strain (ΔmexL / pUCPmexL) was restored to the wild level. Figure 3 The results in B showed that compared with the wild-type strain (PAO1 / pUCP20), the production of phenazine-1-carboxylic acid and pyocyanin in the mexL knockout strain (ΔmexL / pUCP20) was significantly reduced and almost undetectable; the production of phenazine 1-carboxylic acid (PCA) and pyocyanin (PYO) in the complemented strain (ΔmexL / pUCPmexL) was restored to the wild-type level.

[0192] 2.3. The role of alanine 47 in MexL protein in regulating phenazine biosynthesis

[0193] The wild-type PAO1 (PAO1 / pUCP20), mexL deletion strain (ΔmexL / pUCP20), complementation strain (ΔmexL / pUCPmexL) and MexL protein alanine 47 mutant strain (ΔmexL / pUCPmexL) were detected by referring to the method of 2.1.3 in Example 2. A47D ) in the phenazine biosynthesis-related genes phzA1, phzM and phzA2. The relative expression levels of the PAO1 wild-type strain (PAO1 / pUCP20), the mexL deletion strain (ΔmexL / pUCP20), the complemented strain (ΔmexL / pUCPmexL) and the MexL protein alanine 47 mutant strain (ΔmexL / pUCPmexL) were determined by referring to the chloroform extraction method in 2.2 of Example 2. A47D ) in the culture medium supernatant.

[0194] The results are as follows Figure 4 As shown, Figure 4 A is RT-qPCR determination of the transcription levels of phenazine synthesis-related genes in the wild-type strain, deletion strain, complementation strain and point mutation complementation strain; Figure 4 B is the chloroform extraction method to determine the pyocyanin content in the supernatant of the culture medium of the wild-type strain, deletion strain, complemented strain and point mutation complemented strain. Figure 4 The results showed that the 47th alanine of MexL protein plays an important role in regulating the synthesis of phenazine. A47D ), the transcription levels of phenazine synthesis-related genes phzA1, phzM and phzA2 were low, and the corresponding pyocyanin production was also low, indicating that after the 47th alanine mutation, the MexL protein lost its role in phenazine synthesis, and the MexL protein with the 47th alanine mutation could not restore the mexL gene mutation phenotype. This shows that MexL deficiency significantly reduced the production of pyocyanin, and its 47th alanine played an important role in the regulation of phenazine synthesis-related genes.

[0195] Example 3: The MexL-deficient strain significantly reduced the expression of the quorum sensing system of Pseudomonas aeruginosa and the virulence factors regulated by it

[0196] 3.1. RT-qPCR detection of quorum sensing and virulence-related gene expression in strains

[0197] Pyocyanin is the terminal product of the phenazine pigment synthesis pathway. It is usually synthesized in large quantities when the bacteria enter the stable period and is positively regulated by the quorum sensing system. The quorum sensing system of Pseudomonas aeruginosa mainly includes three categories, namely the las system, the rhl system and the pqs system. The quorum sensing system can regulate the expression of hundreds of genes, including virulence factors, and is closely related to the pathogenicity of Pseudomonas aeruginosa. In order to explore the effect of the deletion of the mexL gene on the transcription level of quorum sensing-related genes, the expression of quorum sensing and virulence-related genes in the PAO1 wild-type strain (PAO1) and the mexL deletion mutant (ΔmexL) was analyzed by transcriptome sequencing. The method of transcriptome sequencing refers to 2.1.1 in Example 2. The results are as follows Figure 5 The results showed that compared with the wild-type PAO1 strain, the las system and rhl system in the quorum sensing of the mexL deletion strain (ΔmexL) were significantly different in the logarithmic phase (OD 600 =0.8) is down-regulated, while the pqs system is in the logarithmic phase (OD 600 =0.8) without significant changes. Entering the stable period (OD 600 =2.5), only the rhlI gene in the las system and rhl system was down-regulated in the mexL deletion strain (ΔmexL), while the genes related to the pqs system were significantly down-regulated ( Figure 5 ). The virulence factor synthesis genes regulated by quorum sensing, such as rhamnolipid synthesis gene rhlAB, cyanide synthesis gene cluster hcnABC, as well as proteases lasA, lasB, lectins lecA and lecB, were all down-regulated in the stable period.

[0198] The transcriptome data of PAO1 wild type (PAO1 / pUCP20), mexL deletion strain (ΔmexL / pUCP20) and complemented strain (ΔmexL / pUCPmexL) were verified by RT-qPCR. The RT-qPCR detection method was referred to 2.1.3 in Example 2, wherein the primer sequences used are shown in Table 1: lasI-RT-Fw and lasI-RT-Rv, lasR-RT-Fw and lasR-RT-Rv, rhlI-RT-Fw and rhlI-RT-Rv, rhlR-RT-Fw and rhlR-RT-Rv, pqsA- RT-Fw and pqsA-RT-Rv, pqsE-RT-Fw and pqsE-RT-Rv, pqsH-RT-Fw and pqsH-RT-Rv, pqsR-RT-Fw and pqsR-RT-Rv, phnA-RT-Fw and phnA-RT-Rv, lasA-RT-Fw and lasA-RT-Rv, lasB-RT-Fw and lasB-RT-Rv, rhlA-RT-Fw and rhlA-RT-Rv, lecA-RT-Fw and lecA-RT-Rv, lecB-RT-Fw and lecB-RT-Rv. The results are shown in Figure 6 As shown, Figure 6 A in the figure shows the RT-qPCR detection of PAO1 and ΔmexL and the complemented strains in the logarithmic phase (OD 600 =0.8) expression of genes related to the las system and the rhl system; Figure 6 B is RT-qPCR detection of PAO1 and ΔmexL and the early stable phase of complementation strains (OD 600 =2.5) expression of genes related to las system and rhl system; Figure 6 Middle C is RT-qPCR detection of PAO1 and ΔmexL and the early stable phase of complementation strains (OD 600 =2.5) pqs system-related gene expression; Figure 6 D in the figure is the RT-qPCR detection of PAO1 and ΔmexL and the early stable phase of the complemented strain (OD 600 =2.5) Virulence gene expression regulated by the quorum sensing system. Figure 6 The results showed that the quorum sensing systems las system, rhl system and pqs system in the mexL deletion strain (ΔmexL / pUCP20) were significantly downregulated in the logarithmic phase and the stable phase, respectively ( Figure 6 AC), virulence factors regulated by quorum sensing are also down-regulated ( Figure 6 In the complemented strain (ΔmexL / pUCPmexL), the above genes can be restored to wild-type levels. The results of RT-qPCR detection are consistent with the transcriptome data.

[0199] 3.2 Toxicity testing of PAO1, ΔmexL and complemented strains

[0200] 3.2.1. Pseudomonas aeruginosa infection of human lung adenocarcinoma cell A549

[0201] The PAO1 wild-type strain (PAO1 / pUCP20), mexL deletion strain (ΔmexL / pUCP20) and complementation strain (ΔmexL / pUCPmexL) were used to infect human lung adenocarcinoma cells A549. The experimental steps of infecting A549 cells with the PAO1 wild-type strain (PAO1 / pUCP20), mexL deletion strain (ΔmexL / pUCP20) and complementation strain (ΔmexL / pUCPmexL) are as follows:

[0202] (1) First, the subcultured A549 cells were distributed into a 24-well plate, with 2.5×10 cells per well. 5 At the same time, the wild-type strain (PAO1 / pUCP20), mexL deletion strain (ΔmexL / pUCP20) and complemented strain (ΔmexL / pUCPmexL) of Pseudomonas aeruginosa PAO1 cultured overnight in LB medium were inoculated into fresh LB medium at a 1% inoculation rate and cultured to OD600 of 0.5-1.0.

[0203] (2) Then the culture medium in the 24-well plate was aspirated, washed once with DMEM-10% FBS, and fresh DMEM-10% FBS was added. Pseudomonas aeruginosa PAO1 wild-type strain (PAO1 / pUCP20), mexL deletion strain (ΔmexL / pUCP20) and complementation strain (ΔmexL / pUCPmexL) were added to the cell culture medium separately, so that the bacteria maintained an infection rate of about 50%, and the culture plate was placed in a cell culture incubator for infection for 5 hours.

[0204] (3) 5 h after infection, the adherent cells were treated with trypsin (without EDTA), collected in a 1.5 mL centrifuge tube, washed once with 1× PBS, and resuspended in 1× PBS. The resuspended cells were operated according to the apoptosis fluorescent dye kit FITC-Annexin V Apoptosis Detection Kit with 7-AAD (Biolegend, Cat. No. 640922). Then, the cells were detected by flow cytometry.

[0205] The results are as follows Figure 7 As shown in A, Figure 7A shows the flow cytometric detection of PAO1, ΔmexL and complemented strains infecting human lung adenocarcinoma cell A549, with the apoptosis rate of A549 cells being used as a marker of bacterial toxicity. Figure 7 The vertical axis of A is the virulence level (%) of the PAO1 wild-type strain (PAO1 / pUCP20), the mexL deletion strain (ΔmexL / pUCP20) and the complemented strain (ΔmexL / pUCPmexL). The virulence level of the strain is calculated based on the ratio of the number of apoptotic cells of A549 caused by bacteria to the total number of cells. The results showed that the apoptosis rate of A549 cells caused by the mexL deletion strain (ΔmexL / pUCP20) was significantly lower than that of the PAO1 wild-type strain (PAO1 / pUCP20) and the complemented strain (ΔmexL / pUCPmexL).

[0206] 3.2.2 Inhibitory effect of Pseudomonas aeruginosa on Staphylococcus aureus

[0207] Pseudomonas aeruginosa is a dominant strain in the environment and has an inhibitory effect on many strains including Staphylococcus aureus. The inhibitory effect of Pseudomonas aeruginosa on Staphylococcus aureus was determined by the filter paper diffusion method. The specific method is as follows: First, prepare the LB medium plate of Staphylococcus aureus, that is, use fresh medium to increase the OD of Staphylococcus aureus cultured overnight in LB liquid medium. 600 Adjust to 0.1, take 100 μL and evenly spread it on the LB solid plate. Then, carefully stick the sterilized filter paper on the surface of the culture medium, and then spot the extracts (including phenazine and other compounds) in the supernatant of the culture solution of the wild-type strain (PAO1 / pUCP20), mexL deletion strain (ΔmexL / pUCP20) and complemented strain (ΔmexL / pUCPmexL) on the filter paper, culture at 37°C for 24h, take pictures and record the size of the inhibition zone, and judge the antibacterial ability according to the size of the inhibition zone. The larger the inhibition zone, the stronger the antibacterial ability.

[0208] The results are as follows Figure 7 As shown in B, Figure 7 B is the inhibitory effect of the extracts from the fermentation supernatant of PAO1, ΔmexL and complemented strains on Staphylococcus aureus. The numbers in the figure represent the diameter of the inhibition zone. The results show that the inhibition zone formed by the mexL-deficient strain (ΔmexL / pUCP20) on Staphylococcus aureus is significantly smaller than that of the PAO1 wild type (PAO1 / pUCP20), while the complemented strain (ΔmexL / pUCPmexL) has restored the inhibitory effect on Staphylococcus aureus.

[0209] In summary, the deletion of the mexL gene significantly reduced the expression of the quorum sensing system of Pseudomonas aeruginosa and reduced the expression of virulence genes. MexL can be used as a potential drug target.

[0210] Example 4: Increased sensitivity of MexL-deficient strains to ciprofloxacin

[0211] The transcriptome sequencing data of the wild-type strain (PAO1) and the mexL deletion strain (ΔmexL) were compared with the method in Example 2. Figure 8 As shown, the expression of MexEF-OprN efflux pump (encoding gene PA2493-2494-2495) was downregulated after MexL loss. It is known that MexT is a positive regulator (direct regulation) of MexEF-OprN efflux pump, while MexS is a negative regulator of MexT, that is, MexS negatively regulates the expression of MexEF-OprN efflux pump through MexT.

[0212] The transcriptome data were then verified by RT-qPCR, and the relative expression levels of mexT and mexE in the PAO1 wild-type strain (PAO1 / pUCP20), mexL deletion strain (ΔmexL / pUCP20) and complementation strain (ΔmexL / pUCPmexL) were determined by RT-qPCR. The detection method of RT-qPCR was referred to 2.1.3 in Example 2, wherein the primer sequences used are shown in Table 1: mexT-RT-Fw and mexT-RT-Rv, mexE-RT-Fw and mexE-RT-Rv.

[0213] The results are as follows Fig. 9 As shown in A, the results show that after MexL is lost, the expression levels of mexT and mexE are downregulated, and the expression of both in the complemented bacteria returns to the wild level. This indicates that after MexL is lost, the expression of the MexEF-OprN efflux pump may be downregulated by downregulating mexT. Since ciprofloxacin is a commonly used drug for the clinical treatment of Pseudomonas aeruginosa infection, and it has been reported that the MexEF-OprN efflux pump is involved in the efflux of ciprofloxacin, the sensitivity of PAO1 wild-type strain (PAO1), mexL deletion strain (ΔmexL) and mexF deletion mutant (ΔmexEF) to ciprofloxacin was determined. The specific method is as follows: The sensitivity of Pseudomonas aeruginosa to antibiotics was determined by filter paper diffusion method. Single colonies of the PAO1 wild-type strain (PAO1), mexL deletion strain (ΔmexL), and mexF knockout mutant (ΔmexEF) were picked from the LB plate and inoculated into 5 mL of LB liquid medium at 37°C, 200 rpm, and cultured overnight. The OD values ​​of the wild-type strain, mutant strain, and complemented strain were calculated. 600Adjust to about 0.8, heat 0.7% water agar solution in a microwave oven to melt in advance, wait until the temperature drops to about 40°C, take 12mL water agar solution and 100μL bacterial solution and mix evenly, pour on the LB solid plate to form a double-layer plate. After the surface is air-dried, gently stick the sterilized filter paper on the surface of the culture medium, take 10μL ciprofloxacin (mother solution concentration 10mg / mL) solution and drop it on the filter paper, then put the plate in a 37°C incubator and culture for 24h. Measure the size of the inhibition zone and take photos to record.

[0214] The sensitivity of bacteria to ciprofloxacin is determined by the circular area of ​​the ciprofloxacin inhibition zone. The more sensitive the strain, the larger the inhibition zone formed by ciprofloxacin, indicating that the bactericidal effect of ciprofloxacin is better. Fig. 9 As shown in B, Fig. 9 The culture dishes in B are from left to right the wild-type strain PAO1, the mexL deletion mutant (ΔmexL) and the mexEF deletion mutant (ΔmexEF). The results showed that compared with the wild-type strain (PAO1), the mexL deletion mutant (ΔmexL) and the mexE and mexF deletion mutant (ΔmexEF) were more sensitive to ciprofloxacin.

[0215] These results suggest that MexL deficiency may enhance sensitivity to ciprofloxacin by downregulating the expression of the efflux pump MexEF-OprN.

[0216] Example 5: As negative regulators of efflux pumps, the effect of MexL deletion is significantly greater than that of MexS deletion

[0217] It is known that MexL and MexS are both negative regulators of efflux pumps. MexL negatively regulates the expression of MexJK-OprM efflux pumps, and MexS negatively regulates the expression of MexEF-OprN efflux pumps. In order to explore the effects of mexL gene and mexS gene deletion on the physiological metabolism of Pseudomonas aeruginosa, transcriptome sequencing analysis was performed on the PAO1 wild-type strain (PAO1), mexL deletion strain (ΔmexL) and mexS deletion strain (ΔmexS). The transcriptome sequencing method was referred to 2.1 in Example 2. The results are shown in Fig.10 As shown, Fig.10 Comparison of transcriptome data between mexL deletion strain (ΔmexL) and mexS deletion strain (ΔmexS). Fig.10 A is a volcano plot of differentially expressed genes comparing the mexL deletion strain (ΔmexL) and the wild-type strain PAO1. Fig.10 B is a volcano plot of differentially expressed genes comparing the mexS deletion strain (ΔmexS) and the wild-type strain PAO1. Fig.10 A shows that the expression of 1120 genes was affected in the mexL deletion strain (ΔmexL); Fig.10 B shows that the expression of 424 genes in the mexS deletion strain (ΔmexS) was affected, and the number of differentially expressed genes was far less than that of ΔmexL. This indicates that MexL plays a more important role in the physiological metabolism of Pseudomonas aeruginosa, and it is more meaningful to design targeted drugs against it.

[0218] Example 6: Erythromycin, triclosan, tetracycline or pyocyanin affect the binding of MexL protein to the promoter

[0219] 6.1. EMSA in vitro detection of the effects of erythromycin, triclosan, tetracycline and pyocyanin on the binding of MexL protein to the promoter

[0220] As a transcription factor, MexL exerts its regulatory function mainly by binding to promoter DNA. The ability of MexL to bind to the promoter can be used as a specific representation of MexL function. In other words, if a small molecule reduces the binding of MexL to the promoter, then the molecule can be considered a potential inhibitor of MexL protein.

[0221] EMSA, or gel retardation assay, is a commonly used in vitro method for detecting protein-DNA interactions. EMSA experiments can be used to detect the effects of erythromycin, triclosan, tetracycline, and pyocyanin on the binding of MexL to the mexJ promoter. The specific steps are as follows:

[0222] (1) Preparation of promoter DNA. The promoter region of mexJ was amplified using the PAO1 genome as a template, the DNA fragments were recovered by gel excision, and the concentration was determined. The nucleotide sequence of the mexJ promoter DNA is sequence 5 in the sequence list.

[0223] (2) Preparation of EMSA gel. Fix the gel plate and gel rack and make sure that the gel will not leak after inspection. The gel used is 6% non-denaturing gel, and the composition formula (30mL) is: 20.77mL ddH2O, 3mL 5×TBE, 6mL 30% polyacrylamide, 200μL 10% ammonium persulfate, and 30μL tetramethylethylenediamine. After the gel solidifies, store it in a refrigerator at 4℃ for later use.

[0224] (3) Preparation of reaction system. Prepare 10×EMSA binding buffer: 100mM Tris-HCl (pH 7.5), 500mM KCl, 10mM DTT. The mexJ promoter sequence (sequence 5 in the sequence list) was amplified from the PAO1 genome by PCR; the MexL protein was heterologously expressed and purified in Escherichia coli (according to the method provided in Example 1). Tetracycline (Tc) was purchased from Shanghai McLean Biochemical Technology Co., Ltd.; item number T829835, PYO represents pyocyanin, purchased from Cayman Company, item number: 10009594; erythromycin (Ery) was purchased from Shanghai McLean Biochemical Technology Co., Ltd., item number E808820; triclosan (Irg) was purchased from Sigma Company, item number 72779.

[0225] The EMSA reaction system was as follows, with a total volume of 20 μL.

[0226]

[0227] After gently mixing the components, place them at room temperature for 30 minutes. Pre-run the EMSA gel in advance, using 0.5×TBE as the electrophoresis buffer, voltage 100V, and pre-electrophoresis for 60 minutes. Load the samples according to the above lanes and electrophoresed at a voltage of 100V for 100 minutes.

[0228] (4) EMSA result processing: The gel was carefully removed and first soaked in 0.5×TBE containing 1×Gel red stain for 15 min, then destained with pure water for 10 min, and finally photographed and analyzed using a gel imaging system.

[0229] The results are as follows Fig.11 As shown, Fig.11 EMSA was used to detect the effects of erythromycin, triclosan, tetracycline and pyocyanin on the binding of MexL to the mexJ promoter. Fig.11 A is the EMSA (gel retardation) result when tetracycline was added to the system. Fig.11 B is the EMSA (gel retardation) result when triclosan was added to the system. Fig.11 C is the EMSA (gel retardation) result when erythromycin was added to the system. Fig.11 D is the EMSA (gel retardation) result when pyocyanin was added to the system.

[0230] Fig.11 The results showed that: the results of in vitro EMSA (gel retardation) showed that tetracycline ( Fig.11 A) Triclosan Fig.11 B) Erythromycin ( Fig.11 C) and pyocyanin ( Fig.11D) It can affect the function of MexL protein by affecting the binding of MexL to the mexJ promoter. Compared with the other three, erythromycin may require a higher concentration.

[0231] 6.2. RT-qPCR detection of mexJ transcription levels after the addition of tetracycline, triclosan, erythromycin and pyocyanin

[0232] Through 6.1, it has been verified in vitro that tetracycline, triclosan, erythromycin and pyocyanin affect the binding of MexL to the mexJ promoter. Next, RT-qPCR is used to detect the effect of the addition of tetracycline, triclosan, erythromycin and pyocyanin on the transcription level of mexJ in vivo. The RT-qPCR detection method refers to 2.1.3 in Example 2, where the primer sequences used are shown in mexJ-RT-Fw and mexJ-RT-Rv in Table 1. The specific method is:

[0233] The wild-type strain PAO1 was cultured to OD 600 =0.4, PAO1 was added to 5 test tubes, test tube ① had no antibiotics added; test tube ② added tetracycline with a final concentration of 100 μg / mL (corresponding to a molar concentration of 208 μM); test tube ③ added triclosan with a final concentration of 1.5 mg / mL (corresponding to a molar concentration of 5.18 mM); test tube ④ added erythromycin with a final concentration of 1.5 mg / mL (corresponding to a molar concentration of 2 mM); test tube ⑤ added pyocyanin with a final concentration of 500 μM. The five test tubes were placed in a 37°C shaker, 200 rpm, cultured for 3 h, and RNA was extracted.

[0234] The results are as follows Fig.12 As shown, Fig.12 RT-qPCR was used to detect the transcription level of mexJ in wild-type strain PAO1 in the presence of tetracycline, triclosan, erythromycin and pyocyanin. Fig.12 Wild type represents wild-type PAO1 without the addition of antibiotics; wild type + tetracycline represents wild-type PAO1 with the addition of tetracycline at a final concentration of 100 μg / mL (corresponding to a molar concentration of 208 μM); wild type + triclosan represents the addition of triclosan at a final concentration of 1.5 mg / mL (corresponding to a molar concentration of 5.18 mM); wild type + pyocyanin represents wild-type PAO1 with the addition of pyocyanin at a final concentration of 500 μM. Fig.12The results showed that when tetracycline, triclosan, erythromycin and pyocyanin were added, the transcription level of mexJ increased significantly compared with the wild-type strain PAO1 without antibiotics. It is known that MexL binds to the mexJ promoter region by repression. The results of this study can relieve the repression of the mexJ promoter by affecting MexL in vivo. That is, tetracycline, triclosan, erythromycin and pyocyanin can inhibit the activity of the MexL protein (inhibit the activity of the MexL protein binding to the promoter of the mexJ gene regulated by it).

[0235] Example 7: Erythromycin, triclosan or tetracycline targets MexL, thereby reducing the virulence of Pseudomonas aeruginosa.

[0236] 7.1 Effects of different doses of erythromycin, triclosan or tetracycline on pyocyanin synthesis in Pseudomonas aeruginosa

[0237] It is known that pyocyanin is an important virulence factor of Pseudomonas aeruginosa, and MexL deficiency significantly reduces the production of pyocyanin. By adding different doses of erythromycin, triclosan or tetracycline, the production of pyocyanin can be measured as an indicator of targeting MexL function. The specific method is as follows:

[0238] (1) The wild-type strain PAO1 was cultured overnight and inoculated into 30 mL LB medium at a ratio of 1:100. Tetracycline was added to a final concentration of 10 μg / mL, 15 μg / mL, and 20 μg / mL; erythromycin was added to a final concentration of 32 μg / mL, 64 μg / mL, and 128 μg / mL; triclosan was added to a final concentration of 64 μg / mL, 128 μg / mL, and 256 μg / mL. PAO1 without the above antibiotics was used as a control. The culture was shaken at 37°C, 200 rpm for 24 h. The extraction method of pyocyanin was referred to 2.2.

[0239] (2) PAO1 / phz1::gfp and PAO1 / phz2::gfp were used as experimental strains. The construction of the strains was described in 2.1.2. The test tube contained 5 mL of LB (containing carbenicillin at a final concentration of 300 μg / mL), inoculated at 1:100, and tetracycline was added to a final concentration of 10 μg / mL, 15 μg / mL, and 20 μg / mL, respectively; erythromycin was added to a final concentration of 32 μg / mL, 64 μg / mL, and 128 μg / mL; triclosan was added to a final concentration of 64 μg / mL, 128 μg / mL, and 256 μg / mL. PAO1 / pROBE-phz1 and PAO1 / pROBE-phz2 without the above antibiotics were used as controls. The cells were cultured at 37°C, 200 rpm, and shaken for 24 h. The GFP intensity and OD of the bacterial solution were measured using a Synergy H4 hybrid reader (BioTek, USA). 600 GFP belongs to green fluorescent protein, and its excitation wavelength is 488nm and emission wavelength is 520nm. GFP / OD 600 Represents the relative expression level of the gene.

[0240] The results are as follows Fig.13 As shown, adding different concentrations of erythromycin, pyocyanin production ( Fig.13 A) and pyocyanin synthesis gene transcription level ( Fig.13 B) showed a decrease. Adding tetracycline ( Fig.13 C and Fig.13 D) and the addition of triclosan ( Fig.13 E and Fig.13 F) also showed similar results.

[0241] As a transcription factor, MexL mainly functions by binding to the promoter region of the regulated gene to enhance or weaken the gene expression level. The results showed that tetracycline, erythromycin, triclosan and pyocyanin can all affect the ability of MexL to bind to the promoter. When MexL cannot bind to the promoter, its function is lost, which is equivalent to the loss of the MexL gene. The results showed that MexL loss leads to down-regulation of the quorum sensing system and virulence factors of Pseudomonas aeruginosa. In summary, the combined use of pyocyanin, tetracycline, erythromycin, triclosan and ciprofloxacin or the development of small molecule inhibitors of MexL can reduce bacterial virulence by targeting the MexL protein, thereby reducing the inflammatory response and treating Pseudomonas aeruginosa infection.

[0242] This study unexpectedly found that knocking out the negative regulator MexL of the drug efflux pump can reduce the virulence of Pseudomonas aeruginosa, a common drug-resistant bacterium in hospitals, and at the same time increase the sensitivity of the bacterium to certain drugs, providing a target and new strategy for the prevention and treatment of this bacterium.

[0243] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Use of a protein or a substance for regulating the content of the protein or a substance for regulating the activity of the protein or a substance for regulating gene expression in any of the following items, wherein the gene encodes the protein, and the protein is MexL protein; A1) Application in regulating the toxicity of Pseudomonas aeruginosa; A2) Application in the preparation of products for regulating the toxicity of Pseudomonas aeruginosa; A3) Application in regulating the sensitivity of Pseudomonas aeruginosa to drugs; A4) Application in the preparation of products for regulating the sensitivity of Pseudomonas aeruginosa to drugs; A5) Application in regulating the production of pyocyanin from Pseudomonas aeruginosa; A6) Application in the preparation of products for regulating the production of pyocyanin in Pseudomonas aeruginosa; A7) Application in the development or preparation of drugs for resisting Pseudomonas aeruginosa infection; A8) Application in microbial breeding or microbial assisted breeding; The MexL protein is a wild-type MexL protein or a mutant MexL protein, and the wild-type MexL protein is any one of the following proteins a1)-a3): a1) The amino acid sequence is the protein shown in Sequence 1 in the sequence list; a2), a protein related to the toxicity of Pseudomonas aeruginosa obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in a1), which has more than 80% identity with the amino acid sequence shown in a1); a3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of a1) or a2).

2. The use according to claim 1, characterized in that: The mutant MexL protein is MexL A47D Protein, MexL A47D The protein is a protein whose amino acid sequence is sequence 3 in the sequence list.

3. The use according to claim 1 or 2, characterized in that: The substance that regulates the protein content or the substance that regulates gene expression is a biological material, and the biological material is any one of the following: B1), nucleic acid molecule encoding wild-type MexL protein; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5), code MexL A47D Nucleic acid molecules of proteins; B6), an expression cassette containing the nucleic acid molecule described in B5); B7), a recombinant vector containing the nucleic acid molecule described in B5), or a recombinant vector containing the expression cassette described in B6); B8), a recombinant microorganism containing the nucleic acid molecule described in B5), or a recombinant microorganism containing the expression cassette described in B6), or a recombinant microorganism containing the recombinant vector described in B7); The substance that regulates the activity of the protein is selected from tetracycline, triclosan, erythromycin and / or pyocyanin.

4. The use according to claim 3, characterized in that: The nucleic acid molecule described in B1) is a DNA molecule described in any of the following: g1), the coding sequence of the coding strand is the DNA molecule of sequence 2 in the sequence list; g2), a DNA molecule that has more than 80% identity with the DNA molecule described in g1) and is associated with the toxicity of Pseudomonas aeruginosa; B5) The nucleic acid molecule described is a DNA molecule described in any of the following: g3), the coding sequence of the coding strand is the DNA molecule of sequence 4 in the sequence list; g4), a DNA molecule that has more than 80% identity with the DNA molecule described in g3), and is associated with the toxicity of Pseudomonas aeruginosa.

5. A method for regulating the toxicity of Pseudomonas aeruginosa and / or regulating the sensitivity of Pseudomonas aeruginosa to drugs, the method comprising regulating the toxicity of Pseudomonas aeruginosa and / or regulating the sensitivity of Pseudomonas aeruginosa to drugs by regulating the expression of the MexL protein in Pseudomonas aeruginosa or regulating the content or activity of the MexL protein.

6. The method according to claim 5, characterized in that: The regulating the expression of the MexL protein in Pseudomonas aeruginosa or regulating the content of the MexL protein is M1) or M2): M1), inhibiting or reducing the expression of the wild-type MexL protein encoding gene in the recipient Pseudomonas aeruginosa or inhibiting or reducing the content or activity of the wild-type MexL protein in the recipient Pseudomonas aeruginosa, to obtain the target Pseudomonas aeruginosa having lower toxicity than the recipient Pseudomonas aeruginosa or / and higher drug sensitivity than the recipient Pseudomonas aeruginosa; M2), the wild-type MexL protein in the recipient Pseudomonas aeruginosa was mutated to A47D; The regulating the activity of the MexL protein in Pseudomonas aeruginosa is to inhibit, reduce or down-regulate the activity of the MexL protein in Pseudomonas aeruginosa.

7. A method for preparing Pseudomonas aeruginosa with reduced toxicity and / or increased drug sensitivity, characterized in that: The method comprises M1) or M2): M1), inhibiting or reducing the expression of the wild-type MexL protein encoding gene in the recipient Pseudomonas aeruginosa or inhibiting or reducing the content or activity of the wild-type MexL protein in the recipient Pseudomonas aeruginosa, to obtain the target Pseudomonas aeruginosa with lower toxicity than the recipient Pseudomonas aeruginosa and / or higher drug sensitivity than the recipient Pseudomonas aeruginosa; M2) The wild-type MexL protein in the recipient Pseudomonas aeruginosa was mutated to A47D.

8. The recombinant Pseudomonas aeruginosa prepared by the method of claim 7.

9. Application, characterized in that: The application is any of the following: P1) Use of a substance that inhibits the activity of the MexL protein in claim 1 in developing or preparing a drug against Pseudomonas aeruginosa infection; P2) Use of the recombinant Pseudomonas aeruginosa according to claim 8 in screening drugs for preventing and / or treating Pseudomonas aeruginosa infection; P3) Use of the recombinant Pseudomonas aeruginosa according to claim 8 in the study of the mechanism of MexL protein and toxicity or drug sensitivity of Pseudomonas aeruginosa.

10. A drug for preventing infection by Pseudomonas aeruginosa, comprising an antibiotic and a substance that inhibits the activity of the MexL protein of claim 1.

Images