Lung cancer gene detection method and application

Abstract

The invention relates to the technical field of lung cancer gene detection, and discloses a lung cancer gene detection method which comprises the following steps: step 1, collecting a biological sample from the body of a patient, preferentially selecting a peripheral blood sample, and controlling the sampling amount to be 5-10ml; 2, centrifuging the collected blood sample at room temperature, separating plasma and blood cells, and extracting circulating tumor DNA in the plasma by using a kit; and 3, fully diluting the extracted circulating tumor DNA to ensure that only one DNA molecule exists in each reaction unit in the digital PCR at most. According to the lung cancer gene detection method, the application and the use of the kit provided by the invention, the experimental operation process is simplified, so that an experimenter can quickly and consistently perform sample treatment, the repeatability and the standardization degree of an experiment are improved, and by accurately diluting circulating tumor DNA and performing operation by using an accurate micropipettor, the detection accuracy is improved. And the accuracy and the reliability of the experiment are ensured.

Description

Technical Field

[0001] The present invention relates to the technical field of lung cancer gene detection, and in particular to a lung cancer gene detection method and application. Background Art

[0002] Lung cancer is one of the malignant tumors with the highest morbidity and mortality rates worldwide. Early diagnosis and treatment are crucial to improving the survival rate of lung cancer patients. At present, the diagnosis of lung cancer mainly relies on imaging examinations and histopathological analysis, but these methods can often only detect lung cancer when it develops to a certain stage, missing the best time for treatment. In recent years, with the development of molecular biology and genetics, people have found that the occurrence of lung cancer is closely related to a variety of gene mutations. For example, epidermal growth factor receptor (EGFR) gene mutations, ALK gene rearrangements, KRAS gene mutations, etc., the abnormal expression or mutation of these genes is closely related to the occurrence, development and prognosis of lung cancer. Therefore, by detecting the mutation status of these genes, it can provide an important basis for the early diagnosis, treatment selection and prognosis evaluation of lung cancer.

[0003] Existing gene detection technologies include PCR amplification, fluorescence in situ hybridization (FISH), immunohistochemistry, etc. However, these methods have certain limitations, such as complex operation, long detection cycle, high cost, and different sensitivity and specificity.

[0004] In view of this, the present invention proposes a method for detecting lung cancer genes, aiming to overcome the deficiencies of the prior art and to achieve early diagnosis and personalized treatment of lung cancer. Summary of the invention

[0005] 1. Technical issues to be resolved

[0006] In view of the deficiencies in the prior art, the present invention provides a method for detecting lung cancer genes and its application, which has the advantages of simple operation, low cost, high sensitivity and specificity, and solves the problems raised in the background technology.

[0007] (II) Technical solution

[0008] In order to achieve the above-mentioned purpose of simple operation, low cost, high sensitivity and specificity, the present invention provides the following technical solution: a method for detecting lung cancer genes, which is carried out according to the following steps:

[0009] Step 1: Collect biological samples from the patient, preferably peripheral blood samples, and control the sampling volume between 5-10ml;

[0010] Step 2: Centrifuge the collected blood sample at room temperature to separate the plasma and blood cells, and then use a kit to extract circulating tumor DNA in the plasma;

[0011] Step 3: Dilute the extracted circulating tumor DNA sufficiently to ensure that there is at most one DNA molecule in each reaction unit in the digital PCR;

[0012] Step 4: prepare a digital PCR reaction system, which includes: specific primers, fluorescent probes, dNTPs, high-fidelity polymerase and PCR buffer. Design specific primers and fluorescent probes for the deletion of exon 19 at the mutation site of the EGFR gene. The specific primers have a forward primer and a reverse primer. The sequence of the forward primer is: 5'-GCAATGGCAAGACCCTGTGA-3', the sequence of the reverse primer is: 5'-CACCCATGGCCAGCTTGTAG-3', and the sequence of the fluorescent probe is: 5'-(6-FAM)CCACACAGCAAGTGCAAGTCCACGTA(MGB-NFQ)-3';

[0013] Step 5: Digital PCR operation: including the following steps:

[0014] a. Distribute the reaction system: distribute the prepared reaction system into at least 10,000 micro-reaction units, each unit containing one or no template DNA molecule;

[0015] b. Thermal cycling: thermal cycling was performed on a dedicated digital PCR device, including denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 60 seconds, for a total of 40 cycles;

[0016] c. Fluorescence data acquisition: In the annealing or extension step of each cycle, a dedicated digital PCR device is used to detect the fluorescence signal of each reaction unit to determine whether there is amplification of the target sequence;

[0017] Step 6: Data analysis and result judgment: including the following steps:

[0018] a. Data analysis: Use digital PCR analysis software to process the fluorescence data collection results, calculate the number of positive and negative reaction units, and then determine the frequency of target gene mutations;

[0019] b. Interpretation of results: If common mutation sites of the EGFR gene are detected, it indicates that the patient may have lung cancer, otherwise it indicates that the patient may not have lung cancer.

[0020] Preferably, in step 2, the collected peripheral blood sample is centrifuged at room temperature at a relative centrifugal force of 1500 g to 2000 g for 5-10 minutes.

[0021] Preferably, the kit comprises the following components: a binding buffer, magnetic beads, a washing buffer and an elution buffer, wherein the binding buffer is used to promote the binding of circulating tumor DNA to a solid phase carrier and contains a high salt concentration to enhance the interaction between DNA and the carrier, the surface of the magnetic beads is coated with a chemical substance that can specifically bind to circulating tumor DNA and is used to capture circulating tumor DNA from plasma, the washing buffer is used to remove impurities and proteins that are not specifically bound during the binding process, and the elution buffer is used to release the bound circulating tumor DNA from the magnetic beads and contains a low salt concentration and a mild surfactant.

[0022] Preferably, the step 3 of fully diluting the extracted circulating tumor DNA comprises the following sub-steps:

[0023] a. Determine the initial concentration of the extracted circulating tumor DNA by ultraviolet spectrophotometer or fluorescence quantitative method;

[0024] b. Calculate the dilution factor required to achieve this goal based on the quantification results of a maximum of one DNA molecule and circulating tumor DNA per reaction unit;

[0025] c. Use a precise micropipette and diluent to perform fine dilution according to the calculated dilution ratio, ensuring that all operations are performed under sterile conditions;

[0026] d. Perform a preliminary experiment or a test run using a small amount of sample to check whether the circulating tumor DNA concentration after dilution is suitable for digital PCR analysis. If not, adjust the dilution ratio based on the results.

[0027] Preferably, the distribution response system in step 5 further comprises using a digital PCR chip or microfluidic device having at least 10,000 independent micro-reaction units to achieve high-throughput single-molecule detection.

[0028] Preferably, a high-sensitivity fluorescence detector is used in the fluorescence data collection process in step 5, and real-time monitoring is implemented during the data collection process to observe the amplification efficiency in real time and adjust the experimental conditions in time.

[0029] Preferably, the result interpretation process in step six further includes comparing the test results with a known gene mutation database of lung cancer patients to provide more accurate disease diagnosis and prognosis assessment.

[0030] The present invention also provides an application of a lung cancer gene detection method in the process of lung cancer detection.

[0031] Compared with the prior art, the present invention provides a method and application for detecting lung cancer genes, which has the following beneficial effects:

[0032] 1. The present invention provides a method and application for detecting lung cancer genes. The use of the kit simplifies the experimental operation process, allowing experimenters to quickly and consistently process samples, improving the repeatability and standardization of the experiment. By accurately diluting circulating tumor DNA and using a precise micropipette for operation, the accuracy and reliability of the experiment are ensured, while reducing the waste of experimental materials, thereby reducing costs. Due to the high sensitivity and specificity of digital PCR technology, the reliance on expensive subsequent verification steps can be reduced, thereby reducing the overall detection cost.

[0033] 2. The present invention provides a method and application for detecting lung cancer genes. By using a highly sensitive fluorescence detector and real-time monitoring technology, the amplification of the target DNA sequence can be accurately detected, thereby improving the sensitivity of detection. Real-time monitoring also allows experimenters to adjust conditions in time during the amplification process to optimize the reaction efficiency and reduce nonspecific amplification, thereby improving specificity. Through the design of specific primers and fluorescent probes, combined with high-fidelity polymerase, accurate identification of specific mutation sites of the EGFR gene is ensured, further enhancing the specificity of detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 It is a schematic diagram of the process of the present invention. DETAILED DESCRIPTION

[0035] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0036] See also Figure 1 , a method for detecting lung cancer genes, is carried out according to the following steps:

[0037] Step 1: Collect biological samples from the patient, preferably peripheral blood samples, and control the sampling volume between 5-10ml;

[0038] Step 2: Centrifuge the collected blood sample at room temperature to separate the plasma and blood cells, and then use a kit to extract circulating tumor DNA in the plasma;

[0039] Step 3: Dilute the extracted circulating tumor DNA sufficiently to ensure that there is at most one DNA molecule in each reaction unit in the digital PCR;

[0040] Step 4: Prepare a digital PCR reaction system, including: specific primers, fluorescent probes, dNTPs, high-fidelity polymerase and PCR buffer. Design specific primers and fluorescent probes for the deletion of exon 19 at the mutation site of the EGFR gene. The specific primers have a forward primer and a reverse primer. The sequence of the forward primer is: 5'-GCAATGGCAAGACCCTGTGA-3', the sequence of the reverse primer is: 5'-CACCCATGGCCAGCTTGTAG-3', and the sequence of the fluorescent probe is: 5'-(6-FAM)CCACACAGCAAGTGCAAGTCCACGTA(MGB-NFQ)-3';

[0041] Step 5: Digital PCR operation: including the following steps:

[0042] a. Distribute the reaction system: distribute the prepared reaction system into at least 10,000 micro-reaction units, each unit containing one or no template DNA molecule;

[0043] b. Thermal cycling: thermal cycling was performed on a dedicated digital PCR device, including denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 60 seconds, for a total of 40 cycles;

[0044] c. Fluorescence data acquisition: In the annealing or extension step of each cycle, a dedicated digital PCR device is used to detect the fluorescence signal of each reaction unit to determine whether there is amplification of the target sequence;

[0045] Step 6: Data analysis and result judgment: including the following steps:

[0046] a. Data analysis: Use digital PCR analysis software to process the fluorescence data collection results, calculate the number of positive and negative reaction units, and then determine the frequency of target gene mutations;

[0047] b. Interpretation of results: If common mutation sites of the EGFR gene are detected, it indicates that the patient may have lung cancer, otherwise it indicates that the patient may not have lung cancer.

[0048] Specifically, in step 2, the collected peripheral blood sample is centrifuged at room temperature at a relative centrifugal force of 1500g to 2000g for 5-10 minutes. The advantage is that by specifying the centrifugal force and time range, efficient separation of plasma and blood cells can be ensured. The centrifugal force is between 1500g and 2000g, which is generally considered to be suitable for separating plasma and blood cells. It can effectively remove blood cells while retaining circulating tumor DNA in plasma. Appropriate centrifugation conditions help reduce genomic DNA contamination caused by blood cell rupture, which helps to extract high-quality circulating tumor DNA, and high-quality circulating tumor DNA samples are conducive to improving the accuracy and reliability of detection.

[0049] Specifically, the kit includes the following components: binding buffer, magnetic beads, washing buffer and elution buffer. The binding buffer is used to promote the binding of circulating tumor DNA to the solid phase carrier and contains a high salt concentration to enhance the interaction between DNA and the carrier. The surface of the magnetic beads is coated with chemicals that can specifically bind to circulating tumor DNA and is used to capture circulating tumor DNA from plasma. The washing buffer is used to remove impurities and proteins that are not specifically bound during the binding process. The elution buffer is used to release the bound circulating tumor DNA from the magnetic beads and contains a low salt concentration and a mild surfactant. The advantage is that by using magnetic beads coated with chemicals that specifically bind to circulating tumor DNA, circulating tumor DNA can be efficiently captured from plasma. The use of wash buffer helps to remove nonspecific impurities and proteins that may be attached during the binding process, thereby improving the accuracy and reliability of subsequent detection. The elution buffer contains low salt concentration and mild surfactants, which helps to gently and efficiently release the bound circulating tumor DNA from the magnetic beads, reduce damage to the DNA structure, and ensure the integrity of the DNA and the quality of subsequent analysis. The use of the kit simplifies the experimental operation process, allowing experimenters to quickly and consistently process samples, improving the repeatability and standardization of the experiment. The design of the kit makes it suitable for high-sensitivity detection technologies such as digital PCR, and can meet the needs of accurate detection of circulating tumor DNA.

[0050] Specifically, step 3 of fully diluting the extracted circulating tumor DNA includes the following sub-steps:

[0051] a. Determine the initial concentration of the extracted circulating tumor DNA by ultraviolet spectrophotometer or fluorescence quantitative method;

[0052] b. Calculate the dilution factor required to achieve this goal based on the quantification results of a maximum of one DNA molecule and circulating tumor DNA per reaction unit;

[0053] c. Use a precise micropipette and diluent to perform fine dilution according to the calculated dilution ratio, ensuring that all operations are performed under sterile conditions;

[0054] d. Perform a preliminary experiment or a test run with a small amount of sample to check whether the concentration of circulating tumor DNA after dilution is suitable for digital PCR analysis. If not, adjust the dilution ratio according to the result. The advantage is that by accurately diluting circulating tumor DNA, it is ensured that there is at most one DNA molecule in each reaction unit of digital PCR, which helps to accurately perform single-molecule detection, thereby improving the accuracy and reliability of the detection. Preliminary experiments or test runs are performed to check whether the concentration of diluted DNA is suitable for digital PCR analysis, which helps to optimize experimental conditions and ensure the repeatability and accuracy of experimental results. The use of precise micropipettes for dilution ensures the accuracy of the operation, reduces experimental errors, and improves the operability of the experiment. It is emphasized that all operations are performed under sterile conditions, which helps to prevent sample contamination and ensure the reliability of experimental results.

[0055] Specifically, the distribution response system in step five further includes the use of a digital PCR chip or microfluidic device with at least 10,000 independent microreaction units to achieve high-throughput single-molecule detection. The advantage is that a large number of samples can be tested simultaneously using a digital PCR chip or microfluidic device with at least 10,000 independent microreaction units. This greatly improves the detection efficiency, allowing more samples to be processed in a shorter period of time. Due to the high sensitivity of digital PCR, a smaller sample volume can be used for detection. By testing a large number of samples at the same time, the time and resources required for the experiment can be significantly reduced, which is conducive to cost reduction.

[0056] Specifically, in step 5, a highly sensitive fluorescence detector is used in the fluorescence data collection process, and real-time monitoring is implemented during the data collection process to observe the amplification efficiency in real time and adjust the experimental conditions in time. The advantage is that the use of a highly sensitive fluorescence detector can more accurately detect changes in the fluorescence signal, and real-time monitoring of the fluorescence signal during the amplification process can instantly understand the efficiency and dynamics of the PCR reaction, which helps to promptly discover and solve problems of non-specific amplification or inhibition effects. Real-time monitoring and adjustment of experimental conditions help reduce experimental errors and improve the reliability of experimental results, which is crucial for clinical diagnosis and scientific research. Real-time monitoring of fluorescence signal changes can ensure the collection of high-quality data, which is crucial for subsequent data analysis and result interpretation.

[0057] Specifically, the result interpretation process in step 6 further includes comparing the test results with a known database of gene mutations in lung cancer patients to provide a more accurate disease diagnosis and prognosis assessment. The advantage is that by comparing the test results with a known database of gene mutations in lung cancer patients, specific gene mutations associated with lung cancer can be more accurately identified, thereby improving the accuracy of diagnosis. The comparison results help provide patients with personalized medical advice. With the continuous updating and expansion of the database, the detection method can be continuously improved to improve the ability to identify newly discovered gene mutations and maintain the advanced nature of the detection technology.

[0058] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A method for detecting lung cancer genes, characterized in that: Proceed as follows: Step 1: Collect biological samples from the patient, preferably peripheral blood samples, and control the sampling volume between 5-10ml; Step 2: Centrifuge the collected blood sample at room temperature to separate the plasma and blood cells, and then use a kit to extract circulating tumor DNA in the plasma; Step 3: Dilute the extracted circulating tumor DNA sufficiently to ensure that there is at most one DNA molecule in each reaction unit in the digital PCR; Step 4: prepare a digital PCR reaction system, which includes: specific primers, fluorescent probes, dNTPs, high-fidelity polymerase and PCR buffer. Design specific primers and fluorescent probes for the deletion of exon 19 at the mutation site of the EGFR gene. The specific primers have a forward primer and a reverse primer. The sequence of the forward primer is: 5'-GCAATGGCAAGACCCTGTGA-3', the sequence of the reverse primer is: 5'-CACCCATGGCCAGCTTGTAG-3', and the sequence of the fluorescent probe is: 5'-(6-FAM)CCACACAGCAAGTGCAAGTCCACGTA(MGB-NFQ)-3'; Step 5: Digital PCR operation: including the following steps: a. Distribute the reaction system: distribute the prepared reaction system into at least 10,000 micro-reaction units, each unit containing one or no template DNA molecule; b. Thermal cycling: thermal cycling was performed on a dedicated digital PCR device, including denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 60 seconds, for a total of 40 cycles; c. Fluorescence data acquisition: In the annealing or extension step of each cycle, a dedicated digital PCR device is used to detect the fluorescence signal of each reaction unit to determine whether there is amplification of the target sequence; Step 6: Data analysis and result judgment: including the following steps: a. Data analysis: Use digital PCR analysis software to process the fluorescence data collection results, calculate the number of positive and negative reaction units, and then determine the frequency of target gene mutations; b. Interpretation of results: If common mutation sites of the EGFR gene are detected, it indicates that the patient may have lung cancer, otherwise it indicates that the patient may not have lung cancer.

2. The method for detecting a lung cancer gene according to claim 1, characterized in that: In the step 2, the collected peripheral blood sample is centrifuged at room temperature at a relative centrifugal force of 1500 g to 2000 g for 5 to 10 minutes.

3. The method for detecting a lung cancer gene according to claim 1, characterized in that: The kit includes the following components: a binding buffer, magnetic beads, a washing buffer and an elution buffer. The binding buffer is used to promote the binding of circulating tumor DNA to a solid phase carrier and contains a high salt concentration to enhance the interaction between DNA and the carrier. The surface of the magnetic beads is coated with a chemical substance that can specifically bind to circulating tumor DNA and is used to capture circulating tumor DNA from plasma. The washing buffer is used to remove impurities and proteins that are not specifically bound during the binding process. The elution buffer is used to release the bound circulating tumor DNA from the magnetic beads and contains a low salt concentration and a mild surfactant.

4. The method for detecting lung cancer genes according to claim 1, characterized in that: The step 3 of fully diluting the extracted circulating tumor DNA comprises the following sub-steps: a. Determine the initial concentration of the extracted circulating tumor DNA by ultraviolet spectrophotometer or fluorescence quantitative method; b. Calculate the dilution factor required to achieve this goal based on the quantification results of a maximum of one DNA molecule and circulating tumor DNA per reaction unit; c. Use a precise micropipette and diluent to perform fine dilution according to the calculated dilution ratio, ensuring that all operations are performed under sterile conditions; d. Perform a preliminary experiment or a test run using a small amount of sample to check whether the circulating tumor DNA concentration after dilution is suitable for digital PCR analysis. If not, adjust the dilution ratio based on the results.

5. The method for detecting lung cancer genes according to claim 1, characterized in that: The distribution response system in step 5 further includes using a digital PCR chip or a microfluidic device having at least 10,000 independent micro-reaction units to achieve high-throughput single-molecule detection.

6. The method for detecting lung cancer genes according to claim 1, characterized in that: In the step 5, a high-sensitivity fluorescence detector is used in the fluorescence data collection process, and real-time monitoring is implemented during the data collection process to observe the amplification efficiency in real time and adjust the experimental conditions in time.

7. The method for detecting lung cancer genes according to claim 1, characterized in that: The result interpretation process in step six further includes comparing the test results with a known lung cancer patient gene mutation database to provide a more accurate disease diagnosis and prognosis assessment.

8. Use of the method for detecting lung cancer genes according to any one of claims 1 to 7 in the process of lung cancer detection.

Images