Manganese-based nano vaccine adjuvant and preparation method thereof

Abstract

The invention belongs to the technical field of biological medicine, and provides a manganese-based nano vaccine adjuvant and a preparation method thereof, and the adjuvant is manganese-based nano particles Mn-DNP; the Mn-DNP comprises an antigen binding aptamer Apt and a CpG immunologic adjuvant sequence; the manganese adjuvant is directly synthesized into the DNA nanoparticles, the operation is simple, and the preparation is easy; due to high programmability of DNA, the prepared Mn-DNP contains an aptamer sequence bound with an antigen, can be specifically bound with the antigen, and is wide in application range; the prepared Mn-DNP is stable in structure, adjuvants and antigens can be slowly released when the Mn-DNP is degraded in vivo, and a manganese adjuvant and a CpG adjuvant simultaneously stimulate an organism to generate cellular immunity and humoral immunity and cooperatively induce efficient immune response; the manganese-based nano composite vaccine adjuvant is not easy to accumulate in vivo and has good biological safety.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and specifically is a manganese-based nano vaccine adjuvant and a preparation method thereof. Background Art

[0002] Adjuvants, as immunomodulators, can induce effective immune responses after vaccination. Among traditional aluminum salt adjuvants, aluminum hydroxide and aluminum phosphate are the most widely used and safest adjuvants, which can activate Th2 immune responses, but their limitation is that they cannot activate cellular immunity. In anti-infection immunity, cellular immunity mainly participates in the immune response to intracellular parasitic microbial pathogens or viruses, is the main force of anti-infection immunity, and participates in immune protection. Manganese is a trace element necessary for the human body and an activator of multiple enzymes in the human body. Manganese adjuvant is a newly developed immune adjuvant in recent years. It can activate the cGAS-ST I NG pathway and induce humoral and cellular immune responses; in addition, manganese adjuvant can stimulate the maturation of dendritic cells (DC) and induce the production of type I interferon (IFN-I) and cytokines.

[0003] CpG oligonucleotide (CpG-ODN) is a synthetic oligodeoxyribonucleotide containing non-methylated CpG motifs, also known as CpG islands, which can enhance humoral immunity and cellular immunity induced by a variety of antigens. CpG-ODN can activate TLR9 receptors, activate DCs and B cells, and indirectly activate NK cells and T cells by inducing the production of cytokines, inducing Th1 immunity.

[0004] Nano vaccines use nanoparticles as carriers to connect specific antigens and adjuvants, and specifically deliver antigens to antigen presenting cells (APCs), which can avoid premature degradation of the vaccine and improve the stability of the vaccine. However, nanoparticle vaccines still have many problems, such as easy accumulation in the body, causing blood vessel blockage, and some nano vaccines can also cause local or systemic inflammatory reactions. In response to the above problems, it is urgent to develop a safe and efficient nano vaccine.

[0005] Since the DNA nanotechnology was proposed in the 1980s, after decades of development, it has been applied to many fields such as biological imaging, disease prevention, diagnosis, treatment, and drug delivery. Among them, rolling circle amplification (RCA) technology is a newly developed isothermal amplification method for nucleic acids. It is a common preparation method for nucleic acid nanoparticles, has good biosafety, can effectively control the morphology and size of the synthesized nanoparticles, and is easy to customize.

[0006] Due to the many limitations of existing nanovaccine adjuvants and their delivery systems, a new manganese-based nanovaccine adjuvant is developed to achieve co-activation of cellular immunity and humoral immunity to prevent viral infection. Summary of the invention

[0007] In order to solve the above technical problems, the present invention provides a manganese-based nano vaccine adjuvant and a preparation method thereof to solve the problems mentioned in the background technology.

[0008] According to the first aspect of the present disclosure, a manganese-based nano vaccine adjuvant is provided, comprising the adjuvant being a manganese-based nanoparticle Mn-DNP, wherein the manganese-based nanoparticle Mn-DNP comprises an antigen-binding aptamer Apt and a CpG immune adjuvant sequence;

[0009] By utilizing RCA technology to mineralize manganese ions to form manganese pyrophosphate, and using electrostatic adsorption to carry out orderly growth and assembly on the synthetic functional nucleic acid long chains, manganese-based nanoparticles with immune adjuvant efficacy are finally formed.

[0010] Preferably, the particle size of the manganese-based nanovaccine adjuvant is 50 to 600 nm.

[0011] Preferably, the complementary sequence of the functional nucleic acid is used as the template chain of the RCA reaction, and the template chain contains x viral antigen aptamers and y complementary sequences of CpG immune adjuvants, wherein x is 0-5 and y is 1-7.

[0012] Preferably, the virus includes but is not limited to novel coronavirus, influenza virus, herpes virus, respiratory syncytial virus, and human immunodeficiency virus;

[0013] The viral antigens include but are not limited to novel coronavirus antigens, namely the receptor binding domain RBD and the N-terminal domain NTD, influenza virus antigens, namely the hemagglutinin protein HA and the neuraminidase NA, herpes virus antigens, namely the glycoproteins gD, gH and gp350, respiratory syncytial virus antigens, namely the pre-F protein, and H IV antigens, namely the p24 protein.

[0014] According to the second aspect of the present disclosure, a method for preparing a manganese-based nano vaccine adjuvant is also proposed, and the specific steps are:

[0015] S1, mixing the template strand and the primer in a molar ratio range of 4:1 to 1:4 in deionized water to obtain a hybrid strand;

[0016] S2, heating and annealing the obtained hybridized chain in a PCR instrument;

[0017] S3, mixing the product obtained in S2 with T4 DNA ligase, T4 DNA ligase diluent, and T4 DNA ligase buffer, and performing gap ligation of the linear hybridization chain in a PCR instrument to obtain a circular DNA template ci rc-DNA;

[0018] S4. Mix the circular DNA template ci rc-DNA with pH i29 DNA polymerase buffer, pH i29 DNA polymerase, dNTPs, BSA and 2mM to 12mM MnCl2 in a reaction system, with a reaction time of 2 to 24 hours and a reaction temperature of 20 to 40°C to obtain a manganese-based nanovaccine adjuvant.

[0019] Preferably, the molar ratio of the template strand to the primer strand is 1:1; the reaction time is 3 to 6 hours, the reaction temperature is 30° C.; and the MnCl2 concentration is 6 to 8 mM.

[0020] Preferably, the DNA template strand used is:

[0021] Template containing aptamer of SARS-CoV-2 virus antigen RBD and a CpG adjuvant:

[0022] GTATCATCAAGCCGCCGAACCTATCGCAATCCTAAGCAGTCCTTGTTCTTGGGTGCTGCGAATA TTAACGTCAGGAACGTCATGGATACCCGCGAG;

[0023] Template containing 3 CpG sequences:

[0024] GTATCATCAAGCCGAACGTCAGGAACGTCATGGAAATATTAACGTCAGGAACGTCATGGAAATA TTAACGTCAGGAACGTCATGGATACCCGCGAG;

[0025] The aptamer sequence is:

[0026] CCGAACCTATCGCAATCCCTAAGCAGTCCTTGTTCTTGGGTGCTGCG;

[0027] The CpG sequence is: AACGTCAGTCAGCGAACGTCATGGA.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] 1. The present invention synthesizes manganese-based nano-vaccine adjuvants through rolling circle amplification technology, which is simple to operate and easy to produce.

[0030] 2. The manganese-based nano vaccine adjuvant prepared by the present invention uses nucleic acid nanomaterials as carriers, contains antigen-binding aptamers and CpG sequences, and can specifically adsorb antigens; uses manganese as a skeleton to achieve co-delivery of manganese adjuvant and antigen in vivo; manganese-based nanoparticles degrade in vivo to achieve slow release of adjuvant and antigen.

[0031] 3. The present invention uses the manganese-based nano vaccine adjuvant as a carrier, and the prepared vaccine is not easy to accumulate in the body and has higher safety. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 The TEM image of the present invention verifying the synthesis of Mn-DNP; wherein the synthesis time is 3h and the MnCl2 concentration is 8mM;

[0033] Figure 2 This is an SDS-PAGE diagram of the specific adsorption of viral antigen RBD by Mn-DNP of the present invention;

[0034] Figure 3 The secretion level of cytokine IL-6 after BMDCs activated by Mn-DNP of the present invention;

[0035] Figure 4 It is the antibody titer produced after three immunizations with Mn-DNP of the present invention. DETAILED DESCRIPTION

[0036] The following embodiments of the present invention are described in further detail in conjunction with the accompanying drawings and examples. The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention.

[0037] As attached Figure 1 To Attachment Figure 4 As shown:

[0038] Embodiment 1: The present invention provides a manganese-based nano vaccine adjuvant, comprising: the adjuvant is a manganese-based nanoparticle Mn-DNP, the manganese-based nanoparticle Mn-DNP comprises an antigen binding aptamer Apt and a CpG immune adjuvant sequence;

[0039] By utilizing RCA technology to mineralize manganese ions to form manganese pyrophosphate, and using electrostatic adsorption to carry out orderly growth and assembly on the synthetic functional nucleic acid long chains, manganese-based nanoparticles with immune adjuvant efficacy are finally formed.

[0040] The particle size of the manganese-based nano vaccine adjuvant is 50 to 600 nm.

[0041] The complementary sequence of phosphorylated functional nucleic acid is used as the template chain of RCA reaction, and the template chain contains x virus antigen aptamers and y complementary sequences of CpG immune adjuvants, wherein x is 0-5 and y is 1-7.

[0042] Viruses include but are not limited to novel coronavirus, influenza virus, herpes virus, respiratory syncytial virus, and human immunodeficiency virus;

[0043] Viral antigens include but are not limited to new coronavirus antigens (receptor binding domain RBD, N-terminal domain NTD), influenza virus antigens (hemagglutinin protein HA, neuraminidase NA), herpes virus antigens (glycoprotein gD, gH, gp350), respiratory syncytial virus antigens (pre-F protein), and H IV antigen (p24 protein).

[0044] After adding MnCl2, RCA reaction was carried out to obtain manganese-based nanoparticles. The viral antigen aptamer sequence on the nanoparticles can effectively capture the corresponding viral antigens, and the CpG adjuvant can exert the effect of cellular immunity. The nanovaccine adjuvant enters the cell through endocytosis, is decomposed by the lysosomal microacid environment, and releases CpG and manganese ions. CpG adjuvant activates TLR9 receptors, activates DC cells and B cells, and induces the production of cytokines to indirectly activate NK cells and T cells, inducing Th1 immunity; manganese ions activate the cGAS-ST I NG pathway, induce the body to produce cellular immunity, and at the same time activate B cells in the lymph nodes, promote the production of memory cells and germinal centers, thereby inducing long-term and efficient immunity.

[0045] like Figure 1 As shown, it is a TEM image verifying the synthesis of Mn-DNP, where the synthesis time is 3h and the MnCl2 concentration is 8mM.

[0046] Embodiment 2: The present invention also provides a method for preparing a manganese-based nano vaccine adjuvant, the specific preparation method is:

[0047] In the first step, 100 μM phosphorylated template strand and 100 μM primer were mixed in an aqueous solution at a molar ratio of 1:1 to obtain a hybrid strand, and the final concentration of the DNA template was 10 μM;

[0048] In the second step, the obtained hybrid chain was heated and annealed in a PCR instrument, and the program was: 95°C for 2 min, 65°C for 2 min, 60°C for 5 min, and then the temperature was gradually decreased by 0.5°C every 30 s until 20°C, and the obtained product was stored at 4°C;

[0049] The third step is to mix the product obtained in the second step with T4 DNA ligase, T4 DNA ligase diluent, and T4 DNA ligase buffer to obtain a circular DNA template (C i rc-DNA), and the final concentration of the circular DNA template is 1 μM;

[0050] In the fourth step, 0.5 μM circular DNA template was mixed with pH i29 DNA polymerase buffer, pH i29 DNA polymerase, 1 mM dNTPs, 50 mM KCl, 0.5 mg / mL BSA and MnCl2, and Mn-DNP was obtained after reacting for 3 to 6 hours.

[0051] The DNA template strand used was: Primer: CGGCTTGATGATACCTCGCGGGTA;

[0052] Template containing aptamer of SARS-Cov-2 virus antigen RBD and a CpG adjuvant:

[0053] GTATCATCAAGCCGCCGAACCTATCGCAATCCTAAGCAGTCCTTGTTCTTGGGTGCTGCGAATA TTAACGTCAGGAACGTCATGGATACCCGCGAG;

[0054] The aptamer sequence is:

[0055] CCGAACCTATCGCAATCCCTAAGCAGTCCTTGTTCTTGGGTGCTGCG;

[0056] The CpG sequence is: AACGTCAGTCAGCGAACGTCATGGA.

[0057] like Figure 2 The figure shows the SDS-PAGE diagram of Mn-DNP specifically adsorbing the viral antigen RBD, where the ratio of Mn-DNP to RBD or HRP is the mass ratio. HRP is the control protein. Lane 1, protein marker; Lane 2, RBD; Lane 3-5, Mn-DNP:RBD=4:8; Mn-DNP:RBD=6:8; Mn-DNP:RBD=8:8.

[0058] Importantly, it should be noted that the construction and arrangement of the present application shown in a plurality of different exemplary embodiments are only exemplary. Although only a few embodiments are described in detail in this disclosure, it should be readily understood by those who refer to this disclosure that many modifications are possible (e.g., the size, scale, structure, shape and proportion of various elements, as well as parameter values ​​(e.g., temperature, pressure, etc.), mounting arrangements, use of materials, color, directional changes, etc.) without substantially departing from the novel teachings and advantages of the subject matter described in the application. For example, the element shown as integrally formed can be composed of multiple parts or elements, the position of the element can be inverted or otherwise changed, and the nature or number or position of the discrete element can be changed or changed. Therefore, all such modifications are intended to be included in the scope of the present invention. The order or sequence of any process or method steps can be changed or reordered according to alternative embodiments. In the claims, any "device plus function" clause is intended to cover the structure of performing the function described herein, and is not only structurally equivalent but also equivalent structure. Without departing from the scope of the present invention, other replacements, modifications, changes and omissions can be made in the design, operating conditions and arrangement of the exemplary embodiments. Therefore, the invention is not limited to a specific embodiment, but extends to numerous modifications still falling within the scope of the appended claims.

[0059] Additionally, in order to provide a concise description of exemplary embodiments, all features of an actual embodiment (ie, those features that are not relevant to the best mode presently contemplated for carrying out the invention or those that are not relevant to implementing the invention) may not be described.

[0060] It will be appreciated that in the development of any actual implementation, as in any engineering or design project, numerous implementation-specific decisions may be made. Such a development effort may be complex and time-consuming, but will be a routine task of design, fabrication, and production for those of ordinary skill having the benefit of this disclosure without undue experimentation.

[0061] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.

Claims

1. A manganese-based nano vaccine adjuvant, characterized in that: The adjuvant is a manganese-based nanoparticle Mn-DNP, and the manganese-based nanoparticle Mn-DNP contains an antigen-binding aptamer Apt and a CpG immune adjuvant sequence; By utilizing rolling circle amplification technology to mineralize manganese ions to form manganese pyrophosphate, they are then orderly grown and assembled on synthetic functional nucleic acid chains with the help of electrostatic adsorption, ultimately forming manganese-based nanoparticles with immune adjuvant efficacy.

2. A manganese-based nano vaccine adjuvant as claimed in claim 1, characterized in that: The particle size of the manganese-based nano vaccine adjuvant is 50 to 600 nm; the CpG immune adjuvant includes but is not limited to type A CpG immune adjuvant, type B CpG immune adjuvant, and type C CpG immune adjuvant.

3. A manganese-based nano vaccine adjuvant as claimed in claim 1, characterized in that: The complementary sequence of the functional nucleic acid is used as the template chain of the rolling circle amplification reaction, and the template chain contains x complementary sequences of viral antigen aptamers and y CpG immune adjuvants, wherein x is 0 to 5 and y is 1 to 7; that is, in addition to at least one CpG sequence, an antigen aptamer sequence can be added, or multiple functional nucleic acid sequences can be connected in series.

4. A manganese-based nano vaccine adjuvant as claimed in claim 3, characterized in that: The viruses include but are not limited to novel coronavirus, influenza virus, herpes virus, respiratory syncytial virus, and human immunodeficiency virus; The viral antigens include but are not limited to novel coronavirus antigens, namely the receptor binding domain RBD and the N-terminal domain NTD, influenza virus antigens, namely the hemagglutinin protein HA and the neuraminidase NA, herpes virus antigens, namely the glycoproteins gD, gH and gp350, respiratory syncytial virus antigens, namely the pre-F protein, and HIV antigens, namely the p24 protein.

5. A method for preparing a manganese-based nano vaccine adjuvant, applied to a manganese-based nano vaccine adjuvant as claimed in claims 1-4, characterized in that: The specific steps are: S1, mixing the template strand and the primer in a molar ratio range of 4:1 to 1:4 in deionized water to obtain a hybrid strand; S2, heating and annealing the obtained hybridized chain in a PCR instrument; S3, mixing the product obtained in S2 with T4 DNA ligase, T4 DNA ligase dilution solution, and T4 DNA ligase buffer, performing gap ligation of the linear hybridization chain in a PCR instrument to obtain a circular DNA template circ-DNA; S4. Mix the circular DNA template circ-DNA with phi29 DNA polymerase buffer, phi29 DNA polymerase, dNTPs, BSA and 2mM to 12mM MnCl2 in the reaction system for 2 to 24h at a reaction temperature of 20 to 40°C to obtain a manganese-based nanovaccine adjuvant.

6. A method for preparing a manganese-based nano vaccine adjuvant as claimed in claim 5, characterized in that: The molar ratio of the template chain to the primer chain is 1:1; the reaction time is 3 to 6 hours, the reaction temperature is 30° C.; and the MnCl2 concentration is 6 to 8 mM.

7. A manganese-based nano vaccine adjuvant and a preparation method thereof as claimed in claim 5, characterized in that: The DNA template strand used is: Template containing aptamer of SARS-CoV-2 virus antigen RBD and a CpG adjuvant: GTATCATCAAGCCGCCGAACCTATCGCAATCCTAAGCAGTCCTTGTTCTTGGGTGCTGCGAATA TTAACGTCAGGAACGTCATGGATACCCGCGAG; Template containing 3 CpG sequences: GTATCATCAAGCCGAACGTCAGGAACGTCATGGAAATATTAACGTCAGGAACGTCATGGAAATA TTAACGTCAGGAACGTCATGGATACCCGCGAG; The aptamer sequence is as follows: CCGAACCTATCGCAATCCTAAGCAGTCCTTGTTCTTGGGTGCTGCG; The CpG sequence is: AACGTCAGGAACGTCATGGA.

Images