Purification method of label-free alpha-synuclein

Abstract

The invention relates to the technical field of protein purification, in particular to a purification method of label-free alpha-synuclein. The purification method provided by the invention comprises the following steps: (1) constructing a recombinant expression vector containing an alpha-synaptic nucleus gene; (2) transforming the recombinant expression vector containing the alpha-synucleus gene into host bacteria, carrying out induced expression, centrifuging, and collecting thalli; (3) sequentially carrying out ultrasonic pulverization, boiling and centrifugation on the thalli, and collecting centrifuged supernate; (4) sequentially carrying out ammonium sulfate precipitation, centrifugation, filtration, acid precipitation and alkali neutralization on the supernate to obtain a protein solution to be purified; and (5) carrying out anion exchange chromatography, ultrafiltration and concentration on the to-be-purified protein solution to obtain the label-free alpha-synuclein. The purification method is more efficient, economical and capable of maintaining protein functions, and the method can improve the overall effect and experimental accuracy of alpha-synuclein monomer preparation.

Description

Technical Field

[0001] The present invention relates to the technical field of protein purification, and in particular to a method for purifying label-free alpha-synuclein. Background Art

[0002] α-Synuclein is an indispensable protein in cell function, and its abnormal aggregation is closely related to neurodegenerative diseases such as Parkinson's disease. In medical research, the detection of α-synuclein is of great significance for Parkinson's disease, Lewy body dementia and other synuclein diseases. These diseases all involve pathological aggregation of α-synuclein, and RT-QuIC (Real-Time Quaking-Induced Conversion) is a biochemical detection technology that can detect disease-related pathological protein aggregates by simulating the protein aggregation process in vitro. RT-QuIC technology can quickly and highly sensitively identify these abnormally folded proteins in biological samples such as cerebrospinal fluid, skin, and blood, which is helpful for the early diagnosis and pathogenesis research of related diseases. RT-QuIC has high sensitivity and mainly determines whether there are pathological aggregates in the sample by inducing seed-mediated α-synuclein monomer-dependent amplification in vitro and combining it with real-time fluorescence quantitative technology. In order to ensure the accuracy of the detection, it is crucial to obtain monomers with high purity and high yield.

[0003] During the preparation of α-synuclein monomers, ensuring purification is critical because insufficient purification can negatively impact experimental results, especially in highly sensitive detection techniques such as RT-QuIC. Impurity proteins that may be present in the protein sample may interact with α-synuclein, induce nonspecific aggregation, and interfere with experimental results. Insufficiently purified α-synuclein may also be mixed with other components in the cell lysate, such as nucleic acids, lipids, or small molecules, which may affect the normal function of the protein, reduce the aggregation-inducing ability of the protein, and thus reduce the sensitivity of the detection.

[0004] At present, the commonly used protein purification method is to use tags (such as His or GST tags) to achieve efficient purification through commercial affinity chromatography columns. However, the addition of tags needs to be carried out during the plasmid design stage and may affect the function of the protein. For example, macromolecular tags (such as GST or EGFP) may change the conformation of the target protein, thereby affecting its aggregation ability and experimental results. Therefore, it is particularly important to explore methods that do not rely on tags and use the physicochemical properties of proteins (such as molecular weight, charge, hydrophilicity, etc.) for purification. Although traditional purification methods (such as molecular sieve chromatography) are effective, they are costly and time-consuming, which limits their application in large-scale experiments. Therefore, the development of new, cost-effective and efficient purification technologies is of great significance to improving experimental efficiency and expanding the scope of application. Summary of the invention

[0005] The purpose of the present invention is to provide a method for purifying label-free α-synuclein to solve the problems existing in the above-mentioned prior art. The method for purifying label-free α-synuclein provided by the present invention is a more efficient, economical purification method that can maintain protein function, and the method can improve the overall effect and experimental accuracy of the preparation of α-synuclein monomers.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a method for purifying label-free α-synuclein, comprising the following steps:

[0008] (1) constructing a recombinant expression vector containing the α-synuclein gene;

[0009] (2) transforming the recombinant expression vector into a host bacterium, inducing expression, and collecting the bacterium after centrifugation;

[0010] (3) subjecting the bacterial cells to ultrasonic pulverization, boiling and centrifugation in sequence, and collecting the supernatant after centrifugation;

[0011] (4) subjecting the supernatant to ammonium sulfate precipitation, centrifugation, acid precipitation and alkali neutralization in sequence to obtain a protein solution to be purified; the ammonium sulfate precipitation includes primary precipitation and secondary precipitation;

[0012] (5) performing anion exchange chromatography, ultrafiltration filtration and concentration on the protein solution to be purified to obtain the label-free α-synuclein; the ultrafiltration filtration includes a first ultrafiltration filtration and a second ultrafiltration filtration.

[0013] Preferably, in step (4), the primary precipitation comprises the steps of mixing the supernatant with a 60% w / v (mass volume fraction) ammonium sulfate solution, sequentially standing and centrifuging, collecting the supernatant, and obtaining a protein solution;

[0014] The secondary precipitation comprises the step of mixing the protein solution with a 60% w / v ammonium sulfate solution and then centrifuging to obtain a protein precipitate.

[0015] Preferably, the mass volume fraction of ammonium sulfate in the mixed solution obtained after the supernatant is mixed with a 60% w / v ammonium sulfate solution is 18%;

[0016] The mass volume fraction of ammonium sulfate in the mixed solution obtained by mixing the protein solution and the 60% w / v ammonium sulfate solution is 27%.

[0017] Preferably, in step (5), the first ultrafiltration comprises the step of adding the target protein obtained by the anion exchange chromatography to a 100 kd ultrafiltration tube, centrifuging and filtering, collecting the filtrate, and obtaining a first filtrate;

[0018] The second ultrafiltration comprises the steps of adding the first filtrate into a 50 kDa ultrafiltration tube, centrifuging and filtering, collecting the filtrate, and obtaining the second filtrate.

[0019] Preferably, in step (4), the acid precipitation comprises the steps of mixing the supernatant obtained by centrifugation with hydrochloric acid, centrifuging the mixture, and collecting the supernatant obtained by centrifugation.

[0020] Preferably, in step (5), the concentration includes adding the second filtrate to a 3 kDa ultrafiltration tube and then centrifuging and filtering to obtain the unlabeled α-synuclein.

[0021] Preferably, in step (3), the ultrasonic pulverization condition parameters are: 60% intensity; ultrasound is turned on for 10 seconds and off for 10 seconds, and the operation is continued for 30 minutes.

[0022] Preferably, in step (3), the boiling temperature is 100° C. and the boiling time is 10 min.

[0023] Preferably, in step (3), the centrifugation condition parameters are: 4°C, 20,000 g centrifugation for 30 min.

[0024] Preferably, in step (1), the base vector of the recombinant expression vector is pET-28a(+).

[0025] The present invention discloses the following technical effects:

[0026] 1. High purity and high yield

[0027] The present invention adopts a purification method that does not rely on labels, which overcomes the limitation of labels on the purification effect in traditional affinity chromatography. By optimizing the purification steps, the purity and yield of alpha-synuclein can be effectively improved. This is crucial for subsequent experiments and applications, because high-purity proteins can reduce the risk of nonspecific aggregation and improve the sensitivity and accuracy of detection. It can be seen that the efficient purification method that does not rely on labels provided by the present invention can overcome the problems of limited separation amount and high cost of label proteins in affinity chromatography, and greatly improve the yield of alpha-synuclein.

[0028] 2. Avoid label interference

[0029] Many conventional purification methods rely on adding tags (such as His or GST), which may cause changes in the conformation of the target protein, thereby affecting its biological activity and the accuracy of the experimental results. The purification technology provided by the present invention does not require the addition of tags, and can maintain the original conformation and biological function of the protein during the purification process. This method not only ensures that the activity of α-synuclein in the experiment remains unchanged, but also ensures the reliability and consistency of the experimental results. This characteristic of maintaining biological activity is particularly important for subsequent biological research and applications.

[0030] 3. Economical and efficient

[0031] Traditional protein purification methods, such as affinity chromatography and molecular sieve chromatography, are often costly and time-consuming. The purification technology developed by the present invention reduces material costs and operation time, is suitable for large-scale production, and can effectively meet the needs of laboratory and industrial applications. This economic benefit makes the technology more feasible in practical applications.

[0032] 4. Reduce the impact of impurities

[0033] During the purification process, α-synuclein that has not been fully purified may carry some impurity proteins that interact with it, and these impurities are likely to induce nonspecific aggregation. The presence of impurity proteins may interfere with the experimental results and affect the accuracy of the experiment, especially in sensitive detection technologies such as RT-QuIC. The present invention utilizes the physicochemical properties of α-synuclein to remove impurities, ensuring the high purity of the target protein instead of relying on traditional molecular weight differences for molecular sieve chromatography. This process significantly reduces the incidence of nonspecific aggregation and enhances the reliability of the experiment. Moreover, this method ensures the high purity of α-synuclein monomers, providing a more accurate and reliable basis for subsequent experiments.

[0034] 5. Simplify the operation process

[0035] The present invention optimizes the traditional purification process in the technical solution, reduces unnecessary steps, and makes the operation easier. This improvement not only improves the experimental efficiency, but also reduces the dependence on the operator's technical level, so that the method can be used by a wider range of scientific researchers and technicians.

[0036] In summary, the present invention provides a more efficient, economical purification method that can maintain protein function, and can improve the overall effect and experimental accuracy of α-synuclein monomer preparation. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0038] Figure 1 A flow chart of the method for purification of untagged α-synuclein;

[0039] Figure 2 It is the white protein precipitate after the secondary precipitation;

[0040] Figure 3 The peak of the target protein (human α-synuclein) eluted with 330 mM NaCl (33% B solution);

[0041] Figure 4 This is the gel electrophoresis image of human α-synuclein;

[0042] Figure 5 This is the result of Coomassie Brilliant Blue staining;

[0043] Figure 6 is the absorption peak and absorption spectrum curve;

[0044] Figure 7 The figure is the electrophoresis diagram during the purification process of the enzyme cleavage product; among them, SNCA is the gene PCR fragment band of human α-synuclein, and Snca is the gene PCR fragment band of mouse α-synuclein. DETAILED DESCRIPTION

[0045] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0046] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0047] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0048] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0049] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0050] Example 1

[0051] The specific steps of the tag-free α-synuclein purification method are as follows Figure 1 As shown, the details are as follows:

[0052] 1. Construction of recombinant expression plasmid and recombinant bacteria

[0053] 1. Gene sequence acquisition

[0054] Visit the NCBI Gene database and enter "α-synuclein" or its gene identifier (such as SNCA (human) or Snca (mouse)) in the search box to find relevant information about the α-synuclein gene; after entering the gene page, find the "CDS" sequence (coding sequence) and copy it. The CDS sequences of the human α-synuclein gene and the mouse α-synuclein gene are as follows:

[0055] The CDS sequence of the human α-synuclein gene is shown in SEQ ID NO.1, specifically: ATGGATGTATTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAGAAAACCAAACAGGGTGTGGCAGAAGCAGCAGGAAAGACAAAAGAGGGTGTTCTCTATGTAGGCTCCAAAACCAAGGAGGGAGTGGTGCATGGTGTGGCAACAGTGGCTGAGAAGACCAAAGAGCAAGTGACAAATGTTGGAGGAGCAGTGGTGACGGGTGTGACAGCAGTAGCCCAGAAGACAGTGGAGGGAGCAGGGAGCATTGCAGCAGCCACTGGCTTTGTCAAAAAGGACCAGTTGGGCAAGAATGAAGAAGGAGCCCCACAGGAAGGAATTCTGGAAGATATGCCTGTGGATCCTGACAATGAGGCTTATGAAATGCCTTCTGAGGAAGGGTATCAAGACTACGAACCTGAAGCCTAA;

[0056] The CDS sequence of the mouse α-synuclein gene is shown in SEQ ID NO.2, specifically: ATGGACGTGTTTATGAAAGGTCTGAGCAAGGCAAAGGAAGGTGTAGTGGCAGCGGCGGAGAAAACGAAACAGGGCGTGGCGGAAGCGGCGGGTAAGACGAAAGAGGGCGTCCTGTATGTTGGTAGCAAGACCAAGGAAGGCGTGGTCCACGGTGTTACCACCGTTGCTGAGAAAACTAAAGAACAAGTTACCAACGTCGGTGGCGCCGTGGTTACGGGCGTGACCGCAGTTGCGCAAAAGACCGTCGAGGGTGCGGGTAATATCGCCGCTGCGACCGGTTTCGTCAAAAAAGACCAGATGGGTAAGGGTGAGGAAGGCTACCCGCAAGAGGGCATTCTGGAAGATATGCCGGTGGACCCGGGTTCCGAGGCATACGAAATGCCGAGCGAAGAAGGCTATCAGGATTACGAGCCAGAGGCCTAA。

[0057] 2. Plasmid selection

[0058] The pET-28a(+) plasmid was selected as the expression vector. This plasmid contains a T7 promoter, which can induce the expression of the target protein in Escherichia coli BL21(DE3), and carries an ampicillin resistance gene for resistance screening. The pET-28a(+) plasmid was used to construct the expression plasmids of human α-synuclein and mouse α-synuclein.

[0059] 3. Restriction enzyme digestion

[0060] EcoRI and XhoI were used as restriction endonucleases to perform double digestion reaction to digest the pET-28a(+) plasmid and the target α-synuclein gene, respectively.

[0061] Add pET-28a(+) plasmid (500 ng) and α-synuclein gene fragment (1 μg, sequence as shown in SEQ ID NO.1 or SEQ ID NO.2) into restriction enzyme reaction tubes respectively, and then add the following reagents into the reaction tubes:

[0062] 10× enzyme digestion buffer: 2μL, EcoRI (10U / μL): 1μL, XhoI (10U / μL): 1μL, the rest is distilled water, the total reaction system is 20μL.

[0063] Incubate in a 37°C water bath for 2 h to ensure that the plasmid and gene fragment are completely cut to obtain the cut pET-28a(+) plasmid, the cut human α-synuclein fragment and the cut mouse α-synuclein fragment.

[0064] 4. Purification of enzyme digestion products

[0065] After the enzyme digestion reaction is completed, use 1% agarose gel electrophoresis to separate the DNA fragments. Load the digestion product into the agarose gel and verify whether the digestion is successful by electrophoresis. At the same time, use ultraviolet light to observe the electrophoresis results and cut out the corresponding plasmid and α-synuclein gene fragment bands ( Figure 7 ).

[0066] The target DNA fragment in the gel was recovered using a gel recovery kit, and DNA purification was performed according to the kit instructions to finally obtain the cleaved and purified pET-28a(+) plasmid, the cleaved and purified human α-synuclein fragment, and the cleaved and purified mouse α-synuclein fragment.

[0067] 5. Ligation reaction

[0068] The purified plasmid and α-synuclein gene were ligated using T4 DNA ligase.

[0069] Add the following reagents to the ligation reaction tube:

[0070] Cut and purified pET-28a(+) plasmid: 50ng, α-synuclein gene fragment (cut and purified human α-synuclein fragment or cut and purified mouse α-synuclein fragment): 100ng, 10×T4 DNA ligation buffer: 2μL, T4 DNA ligase (400U / μL): 1μL, the rest is distilled water, the total reaction system is 20μL.

[0071] The mixture was incubated overnight at 16°C to complete the ligation reaction between the plasmid and the gene fragment, thereby obtaining the expression plasmid of recombinant human α-synuclein and the expression plasmid of recombinant mouse α-synuclein.

[0072] 6. Transformed cells

[0073] The constructed recombinant human α-synuclein expression plasmid and recombinant mouse α-synuclein expression plasmid were introduced into BL21 (DE3) competent cells by chemical transformation; the transformation steps are as follows:

[0074] Take 50 μL of BL21 (DE3) competent cells, place on ice, and add 2 μL of recombinant human α-synuclein expression plasmid or recombinant mouse α-synuclein expression plasmid.

[0075] Incubate on ice for 30 min to facilitate DNA entry into cells.

[0076] After heat shock at 42°C for 45 seconds, the cells were immediately returned to ice for 2 minutes.

[0077] Add 500 μL of LB medium without antibiotics to the reaction tube and culture at 37° C. in a shaking incubator for 1 h to promote cell recovery to obtain transformed cells.

[0078] 7. Screening and Verification

[0079] The transformed cells were evenly spread on LB agar plates containing ampicillin antibiotic (50 μg / mL) by streaking method.

[0080] Incubate the plate in a 37°C incubator overnight.

[0081] On the second day, a single colony was picked and PCR was used to verify whether the recombinant plasmid in the colony contained the correct α-synuclein insertion fragment to obtain positive recombinant bacteria.

[0082] In the monoclonal screening process of this embodiment, the streak method is used to pick monoclonal bacteria in an agar culture dish containing antibiotics to reduce the variation between strains; at the same time, the picked single colony is transferred to an LB culture medium containing antibiotics to screen out strains with strong resistance.

[0083] 2. Prokaryotic expression and crude purification

[0084] 1. Culture medium preparation and sterilization: clean a 2.5L conical flask, add 800mL pure water and 45g TB broth powder, mix, and obtain Terrible LB culture medium, which is sterilized by high pressure. In this example, LB culture medium is replaced with Terrible LB culture medium, which will provide higher nutrients and promote rapid growth and high-density culture of bacteria.

[0085] 2. Inoculation and shaking: After the sterilized culture medium temperature drops to about 37°C, add ampicillin antibiotics at a ratio of 1:1000 (according to the resistance gene expressed by the plasmid, add 100μg / mL ampicillin antibiotics (ampicillin) to the culture medium) and shake well. Then, add 1mL of bacterial solution (the bacterial solution here is the positive recombinant bacterial solution obtained in the above verification) to each bottle of culture medium (use large conical flasks, and each bottle has 1 / 3 of the bottle volume of the culture medium. This setting helps to fully ventilate and improve the efficiency of shaking). Place the culture medium on a shaker at 37°C and 220rpm for overnight culture (about 16 hours), and use a UV spectrophotometer to measure the OD value of the bacterial solution the next day to ensure that it reaches above 0.8.

[0086] 3. Glycerol preservation: Add part of the bacterial solution to glycerol to prepare a bacterial solution containing 25% glycerol and store it at -80℃.

[0087] 4. Induce expression: When the OD value of the bacterial solution reaches 1.0, add IPTG at a ratio of 1:1000 (i.e., the final concentration of IPTG is 1 μM), and continue to shake the bacteria at 220 rpm in a shaker for 4 hours to induce the expression of the target protein to obtain a recombinant bacterial solution.

[0088] 5. Collect the cells by centrifugation: Centrifuge the recombinant bacterial solution at 4°C and 2500 g for 10 min to collect the cells.

[0089] 6. Resuspend the bacteria: prepare the resuspending solution and add 4 times the volume of the bacteria in proportion, about 50mL, to fully resuspend the bacteria. The formula of the resuspending solution is as follows:

[0090] 5M NaCl: 15mL, 1M Tris-HCl: 1mL, 100×EDTA: 1mL, 100×PMSF: 1mL, 100×protease inhibitor (PI): 1mL, pure water: make up to 100mL.

[0091] 7. Ultrasonic disruption of bacteria: Place the resuspended liquid on ice and use an ultrasonic device to disrupt the cells. Set the ultrasonic device power to 60% intensity, turn on and off the ultrasound for 10 seconds at intervals, and continue the operation for 30 minutes. This condition parameter can effectively lyse the cells.

[0092] 8. Boiling: Boil the broken bacterial mixture in a water bath at 100°C for 10 minutes to inactivate enzymes and other impurity proteins and obtain denatured proteins.

[0093] 9. Collect supernatant protein by centrifugation: Centrifuge the boiled mixture at 20,000 g for 30 min at 4°C to remove precipitated proteins and collect the protein in the supernatant.

[0094] 10. Filtration: Use a syringe to carefully aspirate the supernatant and slowly filter it through a bacterial filter with a pore size of 0.22 μm to remove impurities to obtain a protein filtrate.

[0095] 11. Primary precipitation of ammonium sulfate precipitation: The ammonium sulfate (AS) precipitation method is an economical and efficient protein salting-out technology. By utilizing the high solubility of ammonium sulfate in water, it can effectively adsorb surrounding water molecules, thereby isolating proteins in the solution, breaking its balance in the liquid, and precipitating various proteins. This method is reversible and can redissolve α-synuclein after restoring the salt ion concentration. At the same time, the precipitation effect of α-synuclein can be optimized under fixed pH conditions by adjusting the ammonium sulfate concentration. The specific steps of the ammonium sulfate precipitation in this embodiment are: in 100mL of protein filtrate, first quickly stir and slowly add 50mL of 60% w / v ammonium sulfate (the preparation method of 60% w / v solution: weigh 30g of solid ammonium sulfate powder and dissolve it in 50mL of pure water. After fully stirring and mixing, place it at room temperature of 25°C for 24h to precipitate it, and transfer the supernatant to a clean centrifuge tube for later use.), so that the ammonium sulfate concentration in the solution reaches 18% w / v. After thorough mixing, the mixture was placed at 4°C for 2 h to precipitate foreign proteins. Next, the mixture was centrifuged at 12,000 g and 4°C for 10 min, the precipitate was removed, and the supernatant was collected (salting out).

[0096] 12. Secondary precipitation of ammonium sulfate precipitation: Continue to stir the supernatant rapidly at room temperature, and slowly add 60% w / v ammonium sulfate solution to make its concentration reach 27% w / v. When a large amount of white turbidity appears in the solution, it indicates that α-synuclein has been precipitated. At this time, centrifuge again at 12000g and 4℃ for 10 minutes, and you can see a large amount of white protein precipitate attached to the tube wall ( Figure 2 ) and collect the protein precipitate (secondary precipitation).

[0097] 13. Resuspension and centrifugation: Resuspend the collected protein precipitate with resuspension buffer, then centrifuge again at 20,000 g for 10 min at 4°C, and collect the final supernatant for subsequent steps.

[0098] 14. Acid precipitation: Add 1% (v / v) hydrochloric acid (HCl) to the supernatant to adjust the pH to 3 for acid precipitation. Then, centrifuge at 48,000 g for 30 min at 4°C and collect the supernatant.

[0099] 15. Alkali neutralization: Use 1 mM sodium hydroxide (NaOH) to adjust the pH of the supernatant to 7.5 to complete the neutralization and obtain the protein solution to be purified.

[0100] 3. Anion Exchange Chromatography

[0101] After inputting the protein sequence through the isoelectric point prediction software, it is predicted that the isoelectric point of human α-synuclein protein is 4.37, and the isoelectric point of mouse α-synuclein protein is 4.43. In the equilibrium solution with a pH value of 7.6, both proteins are negatively charged, so an anion column is selected to specifically adsorb negatively charged α-synuclein protein. A Bio-Rad chromatograph is used to provide pressure and control the NaCl concentration and speed during elution. In this example, anion exchange chromatography is performed on human α-synuclein protein.

[0102] According to the ion column information, the column volume (CV) is 1 ml, the maximum load is 64 mg protein, the maximum pressure is 70 bar, and the optimal flow rate is 1 mL / min. The program is set according to the ion column conditions: flow rate 1 mL / min, 10 CV column equilibration, 1 CV sample loading, 5 CV flow-through, 15 CV 50-1000 mM NaCl (A solution-B solution) to elute the target protein, 5 CV B solution to elute all proteins, 10 CV 20% ethanol to preserve the ion column.

[0103] 1. Solution preparation instructions:

[0104] 1.1) Protein diluent (10 mM Tris-HCl, pH 7.4): add 5 mL 1 M Tris-HCl to 500 mL with pure water.

[0105] 1.2) Solution A (10 mM Tris-HCl (pH 7.4) + 25 mM NaCl): 5 mL 1 M Tris-HCl, 2.5 mL 5 M NaCl, add pure water to 500 mL.

[0106] 1.3) Solution B (10 mM Tris-HCl (pH 7.4) + 1 M NaCl): 5 mL 1 M Tris-HCl, 100 mL 5 M NaCl, add pure water to 500 mL.

[0107] 1.4) 1M NaOH: Dissolve 40g NaOH in pure water and add to 1000mL. After preparation, filter and sterilize using a 0.22μm filter membrane.

[0108] 1.5) 20% ethanol solution: add pure water to 500 mL of 100 mL of pure ethanol.

[0109] 2. Anion exchange chromatography step

[0110] 2.1) Channel cleaning: Use 1M NaOH to clean the A and B pumps and L channel until the curve is stable (clean until the baseline is stable). Then use 20% ethanol to continue cleaning each channel until the curve is flat again.

[0111] 2.2) Column cleaning: After connecting the anion column, use 1M NaOH to clean the column using the A and B pumps and the Load channel for 4-5 column volumes respectively. Then, use 20% ethanol to clean the column in the same way for 4-5 column volumes to ensure that the column is thoroughly cleaned.

[0112] 2.3) Protein adsorption: The protein solution to be purified was diluted 10 times with 10 mM Tris, and then loaded onto the column using 100% A solution (buffer) through the Load channel. After all proteins were loaded onto the column, 4-5 column volumes of A solution were used to equilibrate the column to ensure column stability.

[0113] 2.4) Protein elution: Use different concentrations (0%, 15%, 33%, 100%) of B solution (containing NaCl) for protein elution. Initially start with 0% B solution (corresponding to NaCl concentration of 25mmol / L). Usually, the target protein can be eluted at a concentration of 33% B solution, and the protein peak is observed to increase significantly by monitoring the UV absorption curve ( Figure 3 ).

[0114] 2.5) Channel cleaning and column preservation: After eluting the target protein, use 100% solution B to thoroughly elute all protein and nucleic acid residues. Then wash the column with 1M NaOH, and finally preserve the column with 20% ethanol to ensure its cleanliness and stability.

[0115] Note: Each 1mL anion exchange column volume can adsorb approximately 60mg of protein.

[0116] 2.6) During elution, the proteins were collected in the order of elution peaks in 1.5 ml EP tubes. The target protein elution peak was visible at 330 mM NaCl concentration ( Figure 3 ), and collect them in two 1.5ml EP tubes respectively. Subsequently, SDS-PAGE electrophoresis was performed and stained with Coomassie Brilliant Blue to identify the protein and purity of each elution peak. SDS-PAGE electrophoresis uses an upper layer of concentrated gel and a lower layer of 15% separation gel. 5μL is loaded into each well, and electrophoresis is performed at 80V until Marker separation, then switched to 200V electrophoresis until bromophenol blue approaches the bottom. After taking out the polyacrylamide gel, soak it in transfer buffer, cut off the upper layer of concentrated gel and the blue bromophenol blue area, and then incubate with Coomassie Brilliant Blue Quick Staining Solution at room temperature for 20 minutes with slow shaking, decolorize with pure water for 1 hour, and then take pictures in a Bio-Rad developer and analyze the results. The results are as follows Figure 4 As shown, the protein solution is purified through multiple steps, including the supernatant after boiling and centrifugation, the supernatant after ammonium sulfate precipitation, resuspension after ammonium sulfate precipitation, resuspension to remove the precipitate, acid precipitation supernatant, and protein solution after anion column + ultrafiltration. It can be seen that after the protein is purified through these steps, the purity reaches 100%.

[0117] At the same time, 1 μL of the supernatant was mixed with 20 μL of 1× SDS loading buffer and subjected to Western Blot. Figure 5 As shown, anti-α-synuclein antibodies showed that human and mouse α-synuclein proteins were successfully expressed with a predicted molecular weight of 15 kd, indicating that no aggregates were formed.

[0118] 4. Ultrafiltration and concentration (impurity removal, protein concentration, solution replacement)

[0119] 1. Ultrafiltration tube pretreatment: Wet a 100kDa ultrafiltration tube with 10mM Tris (without salt ions); centrifuge at 3000g for 5 minutes, then pour out the wetting solution. Add the target protein eluted from the anion column to the 100kDa ultrafiltration tube. If the protein concentration is high, it can be diluted appropriately to ensure that the final concentration is maintained within a suitable range (recommended around 1mg / mL). Then centrifuge at 4°C and 3000g for 10 minutes, and collect the filtered liquid. Add the collected filtered liquid to a 50kDa ultrafiltration tube, centrifuge at 4°C and 4000g for 30 minutes, and further filter to remove impurities.

[0120] 2. Protein concentration and filtration: For samples with low protein concentration, a 3kDa ultrafiltration tube can be used for further concentration. In this embodiment, the total volume is reduced to increase the protein concentration in order to effectively remove the endotoxin particles with larger molecular weight and the remaining part of the macromolecular protein. The specific steps are as follows: the sample is placed in a 50kDa ultrafiltration tube and centrifuged at 4000g for 30min, the collected filtrate is transferred to a 3kDa ultrafiltration tube and centrifuged at 4000g for 30min for concentration, the supernatant is retained and transferred to a clean EP tube to obtain α-synuclein concentrated monomer.

[0121] 3. Purity verification: The purity of the sample can be verified by observing the changes in the fluorescence signal during the static incubation process. If no fluorescent fiber growth is seen, it means that the sample purity is high. If fluorescence occurs, it may be due to spontaneous aggregation of proteins caused by PFF contamination or excessive salt ion concentration. Usually, the molecular weight of the aggregate is greater than 100kDa, and these impurities can be removed by 50kDa and 30kDa ultrafiltration tubes. In addition, if the salt ion concentration is too high, desalination treatment can be performed through 10kDa or 3kDa ultrafiltration tubes to reduce the salt ion concentration. In this example, the Nanodrop2000 micro-ultraviolet spectrophotometer was used to evaluate the concentration and quality of the protein after ultrafiltration and concentration by analyzing the absorption peaks at 230, 260, and 280nm and their absorption spectrum curves. The results are shown in the figure. Figure 6 As shown. Figure 6 It can be seen that the ratio of 260nm / 280nm is about 0.61 and less than 0.70, indicating that the solution does not contain nucleic acid contamination.

[0122] At the same time, since the single sample loading volume of the molecular sieve column purification scheme shall not exceed 5% of the column volume (purification of 100 mg requires about 5h×5 times), the ammonium sulfate, acid precipitation and other schemes we provide have no restrictions on the sample loading volume of the protein solution, and the maximum yield can be achieved in a single time, that is, 100 mg requires about 1h×1 time, which can ultimately increase the yield of α-synuclein.

[0123] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for purifying label-free α-synuclein, characterized in that: The following steps are involved: (1) constructing a recombinant expression vector containing the α-synuclein gene; (2) transforming the recombinant expression vector into a host bacterium, inducing expression, and collecting the bacterium after centrifugation; (3) subjecting the bacterial cells to ultrasonic pulverization, boiling and centrifugation in sequence, and collecting the supernatant after centrifugation; (4) subjecting the supernatant to ammonium sulfate precipitation, centrifugation, acid precipitation and alkali neutralization in sequence to obtain a protein solution to be purified; the ammonium sulfate precipitation includes primary precipitation and secondary precipitation; (5) performing anion exchange chromatography, ultrafiltration filtration and concentration on the protein solution to be purified to obtain the label-free α-synuclein; the ultrafiltration filtration includes a first ultrafiltration filtration and a second ultrafiltration filtration.

2. The purification method according to claim 1, characterized in that In step (4), the primary precipitation comprises the steps of mixing the supernatant with a 60% w / v ammonium sulfate solution, sequentially standing and centrifuging, collecting the supernatant, and obtaining a protein solution; The secondary precipitation comprises the step of mixing the protein solution with a 60% w / v ammonium sulfate solution and then centrifuging to obtain a protein precipitate.

3. The purification method according to claim 2, characterized in that The mass volume fraction of ammonium sulfate in the mixed solution obtained by mixing the supernatant with a 60% w / v ammonium sulfate solution is 18%; The mass volume fraction of ammonium sulfate in the mixed solution obtained by mixing the protein solution with the 60% w / v ammonium sulfate solution is 27%.

4. The purification method according to claim 1, characterized in that In step (5), the first ultrafiltration comprises adding the target protein obtained by the anion exchange chromatography to a 100 kd ultrafiltration tube, centrifuging and filtering, collecting the filtrate, and obtaining a first filtrate; The second ultrafiltration comprises the steps of adding the first filtrate into a 50 kDa ultrafiltration tube, centrifuging and filtering, collecting the filtrate, and obtaining the second filtrate.

5. The purification method according to claim 1, characterized in that In step (4), the acid precipitation comprises the steps of mixing the supernatant obtained by centrifugation with hydrochloric acid, centrifuging the mixture, and collecting the supernatant obtained by centrifugation.

6. The purification method according to claim 1, characterized in that In step (5), the concentration includes adding the second filtrate to a 3 kDa ultrafiltration tube and then centrifuging and concentrating to obtain the unlabeled α-synuclein.

7. The purification method according to claim 1, characterized in that In step (3), the ultrasonic pulverization condition parameters are: 60% intensity; ultrasound is turned on for 10 seconds and off for 10 seconds, and the operation is continued for 30 minutes.

8. The purification method according to claim 1, characterized in that In step (3), the boiling temperature is 100° C. and the boiling time is 10 minutes.

9. The purification method according to claim 1, characterized in that In step (3), the centrifugation condition parameters are: 4°C, 20,000 g centrifugation for 30 min.

10. The purification method according to claim 1, characterized in that: In step (1), the base vector of the recombinant expression vector is pET-28a(+).

Images