Recombinant microorganism and application thereof in production of L-isoleucine

Abstract

The invention relates to the technical field of microorganisms, and particularly discloses a recombinant microorganism and application thereof in production of L-isoleucine. Compared with an original strain, the recombinant microorganism disclosed by the invention expresses a cimA mutant and an ilvIH mutant; the starting strain is escherichia coli or corynebacterium glutamicum; the amino acid sequence of the cimA mutant is as shown in SEQ ID No. 1; the nucleotide sequence of the ilvIH mutant is as shown in SEQ ID No. 5. The L-isoleucine can be produced by fermenting the recombinant microorganism provided by the invention.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, in particular to a recombinant microorganism and application thereof in producing L-isoleucine. Background Art

[0002] L-isoleucine is one of the eight essential amino acids. Because it has a branched methyl group, it is collectively referred to as a "branched chain amino acid" together with L-valine and L-leucine. As a supplement for synthesizing protein raw materials, L-isoleucine is an indispensable component in the physiological metabolism of animals and plants, and is widely used in medicine, feed, pharmaceuticals, food, etc. The market demand for L-isoleucine is expanding. At present, the main methods for industrial production of L-isoleucine are extraction and fermentation. The traditional chemical synthesis method has been eliminated due to complex reactions and low yields. The extraction method requires strong acid hydrolysis of animal and plant protein tissues, which is easy to cause environmental pollution. Compared with the extraction method, the fermentation method is widely used because of its advantages such as simple operation, low cost, environmental friendliness, and green sustainable development.

[0003] In microorganisms, L-isoleucine is converted from the intermediate metabolite of TCA cycle, oxaloacetate, to aspartate through transamination reaction, and aspartate is synthesized into the precursor substance L-threonine through 5 steps of enzyme catalysis. L-threonine is converted into 2-ketobutyrate by L-threonine dehydratase (encoded by ilvA), and L-isoleucine is synthesized from 2-ketobutyrate through 4 steps of enzyme reaction. The enzymes involved in the last 4 steps are acetohydroxyacid synthase (encoded by ilvIH), acetohydroxyacid isomeroreductase (encoded by ilvC), dihydroxydehydratase (encoded by ilvD), and branched-chain amino acid transaminase (encoded by ilvE). At present, the strategies for enhancing the synthesis of isoleucine mainly focus on enhancing the biotransformation process of precursor threonine and threonine to isoleucine. How to improve the synthesis of isoleucine still needs further research. Summary of the invention

[0004] One of the objects of the present invention is to provide a novel method for producing L-isoleucine by fermentation.

[0005] The present invention provides a recombinant microorganism, which, compared with a starting strain, expresses a cimA mutant and an ilvIH mutant, and overexpresses leuBCD; the starting strain is Escherichia coli or Corynebacterium glutamicum; the amino acid sequence of the cimA mutant is shown in SEQ ID No.1; and the nucleotide sequence of the ilvIH mutant is shown in SEQ ID No.5.

[0006] The present invention has conducted extensive research on how to increase the supply of metabolic precursor 2-ketobutyrate (a key precursor for the synthesis of isoleucine) in microorganisms and found that by introducing Methanocaldococcus jannaschii The invention provides a new method for producing L-isoleucine by introducing a citramalate synthase mutant (cimA) and an ilvIH mutant that relieve the feedback inhibition of L-isoleucine. Furthermore, the invention provides a new method for supplying 2-ketobutyrate, a precursor of L-isoleucine metabolism. By introducing an exogenous citramalate synthase (cimA, EC 2.3.1.182) mutant into a microorganism (such as Escherichia coli or Corynebacterium glutamicum), acetyl-CoA and pyruvate can be catalyzed to produce citramalate, and further citramalate can be converted into 2-ketobutyrate by expressing the leuBCD gene of the strain itself. The synthesis of 2-ketobutyrate by this method can bypass the complex metabolic regulation of the strain itself, improve the synthesis efficiency of 2-ketobutyrate, and improve the ratio of intracellular 2-ketobutyrate / pyruvate, thereby further increasing the isoleucine yield on the original basis.

[0007] Preferably, the recombinant microorganism of the present invention further overexpresses leuBCD compared to the starting strain, so as to better convert citramalate into 2-ketobutyrate.

[0008] More preferably, the recombinant microorganism of the present invention, while expressing a cimA mutant and an ilvIH mutant and overexpressing leuBCD, further overexpresses thrABC and expresses an ilvA mutant.

[0009] At this time, the recombinant microorganism can simultaneously synthesize 2-ketobutyrate and L-isoleucine through the threonine pathway and the citramalate synthase pathway, and the two pathways synergistically increase the production of L-isoleucine.

[0010] In the recombinant microorganism of the present invention, the nucleotide sequence of the cimA mutant is shown as SEQ ID No.2; the nucleotide sequence of the leuBCD is shown as SEQ ID No.3; and the nucleotide sequence of the thrABC is shown as SEQ ID No.31.

[0011] The present invention also provides the use of the recombinant microorganism in fermentation production of L-isoleucine, genetic breeding of microorganisms for producing L-isoleucine, or improving the yield of biologically synthesized L-isoleucine.

[0012] The present invention also provides a cimA mutant, whose amino acid sequence is shown in SEQ ID No.1.

[0013] The present invention also provides a DNA molecule, whose nucleotide sequence is shown as SEQ ID No. 2, 4 or 5.

[0014] The present invention also provides the use of the DNA molecule in constructing a recombinant microorganism, wherein the recombinant microorganism can produce L-isoleucine by fermentation, and the starting strain is Escherichia coli or Corynebacterium glutamicum.

[0015] The cimA mutant of the present invention can be used in combination with other genetic modifications to construct a new 2-ketobutyrate synthesis pathway in recombinant bacteria.

[0016] The present invention also provides a method for producing L-isoleucine by fermentation, which comprises the step of culturing the above-mentioned recombinant microorganism.

[0017] The present invention also provides a method for constructing a recombinant microorganism for producing L-isoleucine, which comprises the steps of making a starting strain express a cimA mutant and an ilvIH mutant, or further overexpressing leuBCD, or further overexpressing thrABC and expressing an ilvA mutant; the starting strain is Escherichia coli or Corynebacterium glutamicum; the amino acid sequence of the cimA mutant is shown in SEQ ID No.1; the nucleotide sequence of the ilvIH mutant is shown in SEQ ID No.5; the nucleotide sequence of the ilvA mutant is shown in SEQ ID No.4; the nucleotide sequence of the leuBCD is shown in SEQ ID No.3; and the nucleotide sequence of the thrABC is shown in SEQ ID No.31.

[0018] The beneficial effects of the present invention are at least: The present invention provides a novel method for producing 2-ketobutyrate and isoleucine in microorganisms, which bypasses the complex metabolic regulation of the threonine pathway and can significantly improve the production and yield of L-isoleucine when it coexists with the known L-isoleucine synthesis pathway (threonine pathway). DETAILED DESCRIPTION

[0019] The preferred embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that the following examples are provided only for the purpose of illustration and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0020] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are commercially available or prepared according to conventional methods in the art unless otherwise specified.

[0021] The specific implementation of the present invention includes: (1) constructing recombinant plasmids pBbA1K-cimA, pBbA1K-cimA-leuBCD, pTrc99a-ilvAIH, and pTrc99a-ilvIH; the amino acid sequence of cimA is shown in SEQ ID No.1, and the nucleotide sequence of cimA is shown in SEQ ID No.2; the leuBCD sequence is shown in SEQ ID No.3, the ilvA sequence is shown in SEQ ID No.4, and the ilvIH sequence is shown in SEQ ID No.5; (2) introducing the recombinant plasmid into Escherichia coli to construct an L-isoleucine production strain; (3) fermenting and culturing the above strains to detect the growth of the bacteria and the production of L-isoleucine. The feasible embodiments are as follows, but are not limited to the following examples.

[0022] Example 1 Construction of recombinant plasmids pBbA1K-cimA, pBbA1K-cimA-leuBCD, pTrc99a-ilvAIH, pTrc99a-ilvIH

[0023] This embodiment will Methanocaldococcus jannaschii The cimA mutant derived from Escherichia coli that relieves feedback inhibition by L-isoleucine (comprising the point mutation I47V-E114A-H126Q-T204G-L238S, the sequence is shown in SEQ ID No.1, and the nucleotide sequence is shown in SEQ ID No.2), the leuBCD derived from Escherichia coli (the sequence is shown in SEQ ID No.3), the ilvA mutant derived from Escherichia coli that relieves feedback inhibition by L-isoleucine (ilvA comprising the double point mutation F352A-R362F, the sequence is shown in SEQ ID No.4), and the ilvIH mutant derived from Escherichia coli that relieves feedback inhibition by L-isoleucine (ilvI comprising the double point mutation G41A-C50T, the ilvIH mutant sequence is shown in SEQ ID No.5) were constructed into a vector.

[0024] Specifically, the synthesized cimA gene was used as a template, and PCR was performed with cimA-F (tcttttaagaaggagatatacatatgatggtgcgcatttttgataccac, SEQ ID No.6) and cimA-R2 (ccttactcgagtttggatccTTAGTTCAGCAGCATGTTAATGCCTTCCAT, SEQ ID No.32) as primers to obtain a gene fragment of cimA of about 1500 bp and PCR products were purified. Plasmid pBbA1K (purchased from Addgene) was used as a template and primers pBbA1K-F (ggatccaaactcgagtaaggatctccaggca, SEQ ID No.10) and pBbA1K-R (atgtatatctccttcttaaaagatcttttgaattctga, SEQ ID No.11) were used for PCR to obtain a gene fragment pBbA1K of about 3500 bp and the PCR product was purified. The fragments cimA and pBbA1K were recombined using a recombination cloning kit (Vazyme, C115), and then introduced into the host Escherichia coli DH5α. The recombinant plasmid pBbA1K-cimA was obtained by screening and extraction.

[0025] Using the synthesized cimA gene as a template, PCR was performed with cimA-F (tcttttaagaaggagatatacatatgatggtgcgcatttttgataccac, SEQ ID No. 6) and cimA-R (TTAGTTCAGCAGCATGTTAATGCCTTCCATCAC, SEQ ID No. 7) as primers to obtain a gene fragment of cimA of about 1500 bp and PCR products were purified. Using the genome of Escherichia coli MG1655ATCC 700926 as a template, PCR was performed with primers leuB-F (aacatgctgctgaactaatttaagaaggagatatacatatgtcgaagaattaccatattgccgtat, SEQ ID No.8) and leuD-R (agatccttactcgagtttggatccttaattcataaacgcaggttgttttgcttcataag, SEQ ID No.9) to obtain a gene fragment leuBCD of about 3000 bp and the PCR product was purified. Plasmid pBbA1K (purchased from Addgene) was used as a template and primers pBbA1K-F (ggatccaaactcgagtaaggatctccaggca, SEQ ID No.10) and pBbA1K-R (atgtatatctccttcttaaaagatcttttgaattctga, SEQ ID No.11) were used for PCR to obtain a gene fragment pBbA1K of about 3500 bp and the PCR product was purified. The fragments cimA, leuBCD and pBbA1K were recombined using a recombination cloning kit (Vazyme, C115), and then introduced into the host Escherichia coli DH5α. The recombinant plasmid pBbA1K-cimA-leuBCD was obtained by screening and extraction.

[0026] Using the genome of Escherichia coli MG1655 as a template, PCR was performed with primers ilvA-F (ggataacaatttcacacaggaaacagaccatggctgactcgcaacccctgtccggtg, SEQ ID No.12) and ilvA(F352A)-R (ccgccaagcagttggcagaatttgagcgcgctgcctttttcttccggaatgg, SEQ ID No.13) to obtain a gene fragment ilvA-1 of about 1000 bp and PCR products were purified. PCR was performed using primers ilvA(R362F)-F (tcaaattctgccaactgcttggcgggttctcggtcaccgagttcaactaccgttt, SEQ ID No.14) and ilvA-R (acccgccaaaaagaacctgaacgccgggttattggtttcgtcgtggcaatcg, SEQ ID No.15) to obtain a gene fragment ilvA-2 of about 500 bp and PCR products were purified. Using the genome of Escherichia coli MG1655 as a template, PCR was performed with primers ilvI-F (cccggcgttcaggttctttttggcgggttagtttaagaaggagatatacatatggagatgttgtctggagccgaga, SEQ ID No.16) and ilvH(G41A,C50T)-R (ccaatcacgcggAataacgcgTctgattcattttcgagtaagactgat, SEQ ID No.17) to obtain a gene fragment ilvIH-1 of about 1800 bp and the PCR product was purified. PCR was performed with primers ilvH(G41A,C50T)-F (cagAcgcgttatTccgcgtgattggcctttttcccag, SEQ ID No.18) and ilvH-R (caggtcgactctagaggatcctcaacgcattattttatcgccgcgcga, SEQ ID No.19) to obtain a gene fragment of about 400 bp of ilvIH-2 and PCR products were purified. Plasmid pTrc99a was used as a template and primers pTrc99a-F (ggatcctctagagtcgacctgcaggcatgc, SEQ ID No.20) and pTrc99a-R (ggtctgtttcctgtgtgaaattgttatccg, SEQ ID No.21) were used to perform PCR to obtain a gene fragment of about 4000 bp of pTrc99a and PCR products were purified.The fragments ilvA-1, ilvA-2, ilvIH-1, ilvIH-2 and pTrc99a were recombined using a recombination cloning kit (Vazyme, C115), and then introduced into the host Escherichia coli DH5α. The recombinant plasmid pTrc99a-ilvAIH was obtained by screening and extraction.

[0027] Using the recombinant plasmid pTrc99a-ilvAIH as a template, PCR was performed with primers ilvI-F2 (taacaatttcacacaggaaacagaccatggagatgttgtctggagccgagatg, SEQ ID No.22) and ilvH-R (SEQ ID No.19) to obtain a gene fragment of about 2200 bp of ilvIH and PCR product purification. Using the plasmid pTrc99a as a template, PCR was performed with primers pTrc99a-F (SEQ ID No.20) and pTrc99a-R (SEQ ID No.21) to obtain a gene fragment of about 4000 bp of pTrc99a and PCR product purification. The fragments ilvIH and pTrc99a were recombined using a recombinant cloning kit (Vazyme, C115), and then introduced into the host Escherichia coli DH5α, and the recombinant plasmid pTrc99a-ilvIH was obtained by screening and extraction.

[0028] Example 2 Construction of an engineered bacterium producing L-isoleucine

[0029] Using the genome of Escherichia coli MG1655 as a template, PCR was performed with primers tdh-UP-F (ttcctgctttgatgctaacggtggcct, SEQ ID No.23) and tdh-UP-R (gcattatacgagccggatgattaattgtcaaagtcccgcagatggctgttttac, SEQ ID No.24) to obtain a gene fragment of about 1000 bp of tdh-UP and PCR products were purified. Using the genome of Escherichia coli MG1655 as a template, PCR was performed with primers tdh-DOWN-F (gatgatgaatcatcagtaacacgaacaagggctggtattcca, SEQ ID No.25) and tdh-DOWN-R (ggcataatttcgatttaatttctc, SEQ ID No.26) to obtain a gene fragment of about 1000 bp of tdh-DOWN and PCR products were purified. Using the genome of Escherichia coli MG1655 as a template, PCR was performed with primers thrABC-F (atccggctcgtataatgcacacaggaaacagaccatgcgagtgttgaagttcggcggta, SEQ ID No.27) and thrABC-R (tggaataccagcccttgttcgtgttactgatgattcatcatcaatttac, SEQ ID No.28) to obtain a gene fragment of thrABC of about 1000 bp and the PCR product was purified.

[0030] The fragments tdh-UP, tdh-DOWN, and thrABC were subjected to overlapping PCR to obtain the targeting fragment. The plasmid pTarget (Jiang, Y., Chen, B., Duan, CL, Sun, BB, Yang, JJ, and Yang, S. (2015)Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Appl Environ Microbiol 81: 2506–2514. Jiang, et al. 2015) was used as a template and primers tdh-N20-F (tcgtctgatatgtctatcgacgttttagagctagaaatagcaagttaaaat, SEQ ID No.29) and tdh-N20-R (gtcgatagacatatcagacgactagtattatacctaggactgagctag, SEQ ID No.30) were used for amplification to obtain pTarget-tdh. The targeting fragment was electroporated into Escherichia coli MG1655 using an electroporator (Bio-Rad). The electroporation conditions were 2.5 KV, 200 Ω, and 25 μF (the width of the electroporation cup was 2 mm). The recombinant bacteria that could produce threonine were screened and named E.coil-△tdh::Ptrc-thrABC.

[0031] The recombinant plasmids pTrc99a-ilvAIH and pBbA1K prepared in Example 1 were transformed into E.coil-△tdh::Ptrc-thrABC by electroporation (conditions as above), and the obtained recombinant strain was named E.coil-△tdh::Ptrc-thrABC / ilvAIH. The recombinant strain can synthesize L-isoleucine through the threonine pathway, but does not contain the citramalate synthase pathway.

[0032] The recombinant plasmids pTrc99a-ilvIH and pBbA1K-cimA-leuBCD prepared in Example 1 were transferred into E.coil-MG1655 by electrotransformation (conditions as above), and the obtained recombinant strains were named E.coil-MG1655 / ilvIH-cimA-BCD. The recombinant plasmids pTrc99a-ilvIH and pBbA1K-cimA were transferred into E.coil-MG1655 by electrotransformation (conditions as above), and the obtained recombinant strains were named E.coil-MG1655 / ilvIH-cimA. Since these two recombinant strains did not overexpress the key genes thrABC in the threonine synthesis pathway and ilvA that relieves the feedback inhibition of L-isoleucine, they could only synthesize 2-ketobutyrate and L-isoleucine through the citramalate synthase pathway. The recombinant plasmids pTrc99a-ilvIH and pBbA1K were transformed into E.coil-MG1655 by electroporation (conditions as above), and the obtained recombinant strain was named E.coil-MG1655 / ilvIH. This strain served as a control group and only overexpressed the ilvIH gene, and could not effectively synthesize 2-ketobutyrate.

[0033] The recombinant plasmids pTrc99a-ilvAIH and pBbA1K-cimA-leuBCD prepared in Example 1 were transformed into E.coil-△tdh::Ptrc-thrABC by electroporation (conditions as above), and the obtained recombinant strain was named E.coil-△tdh::Ptrc-thrABC / ilvAIH-cimA. The recombinant strain can synthesize 2-ketobutyrate and L-isoleucine through the threonine pathway and the citramalate synthase pathway at the same time.

[0034] Example 3 Fermentation and production of L-isoleucine by recombinant Escherichia coli

[0035] The recombinant strains E.coil-MG1655 / ilvIH, E.coil-MG1655 / ilvIH-cimA, E.coil-MG1655 / ilvIH-cimA-BCD, E.coil-Δtdh::Ptrc-thrABC / ilvAIH and E.coil-Δtdh::Ptrc-thrABC / ilvAIH-cimA prepared in Example 2 were cultured overnight on LB plates. A single colony from the fresh plate was inoculated into a test tube containing 5 ml of LB medium and cultured at 37°C, 200 rpm for 12 hours.

[0036] Inoculate 5% of the inoculum into a 500 ml baffled shake flask containing 50 ml of fermentation medium and culture at 37°C and 200 rpm until OD 600was 0.6, 0.1 mM IPTG was added and cultured for 48 h.

[0037] Each liter of fermentation medium includes: 20g of glucose, 0.8g of magnesium sulfate heptahydrate, 4g of diammonium hydrogen phosphate, 6.67g of potassium dihydrogen phosphate, 1.35g of potassium citrate, 20.9g of 3-morpholinepropanesulfonic acid, 2.5g of yeast powder, 50mg of ferrous sulfate heptahydrate, 10mg of calcium chloride dihydrate, 11mg of zinc sulfate heptahydrate, 2.5mg of manganese sulfate tetrahydrate, 5mg of copper sulfate pentahydrate, 0.5mg of ammonium molybdate, and 0.1mg of sodium borate decahydrate.

[0038] During the fermentation process, the product concentration and the growth of the strain were detected by liquid chromatography, and the results are shown in Tables 1 and 2. As can be seen from Tables 1 and 2, the control strain E.coil-MG1655 / ilvIH cannot synthesize isoleucine, but after introducing cimA (strain E.coil-MG1655 / ilvIH-cimA) or cimA-leuBCD (strain E.coil-MG1655 / ilvIH-cimA-BCD) into this strain, L-isoleucine can be synthesized only through the citramalate synthase pathway. At the same time, after further introducing cimA-leuBCD into the strain E.coil-△tdh::Ptrc-thrABC / ilvAIH that retains the natural threonine and isoleucine synthesis pathways of E.coil (strain E.coil-△tdh::Ptrc-thrABC / ilvAIH-cimA), the yield and production efficiency of L-isoleucine can also be significantly improved.

[0039] Table 1 Growth of different strains (OD 600 )

[0040] Table 2 L-isoleucine production of different strains (g / L)

[0041] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements may be made thereto based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A recombinant microorganism, It is characterized in that The recombinant microorganism expresses a cimA mutant and an ilvIH mutant compared to the starting strain; the starting strain is Escherichia coli or Corynebacterium glutamicum; The amino acid sequence of the cimA mutant is shown in SEQ ID No.1; the nucleotide sequence of the ilvIH mutant is shown in SEQ ID No.

5.

2. The recombinant microorganism according to claim 1, It is characterized in that The recombinant microorganism further overexpresses leuBCD compared to the starting strain.

3. The recombinant microorganism according to claim 2, It is characterized in that Compared with the starting strain, the recombinant microorganism further overexpresses thrABC and expresses an ilvA mutant; the nucleotide sequence of the ilvA mutant is shown in SEQ ID No.

4.

4. The recombinant microorganism according to claim 3, It is characterized in that The nucleotide sequence of the cimA mutant is shown in SEQ ID No. 2; The nucleotide sequence of leuBCD is shown in SEQ ID No. 3; The nucleotide sequence of thrABC is shown in SEQ ID No.

31.

5. Use of the recombinant microorganism according to any one of claims 1 to 4 in the fermentation production of L-isoleucine, in the genetic breeding of microorganisms for producing L-isoleucine, or in increasing the yield of biosynthesized L-isoleucine.

6. A cimA mutant, It is characterized in that The amino acid sequence is shown in SEQ ID No.

1.

7. A DNA molecule, It is characterized in that The nucleotide sequence is shown as SEQ ID No. 2, 4 or 5.

8. Use of the DNA molecule according to claim 7 in constructing a recombinant microorganism capable of fermenting and producing L-isoleucine, wherein the starting strain is Escherichia coli or Corynebacterium glutamicum.

9. A method for producing L-isoleucine by fermentation, It is characterized in that The method comprises the step of culturing the recombinant microorganism according to any one of claims 1 to 4.

10. A method for constructing a recombinant microorganism for producing L-isoleucine, It is characterized in that The invention comprises the steps of making the starting strain express a cimA mutant and an ilvIH mutant, or further overexpressing leuBCD, or further overexpressing thrABC and expressing an ilvA mutant; the starting strain is Escherichia coli or Corynebacterium glutamicum; the amino acid sequence of the cimA mutant is shown in SEQ ID No.1; the nucleotide sequence of the ilvIH mutant is shown in SEQ ID No.5; the nucleotide sequence of the ilvA mutant is shown in SEQ ID No.4; the nucleotide sequence of leuBCD is shown in SEQ ID No.3; and the nucleotide sequence of thrABC is shown in SEQ ID No.31.

Images