Threose ribozyme Tz2 with RNA cleavage activity and application of threose ribozyme Tz2

Abstract

The invention discloses threose ribozyme Tz2 with RNA (Ribonucleic Acid) cleavage activity and application of the threose ribozyme Tz2. Belongs to the technical field of biological medicine, the threose ribozyme Tz2 can specifically recognize and rapidly cut an RNA substrate in a reaction buffer solution containing magnesium ions, after the threose ribozyme Tz2 is delivered into cells, target genes of lung cancer cells containing drug-resistant mutation can be silenced, the lung cancer cells containing the drug-resistant mutation can be selectively killed, and the lung cancer cells containing the drug-resistant mutation can be used for treating lung cancer diseases. The killing effect on the lung cancer cells without mutation is relatively weak. In addition, as a non-natural nucleic acid, the threose ribozyme Tz2 can resist the degradation of nuclease and has excellent biological stability. The threose ribozyme Tz2 has good specificity, catalytic activity and substrate universality, and can be used as an effective gene silencing molecular tool to resist non-small cell lung cancer drug resistance.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and relates to a method for preparing a threonucleoside ribozyme Tz2 with RNA cleavage activity and its application in gene silencing, and in particular, relates to a threonucleoside ribozyme with higher cleavage activity, substrate versatility and gene silencing ability obtained by mutation, and the threonucleoside ribozyme is applied to selectively silence EGFR with drug-resistant mutations in lung cancer cells. Background Art

[0002] Non-small cell lung cancer is the main type of lung cancer, and its mortality and morbidity rates rank first in the cancer list. Epidermal growth factor receptor (EGFR) is a receptor kinase on the cell membrane, which is overexpressed on the surface of non-small cell lung cancer cells, thereby driving cancer cell proliferation. EGFR tyrosine kinase inhibitors, targeted anticancer drugs for lung cancer, can bind to EGFR, inhibit kinase activity, and achieve therapeutic effects. However, most patients with non-small cell lung cancer will develop drug resistance after using targeted drugs. The main reason for drug resistance is that a single-point C→U mutation occurs in the patient's EGFR exon 20 transcript, resulting in the mutation of threonine (T) at exon 790 of the EGFR protein to methionine (M).

[0003] RNA is a messenger that transfers genetic information from DNA to protein. It also plays an important physiological role such as gene expression regulation. Cutting the mRNA encoding EGFR can achieve silencing of the EGFR gene. Ribozymes and deoxyribozymes can accelerate a variety of chemical reactions, such as RNA cleavage reactions, by folding to form a catalytically active spatial structure. Therefore, some (deoxy)ribozymes can catalyze the breakage of target gene mRNA, thereby achieving gene silencing. Compared with proteins, (deoxy)ribozymes are easy to chemically synthesize and modify on a large scale, simple to design, and easy to store, and are potential gene silencing tool molecules. However, some natural (deoxy)ribozymes with DNA or RNA skeletons discovered so far have obvious shortcomings, which limit their further application. First, natural ribozymes usually require metal ions at concentrations far higher than physiological concentrations to function; in addition, natural ribozymes have poor biological stability and are difficult to complete a long-term continuous effect; finally, natural ribozymes are difficult to bind to mRNA substrates with complex secondary structures.

[0004] Threonose nucleic acid (TNA) is a non-natural nucleic acid composed of a four-carbon sugar ring that can form a stable pair with RNA. Since TNA can resist degradation by nucleases, TNA has excellent biological stability. In the early stage, TNA enzyme (threonuclease) Tz1, which can catalyze RNA cleavage reactions, has been obtained through in vitro screening. This enzyme can specifically cut transcripts containing EGFRT790M drug-resistant mutations to achieve gene silencing effects without cutting wild-type transcripts. However, there is still a lot of room for optimization of the gene silencing effect of Tz1 in cells, and the substrate versatility of Tz1 as a tool molecule also needs to be further optimized. Summary of the invention

[0005] In view of the above problems, the present invention aims to obtain a threonucleozyme Tz2 with significantly improved catalytic activity and substrate versatility through optimization to address the shortcomings of the original threonucleozyme, and to apply it to selectively silence EGFR with drug-resistant mutations in lung cancer cells.

[0006] The technical solution of the present invention is: a method for preparing a threonuclease Tz2 having RNA cleavage activity according to the present invention, wherein the preparation steps are as follows:

[0007] Step (1): preparing variants in which 14 non-conserved sites in the family of threonuclease Tz1 are mutated one by one to other three bases through a TNA primer extension reaction;

[0008] Step (2): testing the cleavage activity of the above single point mutation variants on RNA substrates, and screening out variants with higher activity than the wild-type threonuclease Tz1;

[0009] Step (3): performing combined multi-point mutations on the mutation sites with improved catalytic activity obtained by screening;

[0010] Step (4): Test the cleavage activity of the above-mentioned combined multi-point mutation variants on RNA substrates, screen out the variant with the highest activity, that is, obtain the sequence of the threonucleozyme Tz2, and then perform a large amount of TNA primer extension reaction to prepare a large amount of threonucleozyme Tz2.

[0011] Furthermore, the threonucleozyme Tz2 obtained by combining multiple mutations of A3C, T22A, and G28C in the original threonucleozyme Tz1 was 2+ The catalytic rate is twice that of the threonucleolytic enzyme Tz1.

[0012] Furthermore, the length of the threonucleoside ribozyme Tz2 is 20-1000 nt.

[0013] Furthermore, the threonucleozyme Tz2 is a sequence containing seq1 or having more than 80% homology to the seq1 sequence: the homologous sequence includes a sequence obtained by adding bases, reducing bases, or replacing any one or several bases on the basis of seq1:

[0014] seq1 is AGGGCATGAG AAGTCTTATTGGTGGATGAAGC GATGAGTTGC .

[0015] Furthermore, the threonose ribozyme also includes a sequence in which the underlined sequence in seq1 is replaced by any other sequence.

[0016] Furthermore, a threonucleolytic ribozyme Tz2 with RNA cleavage activity is prepared and used.

[0017] Furthermore, the application specifically includes:

[0018] Application (1): The threonucleolytic enzyme Tz2 can cleave four different physiologically significant RNA model sequences;

[0019] Application (2): Threonine ribozyme Tz2 can cleave long RNA substrates including the 20th exon transcript of EGFR and part of the open reading frame of EGFR;

[0020] Application (3): The threonucleoside ribozyme Tz2 can selectively knock down EGFR in cells with drug-resistant mutations, causing cytotoxicity and apoptosis.

[0021] Furthermore, by applying the substrate universality test in (1), it was identified that the activity of the threonucleozyme Tz2 remained essentially unchanged after the binding arms on both sides were replaced with any other sequence; the threonucleozyme Tz2 variants were used to target the model transcripts corresponding to the NIPBL, YWHAQ, ALK and PIK3CA targets, and they were able to specifically recognize and cleave the substrates.

[0022] Furthermore, in application (2), for the EGFR exon 20 transcript and the EGFR partial open reading frame long substrate sequence, the threonuclease Tz2 was active even in the presence of physiological concentrations of Mg 2+ In buffer, it can also cleave mutant substrates with high activity and specificity.

[0023] Furthermore, in application (3), the threonucleoside ribozyme Tz2 can knock down EGFR in lung cancer cells containing drug-resistant mutations;

[0024] The threonucleoside ribozyme Tz2 selectively causes significant apoptosis in lung cancer cells containing drug-resistant mutations.

[0025] The beneficial effects of the present invention are as follows: the threonucleozyme of the present invention has excellent biological stability and lower divalent metal ion dependence compared with the existing deoxyribozyme (such as 10-23); the threonucleozyme of the present invention has better biological stability and lower divalent metal ion dependence compared with the original threonucleozyme Tz1 at 20mM and 2mM Mg 2+ The catalytic rate of the threonase was about twice that of Tz1, and the recognition ability of the mutant substrate was retained. Through the substrate universality test, it was identified that after the binding arms on both sides of the threonase were partially replaced with any other sequence, its activity remained basically unchanged. The threonase variant was used to target 4 different mRNA models with physiological significance, and it was able to specifically recognize and cleave the substrate. For the long-fragment substrate sequences of EGFR exon 20 (186nt) and part of the EGFR transcript (1000nt), the threonase was able to specifically recognize and cleave the substrate even at physiological concentrations of Mg. 2+ The threonose ribozyme can also cleave mutant substrates with high activity and specificity; the threonose ribozyme can effectively knock down the EGFR of lung cancer cells containing drug-resistant mutations, while having no effect or little effect on the EGFR of wild-type lung cancer cells; the threonose ribozyme can selectively cause significant cell apoptosis in lung cancer cells containing drug-resistant mutations, while having a weaker effect on wild-type lung cancer cells; this invention provides a molecular tool with good application prospects in the field of biomedical technology, especially in gene silencing-mediated tumor treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a schematic diagram of the results of obtaining a more active threonucleozyme Tz2 by point mutation of Tz1 in an embodiment of the present invention;

[0027] Figure 2 This is a schematic diagram of the results of biochemical characterization of threonucleoside ribozyme Tz2 in an embodiment of the present invention;

[0028] Figure 3 Schematic diagram of the substrate universality test results of the threonucleozyme Tz2 in the embodiment of the present invention;

[0029] Figure 4 This is a schematic diagram of the test results of using threonucleoside ribozyme Tz2 for specific gene silencing in cells in an embodiment of the present invention;

[0030] Figure 5 It is a schematic diagram of the specific toxicity test results of threonucleoside ribozyme Tz2 on H1975 cells and A549 cells in the examples of the present invention. DETAILED DESCRIPTION

[0031] The specific technical solutions of the present invention are further described in detail below in conjunction with specific examples.

[0032] The preparation method of the threonuclease Tz2 with RNA cleavage activity described in the present invention is obtained as follows:

[0033] Based on the original threonucleoside ribozyme Tz1, a series of non-conservative sites were mutated to obtain threonucleoside ribozyme Tz2 with higher activity and substrate universality, and its catalytic activity was tested.

[0034] That is: 1. Through the primer extension reaction of TNA, the variants are prepared by mutating the 14 non-conserved sites in the family of threonuclease Tz1 into the other three bases one by one;

[0035] Second: testing the cleavage activity of the above single point mutation variants on RNA substrates, and screening out variants with higher activity than wild-type Tz1;

[0036] 3. Combining multiple mutations on the mutation sites with improved catalytic activity obtained by screening;

[0037] Fourth, testing the cleavage activity of the variants after the above combination of multiple mutations on RNA substrates, and screening out the variant with the highest activity, which is the threonucleozyme Tz2;

[0038] The results showed that the threonucleozyme Tz2 obtained by combining multiple mutations of A3C, T22A and G28C in the original threonucleozyme Tz1 had a strong 2+ The catalytic rate in is about twice that of the threonucleolytic ribozyme Tz1;

[0039] The threonucleozyme Tz2 can be prepared by directly performing a TNA primer extension reaction according to the sequence of the threonucleozyme Tz2 obtained after screening in step 4;

[0040] (2): The binding arm of Tz2 was replaced with other sequences, and some nucleotides near the cleavage site were mutated. Tz2 was identified as a threonucleozyme that catalyzes RNA cleavage with good substrate versatility. Tz2 was applied to the model transcripts corresponding to the NIPBL, YWHAQ, ALK and PIK3CA targets to verify that Tz2 can effectively cleave them;

[0041] (3): Tz2 can cleave long RNA substrates including the EGFR exon 20 transcript (186 nt) and part of the EGFR open reading frame (1000 nt);

[0042] (4): Tz2 was used to selectively knock down EGFR in cells with drug-resistant mutations, causing cytotoxicity and apoptosis.

[0043] Furthermore, the length of the threonucleoside ribozyme Tz2 is 20-1000 nm;

[0044] The threonucleozyme Tz2 is a sequence containing seq1 or having more than 80% homology to the seq1 sequence: the homologous sequence includes a sequence obtained by adding bases, reducing bases, or replacing any one or several bases on the basis of seq1:

[0045] seq1 is

[0046] 5'- AGGGCATGAG AAGTCTTATTGGTGGATGAAGC GATGAGTTGC -3'.

[0047] Furthermore, the threonose ribozyme Tz2 also includes a sequence in which the underlined portion of seq1 is replaced with any other sequence, and a threonose ribozyme comprising the 42 nt partial sequence.

[0048] Further, specifically: in order to improve the catalytic activity and substrate versatility of the original threonucleolytic ribozyme Tz1, a series of non-conserved sites were selected for single / combination mutations based on the sequencing results of the family to which Tz1 belongs after in vitro screening, and the variant with the highest catalytic activity was identified, which was named Tz2;

[0049] Furthermore, the preparation method of the threonucleoside ribozyme Tz1 is as follows:

[0050] 1. Mix the DNA primer, the corresponding DNA template, and 1× ThermolPol buffer, incubate the mixture at 98°C for 5 min, and then cool it down to 4°C (10°C per minute for 10 min) for annealing;

[0051] 2. Pre-incubate Kod-RSGA polymerase with MnCl2 for 15 min; then add the mixture of Kod-RSGA polymerase and MnCl2 into the system, and then add tNTPs into the system;

[0052] 3. Incubate the reaction system at 55°C for more than 4 hours to complete the primer extension reaction;

[0053] 4. Purify the product chain with DNA primer by ethanol precipitation and denaturing PAGE; quantify it by Nanodrop 2000 after desalting;

[0054] 5. To remove the DNA primer, snake venom phosphodiesterase I (SVPE) was used to incubate the product strand in SVPE buffer at 37°C;

[0055] 6. Purify the product by ultrafiltration and denaturing polyacrylamide gel electrophoresis (PAGE), and quantify it by Nanodrop2000 after desalting.

[0056] Furthermore, the activity test of the threonuclease Tz2 is carried out as follows:

[0057] 1. Mix the threonucleozyme with the corresponding mutant RNA substrate or wild-type RNA substrate in a reaction buffer, incubate the mixture at 37°C for a certain period of time, then terminate the reaction with a reaction stop buffer, and analyze the results using 12% denaturing PAGE;

[0058] 2. In order to quantitatively describe the catalytic activity and mutation site recognition ability of Tz2, the yields of the above reactions at different times were tested, the functional relationship between reaction time and cleavage yield was fitted, and the apparent first-order rate constant k was calculated. obs .

[0059] Furthermore, an application of threonucleoside ribozyme Tz2 having RNA cleavage activity.

[0060] Furthermore, the application specifically includes:

[0061] Application (1): The threonucleolytic enzyme Tz2 can cleave four different physiologically significant RNA model sequences;

[0062] Application (2): Threonine ribozyme Tz2 can cleave long RNA substrates including the 20th exon transcript of EGFR and part of the open reading frame of EGFR;

[0063] Application (3): The threonucleoside ribozyme Tz2 can selectively knock down EGFR in cells with drug-resistant mutations, causing cytotoxicity and apoptosis.

[0064] Furthermore, by applying the substrate universality test in (1), it was determined that the activity of the threonucleozyme Tz2 remained essentially unchanged after the binding arms on both sides were replaced with any other sequence; the threonucleozyme Tz2 variants were used to target the model transcripts corresponding to the NIPBL, YWHAQ, ALK and PIK3CA targets, and they were able to specifically recognize and cleave the substrates;

[0065] By using the aforementioned primer extension method, Tz2 variants with conversion (A to T, G to C; A to C, G to T) or transversion (A to G, T to C) of the binding arms on both sides were prepared, and the reaction results of these Tz2 variants to their corresponding substrates were determined by a similar activity test method. It was identified that the binding arms on both sides of Tz2 are universal, and its cleavage activity is not greatly affected after replacing its binding arm sequence with any sequence;

[0066] The cleavage activity of Tz2 on these mutant substrates was tested after the six nucleotides near the cleavage site in the substrate were mutated to three other natural bases, and the results were determined by a similar activity test method. It was identified that the A-3, U-2 and G+3 sites of its substrates can be mutated to other bases to a certain extent, and the catalytic activity of Tz2 is not affected;

[0067] Tz2 targeting specific regions of the transcripts of NIPBL, YWHAQ, ALK, and PIK3CA were prepared by primer extension, and the responses and k values ​​of these Tz2 variants to their respective substrates were determined by analytical methods. obs ; Tz2 variants were identified that could cleave the mRNA substrates of these four targets.

[0068] Furthermore, in application (2), for the EGFR exon 20 transcript and the EGFR partial open reading frame long substrate sequence, the threonuclease Tz2 was active even in the presence of physiological concentrations of Mg 2+ In buffer, it can also cleave mutant substrates with high activity and specificity;

[0069] To obtain the 186nt EGFR exon 20 transcript, total RNA was extracted from human non-small cell lung cancer cells H1975 and A549, and cDNA was obtained by reverse transcription. The cDNA fragment of EGFR exon 20 was amplified, and the antisense chain was separated and recovered using streptavidin-coated resin. The antisense chain was used as a template and Cy5.5-labeled RNA was used as a primer to obtain the fluorescently labeled EGFR exon 20 transcript through a primer extension reaction catalyzed by an engineered TGK polymerase. The DNA template was degraded with DNase I, and the product chain was purified by 10% denaturing PAGE.

[0070] The cleavage activity of Tz2 on EGFR exon 20 transcripts containing mutation sites or wild-type was determined by analytical methods; it was identified that Tz2 can cleave EGFR exon 20 transcripts containing mutation sites with higher activity, but not on wild-type;

[0071] To obtain a 1000 nt partial EGFR transcript, after obtaining cDNA by a method similar to the above, a 1 kb EGFR cDNA fragment was amplified by PCR; then the DNA template, NTPs, and T7 RNA polymerase were mixed using the T7 High Yield Transcription Kit; after incubation at 37°C for 2 h, DNase I was added to the reaction system and incubated at 37°C for 15 min to digest the DNA template, and RNA products containing mutation sites or wild-type were obtained after purification;

[0072] The cleavage activity of Tz2 on a 1000nt partial EGFR transcript containing a mutation site or the wild type was determined by an analytical method; it was identified that Tz2 was able to cleave a 1000nt partial EGFR transcript containing a mutation site with higher activity, while having poor cleavage activity on the wild type transcript.

[0073] Furthermore, in application (3), the threonucleoside ribozyme Tz2 can knock down EGFR in lung cancer cells containing drug-resistant mutations; the threonucleoside ribozyme Tz2 can selectively cause significant cell apoptosis in lung cancer cells containing drug-resistant mutations;

[0074] First, Tz2 was transfected into H1975 and A549 cells and cultured at 37°C for 24 h. Total RNA was collected and real-time fluorescence quantitative PCR (qPCR) was used to measure the intracellular EGFR mRNA level.

[0075] After Tz2 was transfected into the two cells, they were cultured at 37°C for 48 h, the total protein of the cells was collected, and the expression of EGFR protein in the treated cells was detected by Western blot;

[0076] Its performance is as follows: After Tz2 treatment of H1975 cells, the mRNA level and protein level of EGFR in the cells decreased significantly; while after Tz2 treatment of A549 cells, the mRNA level and protein level of EGFR in the cells were not affected or were slightly affected;

[0077] After Tz2 was transfected into both cells, they were cultured at 37°C for 48 h, and the cells were collected and stained using the Annexin V-FITC / PI double staining method, and apoptosis analysis was performed using flow cytometry;

[0078] Its performance is as follows: Tz2 can selectively cause significant apoptosis in H1975 cells containing drug-resistant mutations, while only causing weak apoptosis in A549 cells without drug-resistant mutations.

[0079] Example 1

[0080] like Figure 1 As shown, the process of obtaining the threonucleozyme Tz2 with the highest catalytic activity by single-point or combined mutation of non-conserved sites in the Tz1 family sequence is as follows:

[0081] 1. To obtain each Tz1 mutant, first prepare the primer extension system: 1 mM DNA primer, 1 mM DNA template, 1×ThermolPol buffer (20 mM Tris-HCl, 10 mM (NH4)2SO4, 10 mM KCl, 2 mM MgSO4, 0.1% TritonX-100, pH 8.8), 0.2 mM MnCl2, 100 mM tNTP, 1 mg / ml Kod-RSGA polymerase;

[0082] The experimental process is as follows: DNA primers, corresponding DNA templates, and 1×ThermolPol buffer are mixed, the mixture is incubated at 98°C for 5 minutes, and then the temperature is gradually reduced to 4°C (10°C per minute, a total of 10 minutes) for annealing; Kod-RSGA polymerase is pre-incubated with MnCl2 for more than 15 minutes; then the mixture of Kod-RSGA polymerase and MnCl2 is added to the system, and then tNTPs are added to the system; the reaction system is incubated at 55°C for 4 hours to complete the primer extension reaction; then the product chain with DNA primers is obtained by ethanol precipitation and denaturing PAGE purification.

[0083] 2. To remove the DNA primer, snake venom phosphodiesterase I (SVPE) was used to incubate the product chain in SVPE buffer (40 mM Tris-HCl, 10 mM MgCl2, pH 8.4) at 37°C for more than 16 h, and the product was purified by ultrafiltration and denaturing PAGE;

[0084] 3. Mix 0.5 mM of the different Tz1 mutants obtained above, 0.1 mM substrate and reaction buffer (50 mM Tris-HCl, 154 mM NaCl, 20 mM MgCl2, pH 7.5). After mixing, incubate the system at 37°C for 1 h. Then add 2 volumes of stop buffer (5 mM Tris-HCl, 8 M urea, 20 mM EDTA) to terminate the reaction, and use 12% denaturing PAGE to analyze the results;

[0085] 4. Calculate the reaction yield based on the grayscale values ​​of the product and substrate bands to compare the cleavage activity of each Tz1 mutant;

[0086] 5. Finally, it was determined that the Tz1 variant with A3C, T22A, and G28C mutations had the highest cleavage activity at 20 mM mg 2+ The catalytic rate in was about twice that of Tz1, and it was named Tz2.

[0087] Example 2

[0088] like Figure 2As shown in the figure, the process of using threonucleolytic enzyme Tz2 to recognize and cleave mutant substrates is as follows:

[0089] 1. In a reaction buffer (50 mM Tris-HCl, 154 mM NaCl, 20 mM MgCl2, pH 7.5) containing 20 mM MgCl2, the cleavage yields of 0.5 μM Tz2, Tz1 and the classical deoxyribozyme 10-23 (Dz) on substrates containing single-site mutations and wild-type substrates without mutations (0.1 μM) were compared. The reactions were incubated at 37°C for 1 h and the results were analyzed by 12% denaturing PAGE.

[0090] The results showed that both Tz2 and Tz1 could specifically cleave the mutant substrates, but not the wild-type substrates, and the cleavage activity of Tz2 was significantly improved compared with the parent Tz1. Under the same conditions, no cleavage products of the classic DNAzyme 10-23 were observed for the two substrates;

[0091] 2. In order to more quantitatively compare the catalytic activity and recognition ability of Tz2 and Tz1 for single-site mutations, the apparent first-order rate constants (k) of Tz2 and Tz1 at 37°C were tested and compared in 20 mM reaction buffer under single-turnover conditions (enzyme in excess compared to substrate). obs ); the final concentrations of enzyme and substrate were 0.5mM and 0.1mM, respectively. At different times (Tz2: 0, 5, 10, 15, 30, 45, 60, 90, 120, 180, 240min; Tz1: 0, 5, 10, 15, 30, 45, 60, 120, 180, 240, 360min), the results were analyzed by 12% denaturing PAGE; Prism Graphpad was used to plot and fit the functional relationship between reaction time and cleavage yield, and k was calculated. obs . The k of each mutant substrate obs Divided by its k for the wild-type substrate obs , the ratio is defined as the selectivity.

[0092] The results showed that the selectivity of Tz2 was 29, while that of Tz1 was 70. However, the k of Tz2 catalyzing the cleavage of the mutant substrate was obs 1.60h -1 , is k obs 0.84h -1 Therefore, compared with Tz1 and classical DNAzymes 10-23, Tz2 has higher catalytic activity while still retaining the ability to effectively recognize single-site mutations in short RNA substrates.

[0093] Example 3

[0094] Gene silencing of lung cancer cells containing drug-resistant mutations using the threonuclease Tz2:

[0095] 1. First, the gene silencing effect of the threonucleoside ribozyme was evaluated by real-time fluorescence quantitative PCR. 170 pmol of TNAzyme or 50 pmol of siRNA was mixed with 45 μl of Opti-MEM and incubated for 5 min. Meanwhile, 4.9 μl of Lipofectamine 3000 was mixed with 45 μl of Opti-MEM and incubated for 5 min. Then, the TNAzyme or siRNA dilution was mixed with the Lipofectamine 3000 dilution and incubated for 15 min. The mixture was added to A549 and H1975 cell cultures containing 400 μl of complete medium and incubated at 37°C for 24 h.

[0096] 2. Total RNA was extracted using a total RNA extraction kit. 1 mg of total RNA was mixed with 4×gDNA wiper mix and incubated at 42°C for 2 min, followed by addition of 5×HiScript III RT SuperMix for qPCR and incubation at 42°C for 15 min, and finally heated at 85°C for 5 s to terminate the reaction; then, cDNA was analyzed by quantitative PCR (qPCR) using ChamQ SYBR Color qPCR Master Mix;

[0097] The preparation system included 1 μl cDNA template, 0.5 mM upstream PCR primer, downstream PCR primer and 2× Master Mix. Then, the PCR reaction was started using the StepOnePlus instrument. At the same time, β-actin was amplified. After 40 rounds of PCR reaction, the Ct values ​​of the three groups of repeated samples were measured, and the relative copy number of EGFR mRNA in each experimental group was calculated. The results are shown in Figure 5 shown.

[0098] The results showed that compared with the group to which only the transfection reagent was added, the amount of EGFR mRNA containing mutations in H1975 cells was reduced to 61.6%, with a knockdown effect comparable to that of 100nM siRNA; whereas in A549 cells, the amount of wild-type EGFR mRNA was only reduced to 80.1%. In contrast, the amount of EGFR mRNA in H1975 cells treated with Tz1 was only reduced to 76%, while there was no reduction at all after treatment with the classical deoxyribozyme 10-23. These results indicate that, at the transcript level, Tz2 can mediate the cleavage of mutant EGFR mRNA in H1975 cells with a higher efficiency than Tz1 and the classical deoxyribozyme 10-23 (Dz), and its activity is similar to that of siRNA, while its cleavage activity against wild-type EGFR mRNA in A549 is lower;

[0099] 2. Subsequently, Western blot was used to evaluate the gene silencing effect of the threonucleoside ribozyme Tz2; after a transfection step similar to that described above in this example, the cells were incubated at 37°C for 48 h; the cells were lysed using RIPA lysis buffer, and the total protein was extracted and quantified; 100 mg of the protein was loaded on SDS-PAGE and separated by electrophoresis; the protein was then transferred from the gel to a PVDF membrane for immunoblotting. When immunoblotting EGFR, EGFR antibody (EP38Y, abcam, ab52894, 1:1000 dilution) was used as the primary antibody, and anti-rabbit IgG antibody conjugated with DyLight 800 (Cell Signaling, no.5151, 1:10000 dilution) was used as the secondary antibody; when immunoblotting β-actin, β-actin antibody (2D4H5, Proteintech, 1:5000 dilution) was used, and anti-mouse IgG antibody conjugated with DyLight 800 (Cell Signaling, no.5257, 1:10000 dilution) was used as the secondary antibody; SoftMaxPro v.7.1 software was used to analyze the blot images; the results are shown in the figure;

[0100] The results showed that for H1975 cells containing drug-resistant mutations, Tz2 caused a 43% knockdown of the target protein EGFR, and its knockdown effect even exceeded that of the gold standard siRNA. In contrast, the knockdown effects caused by the classic ribozymes 10-23 (Dz) and Tz1 were poor. For A549 cells that did not contain drug-resistant mutations, Tz2 only caused a 25% knockdown, while the gold standard siRNA also caused a strong knockdown of A549 cells indiscriminately. Therefore, at the protein level, it was verified that Tz2 can specifically knock down the EGFR protein in the H1975 cell line containing drug-resistant mutations, while the knockdown effect on the EGFR protein in wild-type A549 cells is weak, with good specificity.

[0101] Example 4

[0102] Using threonucleoside ribozyme Tz2 to kill lung cancer cells containing drug-resistant mutations:

[0103] Cells were seeded into 96-well plates containing 100 μl of culture medium and cultured overnight. Cells were treated with 0 nM, 30 nM, 60 nM, 120 nM, 240 nM, and 480 nM of Tz2 or an inactive TNA control group for 48 h. Then, 10 μl of CellCounting Kit-8 was added to each well and incubated at 37 °C for 2 h. Finally, the absorbance was measured at 450 nm using a SpectraMax iD3 microplate reader to determine cell proliferation.

[0104] The results showed that Tz2 can kill H1975 and A549 cells in a concentration-dependent manner due to cell killing caused by knocking down EGFR. However, Tz2 has a stronger killing effect on H1975 cells containing drug-resistant mutations, while its killing effect on wild-type A549 cells is relatively weak. This shows that Tz2 can selectively kill lung cancer cells containing drug-resistant mutations.

Claims

1. A method for preparing a threonucleolytic enzyme Tz2 having RNA cleavage activity, characterized in that: The preparation steps are as follows: Step (1): preparing variants in which 14 non-conserved sites in the family of threonuclease Tz1 are mutated one by one to other three bases through a TNA primer extension reaction; Step (2): testing the cleavage activity of the above single point mutation variants on RNA substrates, and screening out variants with higher activity than the wild-type threonuclease Tz1; Step (3): performing combined multi-point mutations on the mutation sites with improved catalytic activity obtained by screening; Step (4): testing the cleavage activity of the above-mentioned variants after multiple mutations on RNA substrates, screening out the variant with the highest activity, that is, obtaining the sequence of threonucleozyme Tz2, and then performing TNA primer extension reaction to obtain threonucleozyme Tz2.

2. The method for preparing a threonucleozyme Tz2 having RNA cleavage activity according to claim 1, characterized in that: The threonucleozyme Tz2 was obtained by combining multiple mutations of A3C, T22A, and G28C in the original threonucleozyme Tz1. 2+ The catalytic rate is twice that of the threonucleolytic enzyme Tz1.

3. The method for preparing a threonucleozyme Tz2 having RNA cleavage activity according to claim 1, characterized in that: The length of the threonoribozyme Tz2 is 20-1000 nt.

4. The method for preparing a threonucleozyme Tz2 having RNA cleavage activity according to claim 1, characterized in that: The threonucleozyme Tz2 is a sequence containing seq1 or having more than 80% homology to the seq1 sequence: the homologous sequence includes a sequence obtained by adding bases, reducing bases, or replacing any one or several bases on the basis of seq1: seq1 is AGGGCATGAG AAGTCTTATTGGTGGATGAAGC GATGAGTTGC .

5. The method for preparing a threonucleozyme Tz2 having RNA cleavage activity according to claim 1, characterized in that: The threonose ribozyme also includes a sequence in which the underlined sequence in seq1 is replaced by any other sequence.

6. Use of a threonucleozyme Tz2 having RNA cleavage activity prepared by the preparation method according to any one of claims 1 to 5.

7. The use according to claim 6, characterized in that: Specifically include: Application (1): The threonucleolytic enzyme Tz2 can cleave four different physiologically significant RNA model sequences; Application (2): Threonine ribozyme Tz2 can cleave long RNA substrates including the 20th exon transcript of EGFR and part of the open reading frame of EGFR; Application (3): The threonucleoside ribozyme Tz2 can selectively knock down EGFR in cells with drug-resistant mutations, causing cytotoxicity and apoptosis.

8. The use according to claim 6, characterized in that: By applying the substrate universality test in (1), it was identified that the activity of the threonucleozyme Tz2 remained essentially unchanged after the binding arms on both sides were replaced with any other sequence; the threonucleozyme Tz2 variants were used to target the model transcripts corresponding to the NIPBL, YWHAQ, ALK and PIK3CA targets, and they were able to specifically recognize and cleave the substrates.

9. The use according to claim 6, characterized in that: In application (2), for the EGFR exon 20 transcript and the EGFR partial open reading frame long substrate sequence, the threonuclease Tz2 was active even in the presence of physiological concentrations of Mg 2+ In buffer, it can also cleave mutant substrates with high activity and specificity.

10. The use according to claim 6, characterized in that: In application (3), the threonucleoside ribozyme Tz2 can knock down EGFR in lung cancer cells containing drug-resistant mutations; The threonucleoside ribozyme Tz2 selectively causes significant apoptosis in lung cancer cells containing drug-resistant mutations.

Images