Rice CRK1 protein and application of coding gene thereof

Abstract

According to the rice CRK1 protein and the application of the coding gene thereof, overexpression and CRISPR (clustered regularly interspaced short palindromic repeats) knockout technologies are respectively adopted for performing overexpression or knockout mutation on the rice CRK1 gene in rice, according to phenotypic changes of transgenic rice plants, it is found that overexpression of the CRK1 gene in the rice can remarkably improve the high-temperature and low-temperature resistance of the rice, and therefore, the rice CRK1 protein can be used for improving the high-temperature and low-temperature resistance of the rice. The rice CRK1 protein and the coding gene thereof can be used for improving the temperature stress resistance of plants, and the method comprises the following steps: adjusting the pore opening of plant leaves under a temperature stress condition; the water loss rate of the plant under the temperature stress condition is adjusted; meanwhile, the high-temperature resistance and low-temperature dual abiotic stress resistance of the plants are improved; and cultivating a plant variety with high-temperature resistance and low-temperature resistance dual abiotic stress capability at the same time. The method has application prospects in the aspects of improving and enhancing rice stress resistance, accelerating the stress-resistant molecular breeding process and the like.

Description

Technical Field

[0001] The invention belongs to the field of rice molecular breeding, and in particular relates to the application of rice CRK1 protein and its encoding gene. Background Art

[0002] Rice is one of the three most important food crops in the world. Its output accounts for about 40% of my country's total grain output and is the main source of food for the Chinese people. Maintaining and increasing rice production plays a vital role in ensuring national food security and national economic development.

[0003] During the growth and development of plants, extreme climate will have an adverse effect on them, resulting in a decrease in crop yields. As a colonizing organism, rice plants cannot avoid temperature stress from the external environment by changing their position. Under high and low temperatures, plants will maintain a high moisture state in the leaves by reducing leaf area and closing stomata. High and low temperatures are one of the important abiotic stress factors. By exploring and analyzing the key genes of temperature tolerance and their molecular regulatory mechanisms, it has important theoretical guidance and practical significance for the breeding of crop varieties that are both resistant to high and low temperatures.

[0004] Ca 2+ As an important second messenger, it is an indispensable initial signal molecule for plants to trigger heat stress response and cold stress response. 2+ The signal change is recognized and sensed by specific sensors / receptors, which interact with Ca 2+ Binding will change the structure of its own protein, thereby promoting its interaction with the target protein or enhancing its enzyme activity, further stimulating downstream transcription and metabolic reactions. 2+ -dependent protein kinase, including some CDPK-related kinases (CRKs), are important Ca-dependent kinases that have been identified in plants. 2+ One of the signal sensors. Although Ca 2+ The involvement of CRK1 and its channels in regulating temperature stress responses has been widely studied, but the molecular mechanism by which CRK1 co-regulates high and low temperature stress responses and whether this function is related to stomatal movement under temperature stress have not been clearly studied. Summary of the invention

[0005] The main purpose of the present invention is to provide a rice CRK1 protein or its encoding gene for use in improving plant resistance to high and low temperatures. At the same time, overexpression of the rice gene CRK1 can also simultaneously improve the heat and cold resistance of rice seedlings, which is beneficial to the genetic improvement of rice resistance to temperature stress.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions.

[0007] In a first aspect, the present invention provides a nucleic acid encoding a rice CRK1 protein. The nucleic acid encodes a rice CRK1 protein. The rice CRK1 protein comprises an amino acid sequence as shown in SEQ ID NO:3.

[0008] Furthermore, the nucleic acid comprises the nucleotide sequence shown in SEQ ID NO: 1 or a degenerate sequence thereof.

[0009] Furthermore, the nucleic acid comprises the nucleotide sequence shown in SEQ ID NO: 2 or a degenerate sequence thereof.

[0010] Second aspect

[0011] The present invention provides an application of rice CRK1 protein or a gene encoding rice CRK1 protein, wherein the application is one or more of the following:

[0012] A) Regulate the stomatal aperture of plant leaves under temperature stress conditions;

[0013] B) Regulate the water loss rate of plants under temperature stress conditions;

[0014] C) Simultaneously improve the plant's ability to tolerate both high and low temperature abiotic stresses;

[0015] D) Cultivate plant varieties that have dual abiotic stress tolerance of high temperature and low temperature.

[0016] Further, the A) is specifically,

[0017] Overexpression of the rice CRK1 gene in plants induces closure of leaf stomata under temperature stress conditions.

[0018] Reducing the expression of the rice CRK1 gene in plants reduces the closing speed of leaf stomata of plants under temperature stress conditions.

[0019] Further, the B) is specifically,

[0020] Overexpression of the rice CRK1 gene in plants reduces the water loss rate of plants under temperature stress conditions,

[0021] Reducing the expression of the rice CRK1 gene in plants increases the water loss rate of the plants under temperature stress conditions.

[0022] Furthermore, the temperature stress is high temperature or low temperature; the high temperature is 48°C, and the low temperature is 6°C.

[0023] Further, the C) is specifically,

[0024] Overexpression of the rice CRK1 gene in plants improves the plants' resistance to high temperatures and low temperatures.

[0025] Reducing the expression of the rice CRK1 gene in plants reduces the plants' resistance to high and low temperatures.

[0026] Furthermore, the CDS sequence of the gene encoding CRK1 is shown as SEQ ID NO.1, and the nucleotide sequence of the gene encoding the rice CRK1 protein is shown as SEQ ID NO.2.

[0027] Furthermore, the amino acid sequence of the rice CRK1 protein is shown in SEQ ID NO.3.

[0028] Furthermore, the overexpression of the rice CRK1 gene comprises the following steps:

[0029] (1) constructing a recombinant overexpression vector containing the CDS of the rice CRK1 gene;

[0030] (2) Transforming the recombinant overexpression vector into plant tissues or plant cells.

[0031] Furthermore, the reducing the expression of the rice CRK1 gene comprises the following steps:

[0032] (1) constructing a recombinant expression vector containing the mutant of the rice CRK1 gene;

[0033] (2) Transforming the recombinant expression vector into plant tissues or plant cells.

[0034] Furthermore, the mutant is obtained through CRISPR gene editing technology.

[0035] Furthermore, the types of the mutants include gene knockout, base mutation, base insertion or base deletion.

[0036] Furthermore, the mutant is that target 1 lacks 5bp at the position 403bp to 407bp away from the start codon, and target 2 inserts 1bp at the position 501bp away from the start codon, resulting in a premature termination codon at the 184aa position of its protein sequence.

[0037] Furthermore, the mutant has multiple bases inserted and deleted between target 1 and target 2, resulting in a premature termination codon at position 184aa of its protein sequence.

[0038] Compared with the prior art, the present invention has the following technical effects:

[0039] The present invention proves for the first time that overexpression of rice CRK1 gene can significantly induce stomatal closure of rice under high temperature and low temperature stress, and can also significantly reduce water loss rate under high temperature and low temperature stress. Therefore, rice CRK1 protein and its encoding gene and recombinant vector can be used to enhance the ability of crops to withstand high temperature and low temperature dual stress, providing a new resource for rice stress resistance breeding.

[0040] Definitions of terms used in this invention

[0041] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0042] The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides or ribonucleotides and polymers thereof in single-stranded or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides, which have binding properties similar to reference nucleic acids and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically limited, the term also means oligonucleotide analogs, which include PNA (peptide nucleic acid), DNA analogs used in antisense technology (phosphorothioate, phosphoramidate, etc.). Unless otherwise specified, a specific nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (including but not limited to degenerate codon substitutions) and complementary sequences as well as explicitly specified sequences. In particular, degenerate codon substitutions can be achieved by generating a sequence in which the 3rd position of one or more selected (or all) codons is substituted with mixed bases and / or deoxyinosine residues.

[0043] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to polymers of amino acid residues. That is, descriptions directed to polypeptides are equally applicable to describing peptides and describing proteins, and vice versa. The terms apply to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally encoded amino acids. As used herein, the terms encompass amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are linked via covalent peptide bonds.

[0044] The term "recombinant host cell strain" or "host cell" means a cell comprising a polynucleotide of the present invention, regardless of the method used for insertion to produce a recombinant host cell, such as direct uptake, transduction, mating, or other methods known in the art. The exogenous polynucleotide may be maintained as a non-integrating vector such as a plasmid or may be integrated into the host genome. The host cell may be a prokaryotic cell or a eukaryotic cell, and the host cell may also be a monocotyledonous or dicotyledonous plant cell.

[0045] The term "transformation" as used herein refers to genetically transforming a polynucleotide or polypeptide into a plant by introducing a coding gene into a plant cell. Methods for introducing the polynucleotide or polypeptide into a plant are well known in the art, including but not limited to stable transformation methods, transient transformation methods, and virus-mediated methods.

[0046] The term "pore opening" as used herein refers to the ratio of pore width to pore length.

[0047] The term "water loss rate" in the present invention refers to the ratio of plant weight loss before and after heat / cold treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 The knockout status of each rice CRK1 gene strain.

[0049] Figure 2 The transgenic plants were positively identified by PCR for overexpression material.

[0050] Figure 3 The expression levels of various strains of rice CRK1 gene overexpression materials.

[0051] Figure 4 The stomatal opening of CRK1-overexpressing, CRISPR-knockout transgenic plants and wild-type plants under 48℃ and 6℃ treatments. A is the statistical results of stomatal opening of crk1-1 mutants after treatment at 48℃ (0h, 1h, 6h and 12h). B is the statistical results of stomatal opening of crk1-1 mutants after treatment at 6℃ (0h, 1h, 3h, 9h and 12h). C is the statistical results of stomatal opening after CRK1 overexpression at 48℃ (0h, 0.5h, 1h and 6h). D is the statistical results of stomatal opening after CRK1 overexpression at 6℃ (0h, 0.5h, 1h and 6h).

[0052] Figure 5 The water loss rate of overexpressed CRK1, CRISPR knockout transgenic plants and wild-type plants under 48℃ and 6℃ treatment was monitored. A is the statistical results of water loss rate of crk1-1 mutant after treatment at 48℃ (0h, 1h, 3h, 6h, 12h, 24h, 48h, 60h and 72h). B is the statistical results of water loss rate of crk1-1 mutant after treatment at 6℃ (0h, 1h, 3h, 6h, 12h, 24h, 48h, 60h and 72h). C is the statistical results of water loss rate after overexpression of CRK1 at 48℃ (0h, 1h, 3h, 6h, 12h, 24h, 48h, 72h and 96h). D is the statistical results of water loss rate after overexpression of CRK1 at 6℃ (0h, 1h, 3h, 6h, 12h, 24h, 48h, 72h and 96h).

[0053] Figure 6The heat tolerance phenotypes of overexpressed CRK1, CRISPR knockout transgenic plants and wild-type plants at the seedling stage under 48℃ treatment. A is the phenotypic picture of crk1-1 and crk1-2 mutants treated at 48℃ for 40h and recovered for 7d. B is the statistical results of the survival rate of crk1-1 and crk1-2 mutants after 48℃ treatment. C is the phenotypic picture of overexpressed CRK1 treated at 48℃ for 72h and recovered for 7d. D is the statistical results of the survival rate of overexpressed CRK1 after 48℃ treatment.

[0054] Figure 7 The cold tolerance phenotypes of overexpressed CRK1, CRISPR knockout transgenic plants and wild-type plants at the seedling stage under 6℃ treatment. A is the phenotypic picture of crk1-1 and crk1-2 mutants treated at 6℃ for 72h and recovered for 7d. B is the statistical results of the survival rate of crk1-1 and crk1-2 mutants after 6℃ treatment. C is the phenotypic picture of overexpressed CRK1 treated at 6℃ for 96h and recovered for 7d. D is the statistical results of the survival rate of overexpressed CRK1 after 6℃ treatment. DETAILED DESCRIPTION

[0055] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0056] Example 1 Genetic transformation experiment of CRK1 gene in rice

[0057] 1. Construction of CRK1 gene overexpression vector

[0058] Firstly, the Gateway method was used to construct the intermediate pDONR221 and the final pHpt-PSAT-N through BP and LR reactions, and then linearized and recovered.

[0059] Primers were designed based on the full-length sequence of Nipponbare, and the full-length gene coding region of CRK1 protein was amplified using Nipponbare cDNA as a template. The linearized linkers of pDONR221 vector were added to the 5′ and 3′ ends. The amplification primers were:

[0060] Table 1 CRK1 gene primers

[0061]

[0062] PCR amplification and recovery of the target DNA fragment (1803 bp). The target fragment was connected to the overexpression vector pHpt-PSAT-N by BP and LR reactions using the Gateway method. The positive clone plasmid was verified by PCR and sequencing. The sequencing results showed that the CRK1 gene fragment shown in SEQ ID NO.1 was inserted into the vector pHpt-PSAT-N, and the recombinant vector was named pHpt-PSAT-CRK1.

[0063] 2. Construction of CRISPR knockout vector for CRK1 gene

[0064] The target site for knockout was designed based on the cDNA sequence of the CRK1 gene. The website used was: http: / / www.genome.arizona.edu / crispr / CRISPRsearch.html. The information of the designed target site is as follows: Figure 1 shown.

[0065] Mutation type 1 (crk1-1) target 1 lacks 5 bp at the position 403bp to 407bp away from the start codon, and target 2 has 1 bp inserted at the position 501bp away from the start codon, resulting in a premature termination codon at the 184aa position of its protein sequence.

[0066] Mutation type 2 (crk1-2) involves the insertion and deletion of multiple bases between target 1 and target 2, resulting in a premature termination codon at position 184aa in its protein sequence.

[0067] Target site 1 sequence: 5'-CGCTGGACAAGGGCTT-3' (SEQ ID NO.6)

[0068] Target site 2 sequence: 5'-CTGCGCCGCCACCTGCAAGA-3' (SEQ ID NO. 7).

[0069] Primers CRK1T1T2-BsF, CRK1T1T2-F0, CRK1T1T2-R0 and CRK1T1T2-BsR were designed according to the target site, and four-primer PCR amplification was performed using the 100-fold diluted pCBC-MT1T2 plasmid as a template. The PCR product was purified and recovered, and the final vector was constructed using the enzyme digestion-ligation system, and the vector was named CRISPR-CRK1.

[0070] Table 2 CRK1 gene target primers

[0071]

[0072] After screening, mutants crk1-1 and crk1-2 were obtained.

[0073] 3. Agrobacterium Transformation

[0074] The expression vector pHpt-PSAT-CRK1 and the knockout vector CRISPR-CRK1 were transferred into Agrobacterium EHA105 competent cells (the competent cells were purchased from Shanghai Bioengineering Company) by freeze-thaw method. The specific experimental methods refer to the molecular cloning experimental guide.

[0075] The following overexpression and mutant strain primers are used for subsequent material identification to determine whether they are homozygous. The identification primers used are as follows. The identification results are as follows: Figure 2 As shown, the primers for hygromycin were used, and the primers were Hyg + -F:CTGCCCGCTGTTCTACAACCGG,Hyg + -R: GGAGCATATACGCCCGGAGTC, wherein lanes 1-12 are for identification of overexpressed materials, lane 13 is a negative control, and lane 14 is a negative control for added double distilled water.

[0076] Table 3 Primers for identification of CRK1 overexpressing plants

[0077] Primer name Primer sequence 5'-3' Hyg-F CTGCCCGCTGTTCTACAACCGG(SEQ ID NO.12) Hyg-R GGAGCATATACGCCCGGAGTC(SEQ ID NO.13)

[0078] Table 4 Primers for identification of CRK1 mutant plants

[0079] Primer name Primer sequence 5'→3' CRK1-T1-F TCGAGCTACAAGGGCTCG(SEQ ID NO.14) CRK1-T1-R TAGCGTTTACACCTGATTGA(SEQ ID NO.15) CRK1-T2-F CTGATACCAGCATTGTTTAG(SEQ ID NO.16) CRK1-T2-R CATCGTACAACATGCTTAG(SEQ ID NO.17)

[0080] 4. qRT-PCR expression identification

[0081] After the NIP wild-type and CRK1 overexpressing transgenic rice plants grew into seedlings, qRT-PCR was performed to identify each line. A small amount of transgenic rice leaves were taken and total RNA was extracted according to the Trizol method of Invitrogen Company and converted into cDNA.

[0082] Design of CRK1 gene qRT-PCR specific primers:

[0083] Table 5 qRT-PCR primers for CRK1 overexpression plants

[0084] Primer name Primer sequence 5'-3' CRK1-RT-F ATGGGTCTCTGTCATGGC(SEQ ID NO.18) CRK1-RT-R GTCGAGCTACAAGAGCTCGC(SEQ ID NO.19)

[0085] Using the expression of rice actin rRNA as an internal reference, qRT-PCR verification was performed on transgenic lines CRK1-OE#1, CRK1-OE#2, CRK1-OE#3, CRK1-OE#4, and CRK1-OE#5 according to the operating instructions of Roche Fast Start Universal SYBRGreen Master (ROX). The verification results are shown in Figure 3As shown, the expression levels of CRK1 in the four CRK1 overexpression lines OE#2, OE#3, OE#4 and OE#5 were all increased compared with the NIP wild type.

[0086] Example 2 Identification of stress resistance of CRK1 overexpressing plants and CRISPR knockout mutant plants

[0087] 1. Growth conditions

[0088] (1) Select T3 generation CRK1 overexpressing transgenic wild-type Nipponbare seeds.

[0089] (2) Rice soil culture: After the newly harvested seeds break dormancy, soak them in a 28℃ incubator for 3 days until they germinate and then sow them. Select seeds with consistent germination and sow them evenly in a mixed soil prepared with a ratio of nutrient soil to vermiculite of 3:1. Cover the surface with a layer of vermiculite and grow them normally in a 28℃ incubator. Water them once every 2-3 days.

[0090] (3) Rice hydroponics: Seeds with uniform germination were selected and sown on a 96-well PCR plate with the bottom removed. The plate was placed in a 28°C incubator for growth. The water was changed every 2-3 days. When the third leaf was just emerging, an appropriate amount of nutrient solution was added. After the third leaf was fully expanded, the solution was replaced with clean water.

[0091] (4) The sterilized rice seeds were germinated at room temperature and then sown. Each experimental group was set up with at least 3 replicates. After culturing at 28°C for 2 weeks under the above conditions, they were heat treated at 48°C for 2-3 days and cold treated at 6°C for 2-4 days (depending on the actual situation), and then transferred to 28°C to resume growth for 7 days.

[0092] 2. For the measurement of stomatal aperture, the mutant and wild-type plants were treated with high and low temperatures; the second leaves of the plants were selected (3-4 leaves were taken each time), nail polish was applied to the surface of the leaves to fix the stomatal shape, and the colloid was air-dried and condensed into a thin film, and then the film was torn off with clean tweezers; a glass slide was made for subsequent microscopic observation, and photographed and preserved; finally, the width and length of the stomatal guard cells were measured using the software ImageJ, and the width / length value was calculated to calculate the stomatal aperture. The experimental results are as follows Figure 4 As shown, according to Figure 4 C and 4D show that overexpression of the rice CRK1 gene in rice can significantly induce stomatal closure under high and low temperature stress.

[0093] 3. For the measurement of water loss rate, set at least three biological replicates for each temperature treatment time point, and select at least three rice seedlings grown to the three-leaf stage, put them in a 50mL EP tube, add an equal amount of water and wait for subsequent treatment; before the plants are treated, wipe off the excess water on the plants with a test paper, weigh their weight, and record it as m1; treat the plants with high or low temperature, take out the plants at each set time point, wipe off the excess water on the plants with a test paper, weigh their weight, and record it as m2; use the formula: (m1-m2) / m1 to calculate the plant's living water loss rate, and use a line graph to record the changes. The test results are as follows: Figure 5 As shown, according to Figure 5 C and 5D show that overexpression of the rice CRK1 gene in rice can significantly reduce the water loss rate under high and low temperature stress.

[0094] 4. For the survival rate of heat stress resistance in the seedling stage, the judgment standard of this study is whether new leaves grow. If there are new leaves, the plant is considered alive, otherwise, it is judged as dead. Figure 6 As shown, according to Figure 6 D shows that overexpressing the rice CRK1 gene in rice can significantly improve the rice's ability to resist high temperature stress.

[0095] 5. For the survival rate of seedlings resistant to cold stress, the criterion of this study is whether new leaves grow. If there are new leaves, the plant is considered alive, otherwise, it is considered dead. Figure 7 As shown, according to Figure 7 D shows that overexpression of the rice CRK1 gene in rice can significantly improve the rice's ability to resist low temperature stress.

[0096] Therefore, rice CRK1 protein, its encoding gene and recombinant vector can be used to enhance the dual stress resistance of crops.

[0097] Unless otherwise specifically stated, the numerical value set forth in these embodiments does not limit the scope of the present invention. In all examples shown and described here, unless otherwise specified, any specific value should be interpreted as merely exemplary, rather than as restriction, and therefore, other examples of exemplary embodiments may have different values.

Claims

1. A nucleic acid encoding a rice CRK1 protein, characterized in that: The nucleic acid encodes a rice CRK1 protein, and the rice CRK1 protein comprises an amino acid sequence as shown in SEQ ID NO:

3.

2. The nucleic acid according to claim 1, characterized in that The nucleic acid comprises the nucleotide sequence shown in SEQ ID NO: 1 or a degenerate sequence thereof.

3. The nucleic acid according to claim 1, characterized in that The nucleic acid comprises the nucleotide sequence shown in SEQ ID NO: 2 or a degenerate sequence thereof.

4. Use of rice CRK1 protein or its encoding nucleic acid, characterized in that: The application is one or more of the following, A) Regulate the stomatal aperture of plant leaves under temperature stress conditions; B) Regulate the water loss rate of plants under temperature stress conditions; C) Simultaneously improve the plant's ability to tolerate both high and low temperature abiotic stresses; D) Cultivate plant varieties that have dual abiotic stress tolerance of high temperature and low temperature.

5. The use according to claim 4, characterized in that: The A) is specifically: Overexpression of the rice CRK1 gene in plants induces closure of leaf stomata under temperature stress conditions. Reducing the expression of the rice CRK1 gene in plants reduces the closing speed of leaf stomata of plants under temperature stress conditions.

6. The use according to claim 4, characterized in that: Specifically, B) is: Overexpression of the rice CRK1 gene in plants reduces the water loss rate of plants under temperature stress conditions, Reducing the expression of the rice CRK1 gene in plants increases the water loss rate of the plants under temperature stress conditions.

7. The use according to claim 4, characterized in that: Specifically, C) is: Overexpression of the rice CRK1 gene in plants improves the high temperature and low temperature resistance of the plants. Reducing the expression of the rice CRK1 gene in plants reduces the high temperature and low temperature tolerance of the plants.

8. The use according to any one of claims 1 to 7, characterized in that: The overexpression of rice CRK1 gene comprises the following steps: (1) constructing a recombinant overexpression vector containing the CDS of the rice CRK1 gene; (2) Transforming the recombinant overexpression vector into plant tissues or plant cells.

9. The use according to any one of claims 1 to 7, characterized in that: The method of reducing the expression of the rice CRK1 gene comprises the following steps: (1) constructing a recombinant expression vector containing a mutant of the rice CRK1 gene; wherein the types of the mutant include gene knockout, base mutation, base insertion or base deletion; (2) Transforming the recombinant expression vector into plant tissues or plant cells.

10. The use according to any one of claims 4 to 9, characterized in that: The CDS sequence of the coding gene is shown as SEQ ID NO.1, the nucleotide sequence of the coding gene of the rice CRK1 protein is shown as SEQ ID NO.2, and the amino acid sequence of the rice CRK1 protein is shown as SEQ ID NO.3.

Images