Sample preservation solution, kit, preservation method and application of sample preservation solution

Abstract

The invention relates to a sample preserving fluid for preserving a fecal sample, a kit comprising a reagent for preparing the sample preserving fluid, a method for preserving the fecal sample by using the sample preserving fluid or the kit, and application of the sample preserving fluid or the kit in the preservation of the fecal sample. The sample preserving fluid comprises lithium dodecyl sulfate, sodium citrate, sodium hydrogen phosphate creatine disodium, tartaric acid, lithium chloride, urea, ethanol and chitosan. The sample preservation solution can rapidly inactivate pathogen microorganisms in an excrement sample, inhibit growth of various viruses or bacteria, ensure the integrity of trace helicobacter pylori DNA, realize transportation and preservation of total DNA of the excrement sample in a stable environment, extract nucleic acid of the sample preserved by the sample preservation solution, and improve the preservation efficiency of the sample. The nucleic acid product which is good in quality and high in yield and can be used for detection and analysis experiments of various genes such as PCR, qPCR and NGS can be obtained.

Description

Technical Field

[0001] The present invention relates to the field of biological sample preservation. More specifically, the present invention relates to a sample preservation solution for preserving stool samples, a kit for preparing the sample preservation solution, a method for preserving stool samples using the sample preservation solution or the kit, and the use of the sample preservation solution or the kit in preserving stool samples. Background Art

[0002] It is reported that the infection rate of Helicobacter pylori (Hp) is about 44.2%. Clinical consensus is that eradication of Helicobacter pylori can effectively reduce the risk of gastric cancer. Helicobacter pylori is a Gram-negative microaerophilic bacterium with extremely strong survival ability. It can survive in the highly acidic environment of the stomach. It is the only bacterium that can survive in the stomach. The current routine non-invasive methods for detecting Helicobacter pylori are mainly urea breath tests, etc., but the C13 / C14 breath test is radioactive and harmful to the human body, and when the test value is near the critical value, the result is unreliable and other means of detection are needed. There are studies using stool samples as a source to detect the nucleic acid of Helicobacter pylori, which is also an important detection method and is being accepted clinically.

[0003] As we all know, human feces are produced from the intestines, which carry a large number of intestinal microorganisms, as well as a large number of digestive residues and various nucleic acid degrading enzymes and PCR inhibitors produced by bacteria, making the cells and nucleic acids in fecal samples extremely vulnerable to damage and degradation. Moreover, after the feces leave the body, its environment also changes, mainly from an anaerobic environment to an aerobic environment. Some bacteria in it still maintain some activity and continue to metabolize and grow. However, due to changes in the environment, the growth and death rates of different bacteria are different from those before defecation.

[0004] The commonly used preservation method at present is to freeze the stool sample immediately at -20℃ or lower after collection to avoid degradation of exfoliated cells or other biochemical reactions, while keeping the bacterial composition in the stool unchanged. However, stool sample collection is often not carried out in the laboratory, that is, the collected stool samples need to be kept at room temperature for a period of time before being placed in a refrigerator at -20℃. This process can easily cause further loss of the already small amount of exfoliated cells and the death of a large number of anaerobic bacteria, thus affecting subsequent testing.

[0005] Preservatives for preserving biological samples often use commercially available UTM preservation solutions or cell preservation solutions to preserve biological samples such as cells in saliva, but nucleic acids in cell samples cannot be preserved for a long time. The first step in detecting DNA in stool samples for Helicobacter pylori is to collect and preserve stool samples. Without a good stool sample DNA preservation technology, the entire program for detecting Helicobacter pylori DNA from stool samples becomes impossible to start.

[0006] In view of the above-mentioned prior art, there is a need for a sample preservation solution that can preserve Helicobacter pylori DNA in feces at ambient temperature and a method of using the same to assist in Helicobacter pylori nucleic acid detection, so as to improve the convenience and accuracy of existing genetic testing or clinical diagnosis. Summary of the invention

[0007] In order to solve one or more of the above technical problems, the present invention provides in a first aspect a sample preservation solution for preserving stool samples, wherein the sample preservation solution comprises lithium dodecyl sulfate, sodium citrate, sodium hydrogen phosphate, disodium creatine, tartaric acid, lithium chloride, urea, ethanol and deacetylated chitosan.

[0008] In a second aspect, the present invention provides a kit for preserving stool samples, the kit comprising reagents for preparing the sample preserving solution described in the first aspect of the present invention.

[0009] The present invention provides a method for preserving stool samples in a third aspect, wherein the method uses the sample preserving solution described in the first aspect of the present invention or the kit described in the second aspect of the present invention for preservation.

[0010] The fourth aspect of the present invention provides use of the sample preservation solution described in the first aspect of the present invention or the kit described in the second aspect of the present invention in the preservation of stool samples. Preferably, the preservation is at room temperature.

[0011] Compared with the prior art, the present invention mainly has the following advantages:

[0012] (1) The total DNA of stool samples can be transported and stored in a stable environment. After the nucleic acid in the sample preservation solution is extracted and purified, the obtained DNA and RNA are of good quality and high yield, and various genetic detection and analysis experiments such as PCR, qPCR, and NGS can be completed.

[0013] (2) Ensure the integrity of the DNA in stool samples during the storage process, that is, obtain high molecular weight DNA.

[0014] (3) It can quickly inactivate pathogenic microorganisms in stool samples and inhibit the growth of various viruses or bacteria.

[0015] (4) Trace amounts of H. pylori DNA can be stored at room temperature without degradation, thereby enabling high-quality preservation of H. pylori nucleic acid detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The results of the integrity test of the total DNA in the stool samples after being stored in the sample storage solution at room temperature (25°C) for different days by electrophoresis in Example 11 are shown. Among them, A1-8: DNA extracted on day 0; B1-8, DNA extracted on day 7; C1-8, DNA extracted on day 14; D1-8, DNA extracted on day 30; E1-8, DNA extracted on day 45; F1-8, DNA extracted on day 60.

[0017] Figure 2 The nucleic acid amplification test results of Helicobacter pylori positive patient volunteer T1 in Example 12 are shown.

[0018] Figure 3 The nucleic acid amplification test results of Helicobacter pylori positive patient volunteer T2 in Example 12 are shown.

[0019] Figure 4 The nucleic acid amplification test results of Helicobacter pylori positive patient volunteer T3 in Example 12 are shown.

[0020] Figure 5 The nucleic acid amplification test results of Helicobacter pylori positive patient volunteer T4 in Example 12 are shown. DETAILED DESCRIPTION

[0021] Although preferred embodiments of the present invention have been shown and described herein, it will be appreciated by those skilled in the art that these embodiments are provided by way of example only. Without departing from the present invention, those skilled in the art will now appreciate that many changes, variations and substitutions may be made. It should be appreciated that many alternatives to the embodiments of the present invention described herein may be used to practice the present invention.

[0022] definition

[0023] Before describing the present teachings in detail, it should be understood that the present disclosure is not limited to specific sample preservative solutions or process steps, as these may vary. It should be noted that as used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise.

[0024] It should be understood that there is an implied "about" before the temperature, mass, weight, volume ratio, concentration, time, etc. discussed in this disclosure, so that slight and insubstantial deviations are within the scope of the teachings of this article. Generally, the term "about" means an insubstantial change in the amount of a component of the sample preservative solution, which has no significant effect on the effect or stability of the sample preservative solution. Moreover, the use of "comprising", "containing", and "including" is not intended to be restrictive. It should be understood that the above general description and detailed description are only exemplary and explanatory, and are not a limitation of the present teachings. In this application, "extracting", "separating" or "purifying" means that one or more components of a sample are removed or separated from other sample components. Sample components contain target nucleic acids that are often in a generally aqueous solution phase, which may also contain cell fragments, proteins, carbohydrates, lipids, salt ions, metal ions, and other nucleic acids. "Extracting", "separating" or "purifying" does not mean any degree of purification. Generally, separation or purification removes at least 70% or at least 80% or at least 90% of the target nucleic acid from other sample components.

[0025] As described above, the present invention provides in a first aspect a sample preservation solution for preserving stool samples, wherein the sample preservation solution comprises lithium dodecyl sulfate, sodium citrate, sodium hydrogen phosphate, disodium creatine, tartaric acid, lithium chloride, urea, ethanol and deacetylated chitosan.

[0026] In some preferred embodiments, the sample preservation solution comprises 0.1-2% (w / v) (e.g., 0.2, 0.5, 1.0 or 1.5% (w / v)) lithium dodecyl sulfate, 10-200 mM (20, 50, 100 or 150 mM) sodium citrate, 20-80 mM (e.g., 30, 40, 50, 60 or 70 mM) sodium hydrogen phosphate disodium creatine, 50-300 mM (e.g., 60, 90, 120, 150, 180, 210, 2 40 or 270 mM) of tartaric acid, 50-500 mM (e.g., 100, 200, 300 or 400 mM) of lithium chloride, 100-2000 mM (e.g., 200, 400, 800, 1000, 1200, 1400, 1600 or 1800 mM) of urea, 10-40% (w / v) (e.g., 15, 20, 25, 30 or 35% (w / v)) of ethanol, and 20-50 mM (30 or 40 mM) of deacetylated chitosan.

[0027] In some more preferred embodiments, the sample preservation solution comprises 0.2-1% (w / v) lithium dodecyl sulfate, 20-150mM sodium citrate, 25-60mM sodium hydrogen phosphate disodium creatine, 100-250mM tartaric acid, 100-400mM lithium chloride, 500-1000mM urea, 15-30% (w / v) ethanol, and 25-50mM deacetylated chitosan.

[0028] In some further preferred embodiments, the sample preservation solution comprises 0.25-1% (w / v) lithium dodecyl sulfate, 20-100 mM sodium citrate, 30-60 mM sodium hydrogen phosphate disodium creatine, 150-250 mM tartaric acid, 200-400 mM lithium chloride, 500-1000 mM urea, 15-25% (w / v) ethanol, and 25-50 mM deacetylated chitosan.

[0029] In some further preferred embodiments, the sample preservation solution comprises 0.5% (w / v) lithium dodecyl sulfate, 50 mM sodium citrate, 50 mM sodium hydrogen phosphate, disodium creatine, 150 mM tartaric acid, 250 mM lithium chloride, 750 mM urea, 20% (w / v) ethanol, and 50 mM deacetylated chitosan.

[0030] In some preferred embodiments, the pH of the sample preservation solution is 8.5-13.5 (e.g., 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0, 12.5 or 13.0). Preferably, the pH of the sample preservation solution is 8.5-11.5. More preferably, the pH of the sample preservation solution is 9.5-11.5. Further preferably, the pH of the sample preservation solution is 10.5.

[0031] In some preferred embodiments, the sample preservation solution further comprises a balance of water.

[0032] In the present invention, as long as the purpose of the present invention can be achieved and the technical problem to be solved by the present invention can be solved, the above components and their concentrations and pH can be various combinations. For example, in some particularly preferred embodiments, in some further preferred embodiments, the sample preservation solution comprises 0.5% (w / v) lithium dodecyl sulfate, 50mM sodium citrate, 50mM sodium hydrogen phosphate disodium creatine, 150mM tartaric acid, 250mM lithium chloride, 750mM urea, 20% (w / v) ethanol, and 50mM deacetylated chitosan and the balance of water, with a pH of 10.5.

[0033] In some preferred embodiments, the sample preservation solution keeps the total DNA in the stool sample stable for at least 30 days (e.g., at least 40, 50, 60, 70, 80, 90 or 100 days) at ambient temperature, preferably at least 90 days. Wherein, the stability means that the degradation of high molecular weight DNA in the preserved stool sample does not exceed 50% (e.g., not more than 40, 30, 20 or 10%), preferably not more than 30%, and more preferably not more than 20%; the high molecular weight DNA refers to DNA above 23 kb; the total DNA may include human genomic DNA and microbial DNA.

[0034] In a second aspect, the present invention provides a kit for preserving stool samples, the kit comprising reagents for preparing the sample preserving solution described in the first aspect of the present invention.

[0035] For example, the kit includes at least five selected from lithium dodecyl sulfate, sodium citrate, sodium hydrogen phosphate, disodium creatine, tartaric acid, lithium chloride, urea and chitosan, preferably at least six, and more preferably all seven.

[0036] In some preferred embodiments, the kit may further include ethanol and / or water. In other preferred embodiments, the kit may further include a detection reagent, a test paper or a pH meter for detecting pH.

[0037] The present invention provides a method for preserving stool samples in a third aspect, wherein the method uses the sample preserving solution described in the first aspect of the present invention or the kit described in the second aspect of the present invention for preservation.

[0038] In some preferred embodiments, the method comprises the following steps:

[0039] a) Obtaining stool samples;

[0040] b) contacting the stool sample with a sample preservation solution and mixing it with grinding beads to obtain a preservation mixture;

[0041] c) storing the storage mixture at ambient temperature;

[0042] The ratio of the stool sample to the sample preservation solution is 0.04 to 0.4 g sample / mL preservation solution, preferably 0.1 to 0.2 g sample / mL preservation solution; the sample preservation solution is the sample preservation solution described in the first aspect of the present invention or the sample preservation solution prepared by the kit described in the second aspect of the present invention.

[0043] For example, the stool sample and the sample preservation solution are added in a ratio of 0.2-2 g stool sample to 5 mL sample preservation solution. More preferably, the stool sample and the sample preservation solution are added in a ratio of 0.5-1 g stool sample to 5 mL sample preservation solution.

[0044] In addition, in step b), the mixture may be inverted about 10 times to form a homogeneous mixture as a storage mixture.

[0045] In some preferred embodiments, the grinding beads are selected from glass beads, steel beads, zirconium oxide beads and pomegranate beads. Preferably, the grinding beads are steel beads or zirconium oxide beads. More preferably, the diameter of the grinding beads is 7 to 10 mm (e.g., 8 or 9 mm).

[0046] The fourth aspect of the present invention provides use of the sample preservation solution described in the first aspect of the present invention or the kit described in the second aspect of the present invention in the preservation of stool samples. Preferably, the preservation is at room temperature.

[0047] The sample preservation solution, kit and preservation method provided by the present invention can preserve the total DNA in stool samples, especially Helicobacter pylori DNA, at ambient temperature, inactivate pathogenic microorganisms, protect the safety of inspectors, and improve the accuracy of Helicobacter pylori nucleic acid detection.

[0048] Example

[0049] In order to further understand the present invention, the preferred embodiments of the present invention are described below in conjunction with examples, but it should be understood that these descriptions are only for further illustrating the features and advantages of the present invention, rather than limiting the claims of the present invention. The experimental methods described in the following examples are conventional methods unless otherwise specified; the materials described are commercially available unless otherwise specified.

[0050] Example 1: Sample preservation solution S1

[0051] The present embodiment provides a sample preservation solution, which is composed of the following components: 0.5% (w / v) lithium dodecyl sulfate, 50mM sodium citrate, 50mM sodium hydrogen phosphate disodium creatine, 150mM tartaric acid, 250mM lithium chloride, 750mM urea, 20% (w / v) ethanol, and 50mM deacetylated chitosan, and the balance is water, and the pH of the preservation solution is 10.5.

[0052] Example 2: Sample preservation solution D1

[0053] This embodiment provides a sample preservation solution, the components and corresponding contents of which are substantially the same as those of embodiment 1, and the only difference is that the pH value is modified to 7.5.

[0054] Example 3: Sample preservation solution D2

[0055] This embodiment provides a sample preservation solution, the components and corresponding contents of which are substantially the same as those of embodiment 1, and the only difference is that the pH value is modified to 8.5.

[0056] Example 4: Sample preservation solution D3

[0057] This embodiment provides a sample preservation solution, the components and corresponding contents of which are substantially the same as those of embodiment 1, and the only difference is that the pH value is modified to 9.5.

[0058] Example 5: Sample preservation solution D4

[0059] This embodiment provides a sample preservation solution, the components and corresponding contents of which are substantially the same as those of embodiment 1, and the only difference is that the pH value is modified to 11.5.

[0060] Example 6: Sample preservation solution E1

[0061] The present embodiment provides a sample preservation solution, which is composed of the following components: 0.5% (w / v) lithium dodecyl sulfate, 50mM sodium citrate, 50mM sodium hydrogen phosphate disodium creatine, 250mM lithium chloride, 750mM urea, 20% (w / v) ethanol, and 50mM deacetylated chitosan, and the balance is water, and the pH of the preservation solution is 10.5.

[0062] Example 7: Sample preservation solution E2

[0063] The present embodiment provides a sample preservation solution, which is composed of the following components: 0.5% (w / v) lithium dodecyl sulfate, 50mM sodium citrate, 50mM sodium hydrogen phosphate disodium creatine, 50mM tartaric acid, 250mM lithium chloride, 750mM urea, 20% (w / v) ethanol, and 50mM deacetylated chitosan, and the balance is water, and the pH of the preservation solution is 10.5.

[0064] Example 8: Sample preservation solution E3

[0065] The present embodiment provides a sample preservation solution, which is composed of the following components: 0.5% (w / v) lithium dodecyl sulfate, 50mM sodium citrate, 50mM sodium hydrogen phosphate disodium creatine, 100mM tartaric acid, 250mM lithium chloride, 750mM urea, 20% (w / v) ethanol, and 50mM deacetylated chitosan, and the balance is water, and the pH of the preservation solution is 10.5.

[0066] Example 9: Sample preservation solution E4

[0067] The present embodiment provides a sample preservation solution, which is composed of the following components: 0.5% (w / v) lithium dodecyl sulfate, 50mM sodium citrate, 50mM sodium hydrogen phosphate disodium creatine, 250M tartaric acid, 250mM lithium chloride, 750mM urea, 20% (w / v) ethanol, and 50mM deacetylated chitosan, and the balance is water, and the pH of the preservation solution is 10.5.

[0068] Example 10: Preservation of total DNA in stool samples using the sample preservation solution of Examples 1-9

[0069] In this embodiment, a subject is instructed to defecate into a stool collection basin, and about 1 g of stool sample is taken with a spoon and added to a 10 mL sampling tube containing a 9 mm steel ball and 5 mL of the sample preservation solution provided in Embodiments 1-9. After the stool is added, a vortex mixer is used to mix it for 10 seconds to homogenize the stool sample.

[0070] The 9 samples of the above-mentioned uniform mixture were stored at ambient temperature (25°C) for extraction on the 0th day, the 7th day, the 30th day and the 60th day. The prepared samples were extracted using the "Magnetic Bead Method Strong Fecal Genomic DNA Extraction Kit" (Cat#CNA03290) provided by Suzhou Cretaceous Biotechnology Co., Ltd., using 250 μL of uniform mixture sample for extraction each time and 100 μL of elution solution for elution. From Table 1, it can be seen that the sample preservation solution S1 is significantly better than other sample preservation solutions. Moreover, it was found from D1-D4 that with the increase of pH value, it was surprisingly found that the preservation of DNA would be better, which is different from our understanding in the traditional sense. It is generally believed that DNA is better stored at pH7.5-8.5. The inventor tried to explain this phenomenon and speculated that it might be because the growth of microorganisms in feces was inhibited under weak alkalinity, no longer reproduced, and no new nucleases were produced. At the same time, the presence of high concentrations of sodium citrate and tartaric acid, two chelating agents, also inhibited the hydrolysis of DNA under alkalinity. Therefore, the present invention is more inclined to use a buffer solution of pH 9.5 to 11.5 to preserve DNA in stool samples. It was found from the results that pH 10.5 is the most suitable. As can be seen from Table 1 below, as the concentration of sodium tartrate increases, the preservation effect of DNA is getting better and better (E1-E4). However, the inventors have also found through experiments that the sample preservation solution E4 will precipitate at low temperatures (such as 4 degrees Celsius) because the concentration of tartaric acid is too high, affecting the use. Therefore, the present invention more preferably uses 150-200mM tartaric acid.

[0071] This example also tests the DNA yield of purified stool samples after being stored in different sample storage solutions for different days. Wherein, A: concentration difference ratio = (concentration on day 360 - concentration on day 0) / concentration on day 0; B. absorbance determination of DNA concentration.

[0072] Absorbance measurement at 260nm (A260nm) is often used to quantify DNA. An absorbance of 1.0 at 260nm corresponds to a pure double-stranded DNA concentration of 50ng / μL. The DNA yield of purified fecal samples treated with or without the sample preservation solution of the present invention under various conditions was determined using a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific Inc). Each DNA sample of 2μL volume was placed on a base and scanned from 220nm to 350nm, and the absorbance at 230nm, 260nm and 280nm was measured. The sample DNA concentration (ng / μL) was reported by NanoDrop 2000c software, and the concentration difference ratio was calculated based on the concentration, and the results are shown in Table 1 below.

[0073] Table 1: DNA in stool samples preserved at room temperature using different sample storage solutions

[0074]

[0075] Example 11: Integrity of DNA in samples stored in stabilizing sample storage solution

[0076] In this embodiment, 8 subjects were instructed to defecate into a stool collection basin, and about 1 g of stool sample was taken with a spoon and added to a 10 mL sampling tube containing a 9 mm steel ball and 5 mL of the sample preservation solution provided in Example 1. After the stool was added, it was mixed with a vortex mixer for 10 seconds to homogenize the stool sample.

[0077] The 8 samples of the homogeneous mixture were stored at ambient temperature (25°C) for extraction on day 0, day 7, day 14, day 30, day 45 and day 60. The prepared samples were extracted using the "Magnetic Bead Method Strong Fecal Genomic DNA Extraction Kit" (Cat# CNA03290) provided by Suzhou Cretaceous Biotechnology Co., Ltd., using 250 μL of the homogeneous mixture sample for extraction each time and 100 μL of elution solution for elution.

[0078] Take 5 μL of the DNA product of the sample extracted above and separate it on a 1% agarose gel by electrophoresis at 120 volts for 15 minutes. The gel was stained in 1 μg / mL ethidium bromide (EtBr) in distilled water for 15 minutes at room temperature, rinsed and photographed using an imaging system (UVP LLC) on a UV transilluminator. When the stained band on the gel is clear and >23Kb compared to the DNA ladder, it is determined that the DNA is stabilized and intact, and the DNA marker size is used as a reference. Figure 1 As shown, the main band of DNA in the fecal samples of 8 subjects remained intact from day 0 to day 60, and no obvious degradation trend was found over time.

[0079] Example 12 Helicobacter pylori DNA amplification detection

[0080] The inventor recruited four (volunteers T1-T4) Helicobacter pylori positive patients who had been confirmed by C14 breath test, collected their fecal samples, and divided them into 2 parts. A sample of about 1g of fecal sample was taken with a spoon and added to a sampling tube containing 10mL. The sampling tube contained 1 9mm steel ball and 5mL of the sample preservation solution provided in Example 1. After the feces were added, a vortex mixer was used to mix for 10 seconds to homogenize the fecal sample. Another sample used RNAlater (Thermo company product) recommended by the Human Metagenome Project as a fecal DNA preservation solution. RNAlater is an aqueous, non-toxic storage reagent that can inhibit bacterial growth and can quickly penetrate tissues. It can not only stabilize and protect the cell RNA in the unfrozen specimen, but also prevent DNA degradation. The sample collected by the above sample was sent to the inventor's laboratory for testing after 5 days of room temperature transportation. The samples prepared above were extracted using the "Magnetic Bead Method Powerful Fecal Genomic DNA Extraction Kit" (Cat# CNA03290) provided by Suzhou Cretaceous Biotechnology Co., Ltd., using 250μL of uniform mixture sample for extraction each time and 100μL of elution buffer for elution. The amplification reagent used was Universal Direct Taqman qPCR Master Mix (2×) Cat: CRP02386 from Suzhou Cretaceous Biotechnology Co., Ltd. as the qPCR premix for detection, the specific 16s gene of Helicobacter pylori was selected for amplification, and the fluorescent quantitative PCR instrument ABI 7500Fast from Therm was selected for quantification. The template loading volume was 5μL and the total system was 25μL. The test results are as follows Figure 2As described above, the sample preservation solution of Example 1 provided by the inventors was used to extract nucleic acid and amplify the test at room temperature for 5 days. The T1 amplification test of the positive patient was positive, while the T1 amplification test of the positive patient using RNALater as the stool sample preservation solution was negative. Figure 3 to Figure 5 It was found that the test results of positive patients T2-T4 showed that both the sample preservation solution of Example 1 of the present invention and RNALater could detect positive results, but it was obvious that the Ct value of the sample preservation solution provided by the present invention was earlier, more sensitive, and better conducive to the nucleic acid detection of Helicobacter pylori in stool samples.

[0081] The primers and probes used are shown in the following table:

[0082] HP-F CCCATCAGGAAACATCGCTTCA HP-R TCCACTATGCTGGAGAATTGGCTA HP-P-FAM TGCTTGCCACGCCATCCATCACATCA,5'FAM,3'BHQ1

[0083] The qPCR reaction system is shown in the following table:

[0084] Components Volume (μL) qPCR Master Mix 12.5 HP-F (10 μM) 1 HP-R (10μM) 1 HP-P-FAM (10 μM) 0.5 Deionized water 5 stencil 5 Total volume 25

[0085] The amplification procedure is shown in the following table:

[0086]

[0087] The description of the above embodiments is only used to help understand the method of the present invention and its core idea. It should be noted that for those of ordinary skill in the art, without departing from the principles of the present invention, several improvements and modifications may be made to the present invention, and these improvements and modifications also fall within the scope of protection of the claims of the present invention. The above description of the disclosed embodiments enables professionals and technicians in this field to implement or use the present invention. The various modifications to these embodiments will be obvious to professionals and technicians in this field, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but will conform to the widest range consistent with the principles and novel features disclosed herein.

Claims

1. A sample preservation solution for preserving stool samples, characterized in that: The sample preservation solution comprises lithium dodecyl sulfate, sodium citrate, sodium hydrogen phosphate, disodium creatine, tartaric acid, lithium chloride, urea, ethanol and deacetylated chitosan.

2. The sample preservation solution according to claim 1, characterized in that: The sample preservation solution comprises 0.1-2% (w / v) lithium dodecyl sulfate, 10-200 mM sodium citrate, 20-80 mM sodium hydrogen phosphate disodium creatine, 50-300 mM tartaric acid, 50-500 mM lithium chloride, 100-2000 mM urea, 10-40% (w / v) ethanol, and 20-50 mM deacetyl chitosan; Preferably, the sample preservation solution comprises 0.2-1% (w / v) lithium dodecyl sulfate, 20-150 mM sodium citrate, 25-60 mM sodium hydrogen phosphate disodium creatine, 100-250 mM tartaric acid, 100-400 mM lithium chloride, 500-1000 mM urea, 15-30% (w / v) ethanol, and 25-50 mM deacetylated chitosan; More preferably, the sample preservation solution comprises 0.25-1% (w / v) lithium dodecyl sulfate, 20-100 mM sodium citrate, 30-60 mM sodium hydrogen phosphate disodium creatine, 150-250 mM tartaric acid, 200-400 mM lithium chloride, 500-1000 mM urea, 15-25% (w / v) ethanol, and 25-50 mM deacetylated chitosan; Further preferably, the sample preservation solution comprises 0.5% (w / v) lithium dodecyl sulfate, 50 mM sodium citrate, 50 mM sodium hydrogen phosphate / disodium creatine, 150 mM tartaric acid, 250 mM lithium chloride, 750 mM urea, 20% (w / v) ethanol, and 50 mM deacetylated chitosan.

3. The sample preservation solution according to claim 1 or 2, characterized in that: The pH of the sample preservation solution is 8.5-13.5; Preferably, the pH of the sample preservation solution is 8.5-11.5; More preferably, the pH of the sample preservation solution is 9.5-11.5; More preferably, the pH of the sample preservation solution is 10.

5.

4. The sample preservation solution according to any one of claims 1 to 3, characterized in that: The sample preservation solution also contains a balance of water.

5. The sample preservation solution according to any one of claims 1 to 4, characterized in that: The sample preservation solution keeps the total DNA in the stool sample stable for at least 30 days, preferably at least 90 days at ambient temperature; Wherein, the stability means that the degradation of high molecular weight DNA in the preserved stool sample does not exceed 50%, preferably does not exceed 30%, and more preferably does not exceed 20%; The high molecular weight DNA refers to DNA above 23 kb; The total DNA includes human genomic DNA and microbial DNA.

6. A kit for preserving stool samples, characterized in that: The kit comprises reagents for preparing the sample preservation solution according to any one of claims 1 to 5.

7. A method for preserving a stool sample, characterized in that: The method uses the sample preservation solution according to any one of claims 1 to 5 or the kit according to claim 6 for preservation.

8. The method according to claim 7, characterized in that The method comprises the following steps: a) Obtaining stool samples; b) contacting the stool sample with a sample preservation solution and mixing it with grinding beads to obtain a preservation mixture; c) storing the storage mixture at ambient temperature; The ratio of the stool sample to the sample preservation solution is 0.04 to 0.4 g sample / mL preservation solution, preferably 0.1 to 0.2 g sample / mL preservation solution.

9. The method according to claim 8, characterized in that: The grinding beads are selected from one of glass beads, steel beads, zirconium oxide beads and pomegranate beads; Preferably, the grinding beads are steel beads or zirconium oxide beads; More preferably, the diameter of the grinding beads is 7 to 10 mm.

10. Use of the sample preservation solution according to any one of claims 1 to 5 or the kit according to claim 6 in the preservation of stool samples; preferably, the preservation is at room temperature.

Images