PCR-LFS-based gene editing element CRISPR / CAS9 rapid detection technology

Abstract

The invention discloses a PCR-LFS-based gene editing element CRISPR / CAS9 rapid detection technology, and belongs to the technical field of gene engineering, and the PCR-LFS-based gene editing element CRISPR / CAS9 rapid detection technology comprises the following steps: S1, selecting a plant sample, preparing a plasmid standard substance, designing and synthesizing a primer, preparing a probe, and preparing colloidal gold; s2, constructing plasmids containing CRISPR / Cas9 gene editing elements, then transforming the plasmids through DH5alpha competent cells, and finally extracting the plasmids and measuring the concentration of the plasmids; s3, preparing a PCR test strip; s4, extracting DNA (deoxyribonucleic acid) from the plant sample, and performing PCR (polymerase chain reaction) amplification and detection; and S5, optimizing and verifying a PCR-LFS detection technology. The problems of low detection speed, low sensitivity, high cost and the like in the aspect of detecting illegal transgenic crops and gene editing crops are solved. The method has the advantages of high accuracy and good reliability.

Description

Technical Field

[0001] The present invention relates to the field of gene engineering technology, and in particular to a PCR-LFS-based gene editing element CRISPR / CAS9 rapid detection technology. Background Art

[0002] Genetically modified foods are foods whose genetic material has been altered through genetic engineering technology, a process that may involve transferring genes from one organism to another to give the recipient organism new characteristics or improve existing characteristics. The development of genetically modified foods is usually aimed at increasing crop yields, improving nutritional value, enhancing resistance to pests and diseases, or adapting to adverse soil and climatic conditions. For example, through genetic modification technology, pest-resistant cotton, herbicide-resistant soybeans, and "golden rice" rich in vitamin A can be cultivated. Although genetically modified foods have irreplaceable advantages, these foods need to undergo rigorous safety assessments and tests before they are put on the market to ensure that they are harmless to human health. Based on the rapid promotion of genetically modified crops around the world, some illegal genetically modified crops have begun to emerge. Although many countries have implemented strict genetically modified labeling regulations, unauthorized and uncontrolled cultivation of genetically modified crops is still reported.

[0003] Gene editing technology is a new and disruptive gene manipulation technology that is widely used in agricultural production. How to detect gene-edited crops is of great research significance. CRISPR / Cas9 is a revolutionary gene editing technology that originates from the natural immune system of bacteria. It has many advantages such as high efficiency, low cost and easy operation. Compared with traditional gene editing methods, it can edit multiple genes more quickly and can be applied in different organisms, including plants, animals and human cells. At present, this technology has been widely used in genetically modified crops, including gene knockout, gene knock-in, gene regulation and genome-level applications.

[0004] Therefore, there is an urgent need for a rapid detection technology for the gene editing element CRISPR / CAS9 based on PCR-LFS to effectively solve the problems existing in the detection of illegal genetically modified crops with existing technologies, improve the speed, sensitivity and specificity of detection, reduce costs, adapt to the development of new technologies, and enhance regulatory capabilities. Summary of the invention

[0005] To this end, the present invention provides a PCR-LFS-based gene editing element CRISPR / CAS9 rapid detection technology to solve the problems of slow detection speed, low sensitivity and high cost in the prior art in detecting illegal genetically modified crops and gene-edited crops.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] According to a first aspect of the present invention, a PCR-LFS-based rapid detection technology for gene editing elements CRISPR / CAS9 is provided, comprising the following steps:

[0008] S1. Select plant samples, prepare plasmid standards, design and synthesize primers, prepare probes, and prepare colloidal gold;

[0009] S2. Construct a plasmid containing CRISPR / Cas9 gene editing elements, then transform the plasmid through DH5α competent cells, and finally extract the plasmid and measure the concentration;

[0010] S3. Preparation of PCR test strips;

[0011] S4. Extract DNA from plant samples and perform PCR amplification and detection;

[0012] S5. Optimization and verification of PCR-LFS detection technology.

[0013] Furthermore, S3 includes the following specific steps:

[0014] S31. Reagent preparation: Use ultrapure water to prepare 200 mL of 1 mol / L pH 8.0 Tris-HCl buffer, 10 mL of 0.1 mol / L potassium carbonate solution, 100 mL of 1% trisodium citrate solution, 10 mM PB, and 5 g / L chloroauric acid solution; Dilute the goat anti-mouse secondary antibody to 1 mg / mL with 10 mM PBS;

[0015] S32. Colloidal gold preparation: The conical flask and magnetic stirring bar were cleaned with tap water and distilled water respectively, and then the magnetic stirring bar was placed in the conical flask, soaked in aqua regia overnight, and then the conical flask and magnetic stirring bar were cleaned with tap water, pure water, and ultrapure water in turn, and then dried;

[0016] Add 196 mL of ultrapure water and 4 mL of 5 g / L chloroauric acid to a clean conical flask, place it on a magnetic stirrer, stir it, and then heat it. Quickly add 2.4 mL of 1% trisodium citrate solution to the flask, continue heating and stirring until the liquid changes color to wine red, continue heating and stirring for 5 minutes, then cool it to room temperature, seal it with a sealing film, and store it at 2-8°C;

[0017] S33. Preparation of colloidal gold conjugate: 1000 μL of colloidal gold was injected into a 1.5 mL conical centrifuge tube, 7 μL of 0.1 mol / L potassium carbonate solution was added, and the mixture was shaken and mixed. Then, 5 μL of 1 mg / mL Anti-Digoxin was added, and the mixture was shaken and mixed. After the mixture was shaken on a 3D rotating mixer for 60 min, 85 μL of 10% BSA solution was added, and the mixture was shaken and mixed. Then, the mixture was shaken and blocked on a 3D rotating mixer for 30 min, and centrifuged at 10500 r / min at 4°C for 15 min on a low-temperature high-speed centrifuge. After the centrifugation, 25 μL of the wine red precipitate was quickly aspirated and transferred to a 200 μL PCR tube, and 10 μL of 10% sucrose solution, 50 μL of 10% BSA solution and 25 μL PBS (1X) were added to prepare a resuspension, and the mixture was shaken on a vortex machine for 8 s. After the mixture was mixed, it was stored at 4°C for later use.

[0018] S34. Preparation of gold label pad: VL98 polyester film was cut into pre-treated strips, soaked in gold label treatment solution for 2 h, then dried in an oven at 37°C for 120 min, and then cut into 4×6 mm gold label pads using a strip cutter. The prepared resuspension solution was transferred and dropped onto the gold label pad at 7 μL / strip, and dried at 37°C for 60 min.

[0019] S35. Preparation of NC film on the bottom plate: remove the adhesive tape reserved in the middle of the PVC bottom plate, stick the cut NC film on the corresponding position in the middle of the PVC rubber plate, suck the prepared C and T line antibodies from the marking needle of the film spraying instrument into the marking conduit, expel the air sucked in the marking conduit and wipe off the antibodies overflowing from the marking needle, set the C and T line marking volume to 0.6 μL / cm, and dry the PVC bottom plate after marking;

[0020] S36. Sample pad preparation: Cut the glass fiber board and cardboard into long strips, soak the sample pad in the treatment solution for 120 min and dry it for later use;

[0021] S37. Assembly: Remove the adhesive tape on the 19 mm width side of the PVC base plate, and place the sample pad flush with the PVC base plate. Then remove the adhesive tape on the 17 mm width side of the PVC base plate, and place one side of the absorbent paper flush with the edge of the PVC base plate, and press the other side onto the NC film for bonding.

[0022] S38. Cutting: Cut the assembled PVC board into 4 mm width strips, put the cut test strips into a sealed bag, add desiccant, and seal;

[0023] S39. Installation of gold label pad: lift up the sample pad with tweezers, and then use another pair of tweezers to place the dried gold pad between the sample pad and the NC membrane, and adjust the overlapping size of the gold label pad and the NC membrane to 2.0±0.2mm. After the test strip is made, place it in a dry and cool place for storage.

[0024] Furthermore, the specific steps for preparing the probe primers and amplification internal standards in S1 are as follows: centrifuge the newly synthesized primer probe at high speed for 5 seconds in a centrifuge, centrifuge the powder on the tube wall to the bottom of the tube, add 100 μL of nuclease-free water to the centrifuge tube, shake up and down, and then centrifuge at high speed for 5 seconds in a centrifuge to obtain 10 μM upstream and downstream primers and probes, and store them in a -20°C refrigerator. The probe needs to be protected from light.

[0025] Furthermore, the primer pair in S1 includes a first primer pair, a second primer pair and a probe:

[0026] The first primer pair includes a forward primer as shown in SEQ ID NO.1 and a reverse primer as shown in SEQ ID NO.2;

[0027] The second primer pair includes a forward primer as shown in SEQ ID NO.3 and a reverse primer as shown in SEQ ID NO.4;

[0028] The probe includes a nucleotide sequence as shown in SEQ ID NO.5.

[0029] Furthermore, the transformation of the purified plasmid into DH5α competent cells in S2 comprises the following specific steps:

[0030] Take out DH5α competent cells from -80℃, add all the plasmid DNA solution into the competent cells in a clean bench, and mix gently. Place the competent cells on ice for 30 minutes, place the competent cell centrifuge tube in a 42℃ water bath for heat shock for 90 seconds, and then quickly place it on ice for 2 minutes. Finally, add 200L of non-resistant liquid LB to the competent cell centrifuge tube, and spread the mixed competent cells on the LB plate containing ampicillin resistance. After spreading, place it in a 37℃ constant temperature incubator and culture it for 12-16 hours until a single colony grows. Pick a single colony, inoculate it into a new non-resistant liquid LB culture medium, and culture it on a shaker at 37℃, 250rpm / min for 14-16 hours.

[0031] Furthermore, the plasmid extraction step in S2 is as follows:

[0032] Take 1-5mL of bacterial solution and centrifuge at 10000rpm for 1min. Collect the bacteria in a 1.5mL EP tube and discard the supernatant LB medium. Add 250L buffer P1 to the bacterial precipitate to resuspend the bacteria. Then add 250L buffer P2 to the centrifuge tube and gently invert it to mix. Then add 350L buffer P3 and immediately invert it gently until white flocculent precipitate appears. Centrifuge at 12000rpm for 10min.

[0033] Transfer the supernatant of the centrifuged product to a FastPure DNA Mini Columns adsorption column with a waste liquid collection tube, centrifuge at 12000rpm for 30s, and discard the waste liquid in the collection tube. Then add PW2 diluted with anhydrous ethanol to the adsorption column to wash the ionic substances in the column, discard PW2 by centrifugation at 12000rpm for 30s, and repeat this step. Completely remove the residual washing liquid in the adsorption column by empty centrifugation at 12000rpm for 2min.

[0034] Place the adsorption column in a clean 1.5mL EP tube, and add 50L Elution buffer to the center of the membrane of the adsorption column to elute the DNA. Let it stand at room temperature for 1min and centrifuge at 12000 rpm for 1min. The result is the target plasmid.

[0035] Furthermore, the S4 specifically includes the following steps:

[0036] S41. DNA extraction: After the plant samples were processed by a grinder, DNA was extracted using a DNA kit, and the DNA concentration was measured using Nanodrop;

[0037] S42. Amplify using a Veriti 96-well PCR instrument. The procedure is as follows:

[0038] Pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, repeat for 30-40 cycles; final extension at 72°C for 3 min;

[0039] S43. PCR product detection: Take 6 μL of DNA amplification product, add 44 μL of 10 mM Tris-HCl and mix well, and drop 50 μL of the mixture on the sample pad of LFS. After 10 minutes, observe the signals of the test area and control area on the LFS, and confirm the PCR product by capillary gel electrophoresis.

[0040] Furthermore, S5 includes: PCR amplification system optimization, display sensitivity comparison analysis, detection specificity verification, detection sensitivity analysis, actual sample detection and data analysis.

[0041] Furthermore, in the S35, the C-line antibody is 1 mg / mL goat anti-mouse secondary antibody, and the T-line antibody is 1 mg / mL streptavidin.

[0042] Furthermore, in the S36, the fiberglass board is cut into strips with a width of 17×300 mm, and the cardboard is cut into strips with a width of 19×300 mm.

[0043] The present invention has the following advantages:

[0044] 1. This application provides a fast and convenient detection method for CRISPR / Cas9 gene-edited crops by constructing a detection method based on PCR amplification and lateral flow strips (Lateral Flow Strip, LFS). Compared with traditional laboratory detection methods, such as Southern blotting or real-time fluorescence quantitative PCR (qPCR), this method is easy to operate, does not require complex instruments and equipment, and can complete the entire process from sample processing to result reading in a short time. This is especially important for field testing and rapid on-site screening, which can greatly improve detection efficiency, reduce human errors, and is convenient for non-professionals to operate.

[0045] 2. This application uses the characteristic sequence of CRISPR / Cas9 gene editing elements to design specific primers, and optimizes the PCR amplification system to ensure high sensitivity and specificity of the detection. By comparing the sensitivity of standards with different dilutions, it is verified that this method can detect extremely low concentrations of target fragments. In addition, through specificity verification, it is ensured that the method will not have non-specific amplification, thereby avoiding false positive results. This high sensitivity and specificity ensures the accuracy of the test results, which is of great significance for monitoring the cultivation of illegal genetically modified crops and helps maintain food safety and market order. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] In order to more clearly illustrate the implementation methods of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for the implementation methods or the description of the prior art. Obviously, the drawings in the following description are only exemplary, and for ordinary technicians in this field, other implementation drawings can be derived from the provided drawings without creative work.

[0047] The structures, proportions, sizes, etc. illustrated in this specification are only used to match the contents disclosed in the specification so as to facilitate understanding and reading by persons familiar with the technology. They are not used to limit the conditions under which the present invention can be implemented, and therefore have no substantial technical significance. Any structural modification, change in proportion or adjustment of size shall still fall within the scope of the technical contents disclosed in the present invention without affecting the effects and purposes that can be achieved by the present invention.

[0048] Figure 1 A concentration determination curve diagram of the plasmid standard provided by the present invention;

[0049] Figure 2 A comparison chart of the detection results of the CRISPR / Cas9 gene editing elements provided by the present invention;

[0050] Figure 3Verification of PCR primers for specific amplification of the 125bp target band provided by the present invention;

[0051] In the figure:

[0052] A: Capillary gel electrophoresis A01: DL 3000 DNA mark; A02: positive control; A03: negative control;

[0053] B: Test strip No. 1: positive control; Test strip No. 2: negative control;

[0054] Figure 4 A comparative analysis diagram of the detection sensitivity of the test strip provided by the present invention and capillary gel electrophoresis;

[0055] In the figure:

[0056] A: Test strip display result A01: stock solution 100; A02: dilution 10-1; A03: dilution 10-2; A04: dilution 10-3; A05: dilution 10-4; A06: dilution 10-5; A07: dilution 10-6; A08: dilution 10-7; A09: dilution 10-8; A10: dilution 10-9; A11: blank control;

[0057] B: Capillary gel electrophoresis results B01: DL 2000 DNA mark; B02: stock solution 100; B03: dilution 10-1; B04: dilution 10-2; B05: dilution 10-3; B06: dilution 10-4; B07: dilution 10-5; B08: dilution 10-6; B09: dilution 10-7; B10: dilution 10-8; B11: dilution 10-9; B12: blank control;

[0058] Figure 5 A comparison chart of the specificity verification of PCR-LFS detection of Cas9 positive and negative plant samples provided by the present invention;

[0059] In the figure:

[0060] A: Capillary gel electrophoresis:

[0061] A01: DL 2000 DNA mark; A02: plasmid standard; A03: Cas9 tomato leaf 1; A04: Cas9 tomato leaf 2; A05: tomato leaf 3; A06: corn; A07: rice; A08: soybean; A09: tomato seeds; A10: rapeseed seeds; A11: pepper seeds; A12: negative control;

[0062] B: Test strips:

[0063] B01: plasmid standard; B02: Cas9 tomato leaf 1; B03: Cas9 tomato leaf 2; B04: tomato leaf 3; B05: corn; B06: rice; B07: soybean; B08: tomato seeds; B09: rapeseed seeds; B10: pepper seeds; B11: negative control;

[0064] Figure 6 A sensitivity analysis diagram of PCR-LFS, PCR capillary gel electrophoresis and fluorescence quantitative PCR using plasmid standard dilutions provided by the present invention;

[0065] In the figure: A: PCR-LFS:

[0066] A01: stock solution 100; A02: dilution 10-1; A03: dilution 10-2; A04: dilution 10-3; A05: dilution 10-4; A06: dilution 10-5; A07: dilution 10-6; A08: dilution 10-7; A09: dilution 10-8; A10: dilution 10-9; A11: negative control;

[0067] B: PCR capillary gel electrophoresis:

[0068] B01: DL 2000 DNA mark; B02: stock solution 100; B03: dilution 10-1; B04: dilution 10-2; B05: dilution 10-3; B06: dilution 10-4; B07: dilution 10-5; B08: dilution 10-6; B09: dilution 10-7; B10: dilution 10-8; B11: dilution 10-9; B12: negative control;

[0069] C: Fluorescence quantitative PCR:

[0070] From left to right, the amplification curves are 100-10-5 plasmid dilution, 10-6-10-9 plasmid dilution and negative control no amplification curve;

[0071] Figure 7 A comparative analysis diagram of the sensitivity of PCR-LFS and PCR capillary gel electrophoresis in the detection of transgenic tomato leaf samples provided by the present invention;

[0072] In the figure:

[0073] A: PCR-LFS test data;

[0074] B: PCR capillary gel electrophoresis detection data;

[0075] C: LFS detection diagram:

[0076] C1-C16: mixed sample 1:20-1:215; C17: negative control; C18: blank control; C19: positive control;

[0077] D: Capillary gel electrophoresis image:

[0078] D1: DL 2000 DNA mark; D2-D17: mixed sample 1:20-1:215; D18: negative control; D19: blank control; D20: positive control. DETAILED DESCRIPTION

[0079] The following is a description of the implementation of the present invention by specific embodiments. People familiar with the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0080] The present invention provides a rapid detection technology of gene editing element CRISPR / CAS9 based on PCR-LFS, comprising the following steps:

[0081] S1. Select plant samples, prepare plasmid standards, design and synthesize primers, prepare probes, and prepare colloidal gold;

[0082] S2. Construct a plasmid containing CRISPR / Cas9 gene editing elements, then transform the plasmid through DH5α competent cells, and finally extract the plasmid and measure the concentration;

[0083] S3. Preparation of PCR test strips;

[0084] S4. Extract DNA from plant samples and perform PCR amplification and detection;

[0085] S5. Optimization and verification of PCR-LFS detection technology.

[0086] Specifically, S3 includes the following specific steps:

[0087] S31. Reagent configuration:

[0088] Use ultrapure water to prepare 200 mL of 1 mol / L pH 8.0 Tris-HCl buffer, 10 mL of 0.1 mol / L potassium carbonate solution, 100 mL of 1% trisodium citrate solution, 10 mM PB, and 5 g / L chloroauric acid solution;

[0089] Dilute goat anti-mouse secondary antibody to 1 mg / mL with 10 mM PBS;

[0090] S32.Colloidal gold production:

[0091] Wash the conical flask and magnetic stirring bar with tap water and distilled water respectively, then put the magnetic stirring bar into the conical flask, soak it with aqua regia overnight, and then use tap water, pure water, and ultrapure water to wash the conical flask and magnetic stirring bar in turn, and then dry them;

[0092] Add 196 mL of ultrapure water and 4 mL of 5 g / L chloroauric acid to a clean conical flask, place it on a magnetic stirrer, stir it, and then heat it. Quickly add 2.4 mL of 1% trisodium citrate solution to the flask, continue heating and stirring until the liquid changes color to wine red, continue heating and stirring for 5 minutes, then cool it to room temperature, seal it with a sealing film, and store it at 2-8°C;

[0093] S33. Preparation of colloidal gold conjugate: Take 1000 μL of colloidal gold and inject it into a 1.5mL conical centrifuge tube, add 7 μL of 0.1mol / L potassium carbonate solution, shake and mix, then add 5 μL of 1mg / mL Anti-Digoxin, shake and mix, and shake on a 3D rotating mixer for 60 minutes, then add 85 μL of 10% BSA solution, shake and mix, then shake and seal on a 3D rotating mixer for 30 minutes, centrifuge at 10500r / min at 4°C on a low-temperature high-speed centrifuge for 15 minutes. After the centrifugation, quickly aspirate 25 μL of wine-red precipitate and transfer it to a 200 μL PCR tube, add 10 μL of 10% sucrose solution, 50 μL of 10% BSA solution and 25 μL PBS (1X) to prepare a heavy suspension, shake on a vortexer for 8s, mix and store at 4°C for later use;

[0094] S34. Preparation of gold label pad: VL98 polyester film was cut into pre-treated strips, soaked in gold label treatment solution for 2 h, then dried in an oven at 37°C for 120 min, and then cut into 4×6 mm gold label pads using a strip cutter. The prepared resuspension solution was transferred and dropped onto the gold label pad at 7 μL / strip, and dried at 37°C for 60 min.

[0095] S35. Preparation of NC film on the bottom plate: remove the adhesive tape reserved in the middle of the PVC bottom plate, stick the cut NC film on the corresponding position in the middle of the PVC rubber plate, suck the prepared C and T line antibodies from the marking needle of the film spraying instrument into the marking conduit, expel the air sucked in the marking conduit and wipe off the antibodies overflowing from the marking needle, set the C and T line marking volume to 0.6 μL / cm, and dry the PVC bottom plate after marking;

[0096] S36. Sample pad preparation: Cut the glass fiber board and cardboard into long strips, soak the sample pad in the treatment solution for 120 min and dry it for later use;

[0097] S37. Assembly: Remove the adhesive tape on the 19 mm width side of the PVC base plate, and place the sample pad flush with the PVC base plate. Then remove the adhesive tape on the 17 mm width side of the PVC base plate, and place one side of the absorbent paper flush with the edge of the PVC base plate, and press the other side onto the NC film for bonding.

[0098] S38. Cutting: Cut the assembled PVC board into 4 mm width strips, put the cut test strips into a sealed bag, add desiccant, and seal;

[0099] S39. Installation of gold label pad: lift up the sample pad with tweezers, and then use another pair of tweezers to place the dried gold pad between the sample pad and the NC membrane, and adjust the overlapping size of the gold label pad and the NC membrane to 2.0±0.2mm. After the test strip is made, place it in a dry and cool place for storage.

[0100] Among them, the specific steps for preparing the probe primers and amplification internal standards in S1 are as follows: centrifuge the newly synthesized primer probe at high speed for 5 seconds in a centrifuge, centrifuge the powder on the tube wall to the bottom of the tube, add 100 μL of nuclease-free water to the centrifuge tube, shake up and down, and then centrifuge at high speed for 5 seconds in a centrifuge to obtain 10 μM upstream and downstream primers and probes, and store them in a -20°C refrigerator. The probe needs to be protected from light.

[0101] Specifically, the primer pair in S1 includes a first primer pair, a second primer pair and a probe:

[0102] The first primer pair includes a forward primer as shown in SEQ ID NO.1 and a reverse primer as shown in SEQ ID NO.2;

[0103] The second primer pair includes a forward primer as shown in SEQ ID NO.3 and a reverse primer as shown in SEQ ID NO.4;

[0104] The probe includes the nucleotide sequence shown in SEQ ID NO.5.

[0105] Among them, the transformation of the purified plasmid into DH5α competent cells in S2 includes the following specific steps:

[0106] Take out DH5α competent cells from -80℃, add all the plasmid DNA solution into the competent cells in a clean bench, and mix gently. Place the competent cells on ice for 30 minutes, place the competent cell centrifuge tube in a 42℃ water bath for heat shock for 90 seconds, and then quickly place it on ice for 2 minutes. Finally, add 200L of non-resistant liquid LB to the competent cell centrifuge tube, and spread the mixed competent cells on the LB plate containing ampicillin resistance. After spreading, place it in a 37℃ constant temperature incubator and culture it for 12-16 hours until a single colony grows. Pick a single colony, inoculate it into a new non-resistant liquid LB culture medium, and culture it on a shaker at 37℃, 250rpm / min for 14-16 hours.

[0107] Specifically, the plasmid extraction steps in S2 are as follows:

[0108] Take 1-5mL of bacterial solution and centrifuge at 10000rpm for 1min. Collect the bacteria in a 1.5mL EP tube and discard the supernatant LB medium. Add 250L buffer P1 to the bacterial precipitate to resuspend the bacteria. Then add 250L buffer P2 to the centrifuge tube and gently invert it to mix. Then add 350L buffer P3 and immediately invert it gently until white flocculent precipitate appears. Centrifuge at 12000rpm for 10min.

[0109] Transfer the supernatant of the centrifuged product to a FastPure DNA Mini Columns adsorption column with a waste liquid collection tube, centrifuge at 12000rpm for 30s, and discard the waste liquid in the collection tube. Then add PW2 diluted with anhydrous ethanol to the adsorption column to wash the ionic substances in the column, discard PW2 by centrifugation at 12000rpm for 30s, and repeat this step. Completely remove the residual washing liquid in the adsorption column by empty centrifugation at 12000rpm for 2min.

[0110] Place the adsorption column in a clean 1.5mL EP tube, and add 50L Elution buffer to the center of the membrane of the adsorption column to elute the DNA. Let it stand at room temperature for 1min and centrifuge at 12000 rpm for 1min. The obtained result is the target plasmid.

[0111] Wherein, S4 specifically includes the following steps:

[0112] S41. DNA extraction: After the plant samples were processed by a grinder, DNA was extracted using a DNA kit (DNeasy Plant MiniKit), and the DNA concentration was determined using Nanodrop;

[0113] S42. Amplify using a Veriti 96-well PCR instrument. The procedure is as follows:

[0114] Pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, repeat for 30-40 cycles; final extension at 72°C for 3 min;

[0115] S43. PCR product detection: Take 6 μL of DNA amplification product, add 44 μL of 10 mM Tris-HCl and mix well, and drop 50 μL of the mixture on the sample pad of LFS. After 10 minutes, observe the signals of the test area and control area on the LFS, and confirm the PCR product by capillary gel electrophoresis.

[0116] The optimization and verification of PCR-LFS detection technology in S5 included: PCR amplification system optimization, display sensitivity comparison analysis, detection specificity verification, detection sensitivity analysis, actual sample testing and data analysis.

[0117] Specifically, the C-line antibody in S35 was goat anti-mouse secondary antibody (H+L), 1 mg / mL;

[0118] The T-line antibody was streptavidin (SA), 1 mg / mL.

[0119] Specifically, the S36 medium glass fiber board is cut into strips with a width of 17×300 mm, and the cardboard is cut into strips with a width of 19×300 mm.

[0120] Example 1

[0121] 1. Materials and Methods

[0122] 1.1 Biological materials and reagents

[0123] The Cas9 plasmid was provided by Professor Hu Kangdi of Hefei University of Technology; the Cas9-positive plants (Cas9 tomato leaf 1 and Cas9 tomato leaf 2) and tomato leaves without Cas9 (tomato leaf 3) were provided by Professor Hu Kangdi of Hefei University of Technology; transgenic crops without Cas9, such as corn, rice, soybeans, tomato seeds, rapeseed seeds, and pepper seeds, were stored by the Hefei Customs Technical Center.

[0124] Cells and related reagents: DH5α competent cells were purchased from Nanjing Qingke Biotechnology Co., Ltd.; kanamycin sulfate solution (BL611A) was purchased from Beijing Lanjieke Technology Co., Ltd.; plasmid extraction kit (DC201-01) was purchased from Nanjing Novozyme Biotechnology Co., Ltd.

[0125] Culture medium: LB agar medium and LB broth medium were purchased from Qingdao Haibo Biotechnology Co., Ltd.

[0126] PCR amplification reagents: 2X Rapid Taq Master Mix (P222-01) was purchased from Novozymes Biotechnology Co., Ltd.; MonAmp 2X Fast Mighty PCR Mix (MP22201) was purchased from Mona Biotechnology Co., Ltd.; 2X San TaqFast PCR Mix (B532062-0005) was purchased from Shanghai Shenggong Biotechnology Co., Ltd.; SapphireAMP Fast PCRMaster Mix (RR350A) was purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.

[0127] Fluorescence quantitative PCR amplification reagent: Premix Ex Taq TM (Probe qPCR) (RR390A) was purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.

[0128] Plant nucleic acid extraction kit: DNeasy Plant Mini Kit (69104) was purchased from QIAGEN. Test strip related materials: conjugate pad, sample pad, polyvinyl chloride (PVC) adhesive backing pad, nitrocellulose (NC) membrane and absorption pad were purchased from Shanghai Jie Ning Biotechnology Co., Ltd. (Shanghai, China). Antibodies and related reagents: digoxin antibody, goat anti-mouse monoclonal antibody and bovine serum albumin (BSA) were purchased from Shanghai Sangon Biotechnology Co., Ltd. (Shanghai, China). Chloroauric acid tetrahydrate (HAuCl4·4H2O) and streptavidin (SA) were purchased from Shanghai Bailingwei Technology Co., Ltd. (Shanghai, China).

[0129] Other common reagents, such as potassium carbonate, sucrose, sodium dodecyl sulfate (SDS), trisodium citrate, and polyethylene glycol (PEG), were of analytical grade and purchased from Sinopharm Chemical Reagent Co., Ltd. (Nanjing, China).

[0130] 1.2 Main instruments and equipment

[0131] KYC-100C air constant temperature shaker was purchased from Shanghai Huyueming Scientific Instrument Co., Ltd.;

[0132] BINDER BD56 biochemical incubator was purchased from BINDER, Germany;

[0133] Metal bath K20 / K10 was purchased from Hangzhou Aosheng Co., Ltd.;

[0134] The vortex mixer QL-866 was purchased from Chilin Bell Company;

[0135] The ultra-micro-volume UV spectrophotometer Nano drop 2000 was purchased from Thermo Fisher Scientific, Germany;

[0136] Fluorescence quantitative PCR instrument ABI7500 was purchased from ABI Company, USA;

[0137] PCR amplifier Veriti was purchased from ABI, USA;

[0138] The electronic balance CP2202S was purchased from Sartorius, Germany;

[0139] Clean bench ACB-6A1 was purchased from ESCO Company in Singapore;

[0140] The biological safety cabinet AC2-6S1 was purchased from ESCO Company, Singapore;

[0141] Capillary electrophoresis instrument Qiaxcel was purchased from QIAGEN;

[0142] The centrifuge Minispin plus was purchased from Eppendorf, Germany;

[0143] The heating magnetic stirrer RCT was purchased from Guangzhou Yike Experimental Technology Co., Ltd.;

[0144] Constant temperature water bath WNB-7-45 was purchased from Memmert Company, USA;

[0145] The electric constant temperature air drying oven FD240 was purchased from BINDER, Germany;

[0146] The film spraying instrument XYZ3060 was purchased from BIODOT;

[0147] The strip cutting machine CM4000 was purchased from BIODOT;

[0148] The grinding machine TH-24 was purchased from Shanghai Jingxin Industrial Development Co., Ltd.;

[0149] 1.3 Primer sequences

[0150] Considering specificity, sensitivity and primer dimers, a pair of primers for detecting CRISPR / Cas9 gene editing elements (accession number: KR029109.1) was selected from multiple primers and modified with end-labeling to be used with LFS. At the same time, a pair of primers and probes were selected for this sequence to compare and verify the sensitivity of the PCR method. Primers used in combination with LFS were designed in combination with the pUC57 sequence. All primers and probes were synthesized by Shanghai Sangon Biotech Co., Ltd. (Shanghai, China), and the detailed sequences are shown in Table 1.

[0151] Table 1 Primers and probes

[0152]

[0153]

[0154] in,

[0155] SEQ ID NO.1 is Digoxin-GAGAACGGTCGTAAGAGGATG;

[0156] SEQ ID NO.2 is Biotin-GAACCCTTGAGCTTCTCGTAG;

[0157] SEQ ID NO.3 is GTCAACGTACATATCCCTACCG;

[0158] SEQ ID NO.4 is AGCGCATGAAGAGGATTGAG;

[0159] SEQ ID NO. 5 is FAM-CGAGAACACCCAGCTCCAGAACG-TAMRA.

[0160] Preparation of probe primers and amplification internal standards: Centrifuge the newly synthesized primer probe at high speed for 5 seconds in a centrifuge, centrifuge the powder on the tube wall to the bottom of the tube, add 100 μL of nuclease-free water to the centrifuge tube, shake up and down, and centrifuge at high speed for 5 seconds to obtain 10 μM upstream and downstream primers and probes, and store them in a -20°C refrigerator. The probe needs to be protected from light.

[0161] 1.4 Plasmid construction and extraction

[0162] The purified plasmid was transformed into DH5α competent cells. The transformation steps are as follows:

[0163] (1) Take out the DH5α competent cells from -80°C, add all the plasmid DNA solution into the DH5α competent cells in a clean bench, mix gently, and place the competent cells on ice for 30 minutes;

[0164] (2) Heat shock the centrifuge tube in a 42°C water bath for 90 seconds, then quickly place it in an ice bath for 2 minutes;

[0165] (3) Add 200 L of non-resistant liquid LB medium and spread it on an LB plate containing ampicillin resistance. After spreading, place the plate in a 37°C constant temperature incubator for 12-16 h. When a single colony grows on the plate, pick the bacteria. After picking, culture the plate on a shaker at 37°C, 250 rpm / min for 14-16 h, and then extract the plasmid.

[0166] The steps for plasmid extraction are as follows:

[0167] (1) Take 1-5 mL of bacterial culture and collect the cells in a 1.5 mL EP tube by centrifugation at 10,000 rpm for 1 min, and discard the supernatant LB medium;

[0168] (2) Add 250 μL of buffer P1 (containing RNase A) to the bacterial pellet and resuspend the cells;

[0169] (3) Continue to add 250L of buffer P2 to the centrifuge tube and gently invert it to mix well to fully lyse the bacteria;

[0170] (4) Add 350 L of P3 to step (3) and immediately gently invert the tube to allow P3 to neutralize the P2 lysate. A white flocculent precipitate should appear. Centrifuge at 12,000 rpm for 10 min.

[0171] (5) Transfer the supernatant of the centrifuged product to a FastPure DNAMini Columns adsorption column with a waste liquid collection tube, being careful not to aspirate the precipitate, centrifuge at 12000 rpm for 30 seconds, and discard the waste liquid in the collection tube;

[0172] (6) Add PW2 diluted with anhydrous ethanol to the adsorption column to clean the ionic substances in the column, discard PW2 by centrifugation at 12000 rpm for 30 seconds, and repeat this step;

[0173] (7) The residual washing liquid in the adsorption column was completely removed by evaporation at 12000 rpm for 2 min;

[0174] (8) Place the adsorption column in a clean 1.5 mL EP tube and add 50 L of Elution buffer to the center of the membrane of the adsorption column to elute the DNA. After standing at room temperature for 1 min, centrifuge at 12,000 rpm for 1 min to obtain the target plasmid.

[0175] (9) The concentration of the extracted plasmid is measured by an ELISA reader and then the gene is sequenced.

[0176] 1.5 PCR test strip preparation

[0177] 1.5.1 Reagent configuration

[0178] Prepare 200 mL of 1 mol / L Tris-HCl solution with a pH of 8.0 using ultrapure water and store at room temperature;

[0179] Prepare 100 mL of 10% sucrose solution with ultrapure water and store in a refrigerator at 2-8°C;

[0180] Prepare 50 mL of 10% BSA solution with ultrapure water and store at 2-8°C;

[0181] Prepare 10 mL of 0.1 mol / L potassium carbonate solution with ultrapure water and store at room temperature;

[0182] Prepare 100 mL of 1% trisodium citrate solution with ultrapure water and store at room temperature;

[0183] Prepare 10 mM PB with ultrapure water;

[0184] Solution A (0.2 mol / L sodium dihydrogen phosphate aqueous solution), Solution B (0.2 mol / L sodium dihydrogen phosphate aqueous solution),

[0185] 0.95 mL of solution A and 4.05 mL of solution B were added to 95 mL of ultrapure water to mix into 10 mM PB, and stored in a 100 mL wide-mouth bottle with a lid at room temperature;

[0186] Preparation of chloroauric acid solution: Dissolve 1g chloroauric acid in 200mL ultrapure water to prepare 5g / L chloroauric acid solution, and store in a brown wide-mouth bottle in a refrigerator away from light at a temperature of 2-8°C;

[0187] Goat anti-mouse secondary antibody (H+L) was diluted to 1 mg / mL in 10 mM PBS (1X).

[0188] 1.5.2 Colloidal gold production

[0189] (1) Bottle washing

[0190] Rinse the conical flask and magnetic stirrer to be used with tap water, and then wash them with distilled water for 3 times. Put the magnetic stirrer into the conical flask, add 2 / 3 of the volume of aqua regia into the flask (operate in a fume hood), seal it with a sealing film, and leave it overnight. Rinse the conical flask and magnetic stirrer soaked in aqua regia with tap water for 4 times, pure water for 4 times, ultrapure water for 4 times, and dry them.

[0191] (2) Gold Making

[0192] Add 196mL ultrapure water and 4mL chloroauric acid (5g / L) to a clean conical flask equipped with a magnetic stirrer and half-seal it with aluminum foil. Place the conical flask on a magnetic stirrer, turn on the stirrer, adjust the position of the conical flask so that the stirrer is located in the middle of the conical flask, and slowly increase the stirring speed to 1300±20r / min. After ensuring that the magnetic stirrer is stirring stably in the center of the conical flask, turn off the stirrer, stop stirring, adjust the heating knob to the maximum, and start heating. When the liquid in the bottle begins to boil violently, turn on the stirrer and quickly add 2.4mL trisodium citrate solution (1%) to the bottle at the same time. Continue heating and stirring. When the color of the liquid gradually changes from black to wine red and stabilizes, start timing, continue heating and stirring for 5 minutes, stop heating and stirring, cool naturally to room temperature, seal with sealing film, and store at 2-8°C.

[0193] 1.5.3 Preparation of colloidal gold conjugates

[0194] Take 1000μL colloidal gold and inject it into a 1.5mL conical centrifuge tube, add 7μL potassium carbonate solution (0.1mol / L), and vortex for 6s to mix. Add 5μL Anti-Digoxin (1mg / mL), vortex for 6s, and oscillate on a 3D rotating mixer for 60min; add 85μL BSA solution (10%), vortex for 6s; oscillate and seal on a 3D rotating mixer for 30min; centrifuge on a low-temperature high-speed centrifuge at r=10500r / min, t=4℃ for 15min.

[0195] Prepare the resuspension: After centrifugation, use a pipette to quickly aspirate 25 μL of the wine-red precipitate at the bottom and transfer it to a 200 μL PCR tube (Note: try to avoid aspirating the supernatant), add 10 μL of sucrose solution (10%), 50 μL of BSA solution (10%) and 25 μL of PBS (1X) to prepare the resuspension, vortex for 8 seconds, mix well and store at 4°C for later use (storage time should not exceed 2 hours).

[0196] 1.5.4 Preparation of gold label pad

[0197] Cut the VL98 polyester film into 6×300mm pre-treated strips, soak them in the gold label treatment solution for 2h, then dry them in an oven at 37℃ for 120min, and then cut them into 4×6mm gold label pads with a strip cutter; add the prepared resuspension solution onto the gold label pad with a pipette, 7μL / piece, and dry them at 37℃ for 60min.

[0198] 1.5.5 Preparation of NC membrane for base plate

[0199] Remove the 25×300mm adhesive tape reserved in the middle of the PVC base plate, and stick the cut 25×300mm NC film to the corresponding position in the middle of the PVC board. Gently press the two ends of the protective film of the NC film to make the PVC base plate slightly arched in the opposite direction to make the NC film completely fit. The configured C (sheep anti-mouse secondary antibody (H+L), 1mg / mL) and T (SA, 1mg / mL) line antibodies are sucked back from the marking needle of the film spray gold instrument into the marking duct, and the air sucked back in the marking duct is exhausted. After the exhaust is completed, wipe off the antibodies overflowed from the marking needle. The marking volume of C and T lines is set to 0.6μL / cm. After the marking is completed, clean the marking operation table in time. Place the PVC base plate with the marking completed in a paper box and dry it in an oven at 37℃ for 120min.

[0200] 1.5.6 Sample pad preparation

[0201] The glass fiber board was cut into strips with a width of 17×300 mm. After being soaked in the sample pad treatment solution for 120 min, it was placed in a paper box containing foam cotton and dried in an oven at 37°C for 120 min.

[0202] 1.5.7 Preparation of absorbent paper

[0203] Cut the cardboard into 19×300mm wide strips and set aside.

[0204] 1.5.8 Assembly

[0205] Sample pad assembly: The sample pad is attached flush with the PVC base plate. Remove the adhesive tape on one side of the 19 mm width of the PVC base plate. The sample pad is attached flush with the PVC base plate.

[0206] Assembly of absorbent paper: remove the adhesive tape on one side of the 17mm width PVC base plate, attach the absorbent paper to the corresponding position, with one side flush with the edge of the PVC base plate and the other side pressed onto the NC film (pressing size 2.0±0.3mm).

[0207] 1.5.9 Cutting

[0208] Place the assembled PVC board at the board inlet of the strip cutting machine, adjust the limit plate, and the gap is ≤0.5mm. Adjust the roller to press into the bottom plate, set the strip width to 4mm, put the cut test strips into a sealed bag, add desiccant, and seal it.

[0209] 1.5.10 Gold Label Pad Installation

[0210] Lift up the sample pad with tweezers, and then use another pair of tweezers to place the dried gold pad between the sample pad and the NC film, and adjust the overlapping size between the gold pad and the NC film to 2.0±0.2mm.

[0211] After the test strips are made, place them in a dry, cool place for future use.

[0212] 1.5.11 DNA extraction and PCR-LFS detection

[0213] After the plant samples were processed by a grinder, DNA was extracted. In this embodiment, a DNA kit (DNeasy PlantMini Kit) was used to extract DNA. The specific operation process was strictly in accordance with the requirements of the instructions. Nanodrop was used to determine the DNA concentration, and the PCR amplification system was configured according to different PCR kits.

[0214] PCR amplification was performed using a Veriti 96-well PCR instrument, and the following program was used initially: 95°C pre-denaturation for 5 min; 95°C denaturation for 15 s, 60°C annealing for 30 s, 72°C extension for 30 s, repeated for 30-40 cycles; and finally 72°C extension for 3 min. In order to detect the amplified DNA products of different samples, the amplified DNA products were pretreated and then directly dropped onto the prepared LFS. 6 μL of DNA amplification product was taken, 44 μL of 10 mM Tris-HCl (pH = 8.8) was added, and after mixing evenly, 50 μL of the mixture was dropped onto the sample pad of the LFS. After 10 min, the signals of the test area and the control area on the LFS were observed, and the PCR products were confirmed by capillary gel electrophoresis.

[0215] Example 2 Primer Applicability Verification

[0216] The principle of the PCR-LFS detection method constructed in this embodiment is that two modified primers are coupled with colloidal gold and the marker of the test strip test line respectively to achieve the purpose of color development of the test line. If the upstream and downstream primers produce primer dimers, they will also cause the test line to develop color, resulting in false positive consequences. Therefore, avoiding the generation of primer dimers is a key link in PCR-LFS detection. The modified and synthesized primers need to be verified for suitability, using plasmid standards as positive controls and sterile water as negative controls. After PCR amplification, the test strips and capillary gel electrophoresis are used to interpret the results.

[0217] Example 3 Optimization of PCR amplification system

[0218] The amplification system is crucial for the construction of the detection method. The method constructed in this embodiment takes into account the detection sensitivity while also taking into account the detection time. In order to screen the ideal amplification system, four rapid amplification systems were selected for optimization and verification, namely 2X Rapid Taq Master Mix (P222-01), MonAmp 2X Fast Mighty PCR Mix (MP22201), 2X San Taq Fast PCR Mix (B532062-0005) and SapphireAMP Fast PCR MasterMix (RR350A). The optimization factors include the number of amplification cycles and the 72°C extension time, where the optimization parameters for the number of amplification cycles are 30, 25, 23, and 20, and the optimization parameters for the extension time are 15s, 10s, 5s, 3s, and 2s. Each sample was repeated three times. The PCR products were interpreted by LFS and capillary gel electrophoresis, respectively.

[0219] Example 4 shows sensitivity comparison analysis

[0220] The PCR product of the positive control was diluted 10-fold using the nucleic acid diluent EASY Dilution (Takara Dalian, China). 6 μL of each dilution PCR product was used to read the results using LFS, and another 10 μL was used to read the results using capillary gel electrophoresis.

[0221] Example 5 Detection specificity verification

[0222] The construction method was validated specifically, including inclusive and exclusive tests. The samples tested in the inclusive test included positive plasmids and two Cas9-positive tomato leaves. The samples in the exclusive test included one non-transgenic tomato leaf, one copy of other transgenic crops without Cas9, such as corn, rice, soybean, tomato seeds, rapeseed seeds, and pepper seeds. Negative controls were also set up. To ensure the accuracy of the experimental results, capillary gel electrophoresis was used to compare and verify the PCR results.

[0223] Example 6 Detection Sensitivity Analysis

[0224] After the concentration of the positive plasmid was measured by a spectrophotometer, the nucleic acid diluent EASY Dilution (Takara, Dalian, China) was used to make a 10-fold gradient dilution to obtain a 100-10-9 gradient dilution. The detection sensitivity was analyzed by PCR capillary gel electrophoresis, PCR-LFS and fluorescent quantitative PCR. The conventional PCR group used capillary gel electrophoresis to interpret the detection results; the PCR-LFS group used LFS to interpret the detection results; the DNA extraction and PCR amplification procedures were the same as in Example 1.

[0225] Example 7 Actual sample detection

[0226] Positive tomato leaf samples containing Cas9 and negative tomato leaf samples not containing Cas9 were prepared in different mass ratios to obtain mixed samples of 1:20, 1:21, 1:22, 1:23, 1:24, 1:25, 1:26, 1:27, 1:28, 1:29, 1:210, 1:211, 1:212, 1:213, 1:214, and 1:215, and negative controls, blank controls, and positive controls were set up and detected by PCR capillary gel electrophoresis and PCR-LFS, respectively. The DNA extraction and PCR amplification procedures were the same as in Example 1.

[0227] In this example, each test sample was tested in triplicate.

[0228] Example 8 Data Analysis

[0229] Statistical analysis was performed using GraphPad Prism v5.0 software. The least significant difference (LSD) method was used to compare the differences in values ​​(p = 0.05).

[0230] Example 9 Results and Analysis

[0231] 1. Plasmid Standard Verification

[0232] After the plasmid standard was prepared, its concentration and purity were determined. Figure 1 As shown; after sequencing and comparison analysis by NCBI, it was determined that the constructed plasmid standard sequence was 100% homologous to pYLCRISPR / Cas9Pubi-H.

[0233] 2. PCR-LFS detection

[0234] After PCR amplification is completed, take 6 μL of PCR product, add 54 μL of PBS, mix well, and slowly drip vertically into the sample well of the test strip. Leave at room temperature for 3-5 minutes, and read the results with the naked eye.

[0235] Positive: The control line (C line) of the test strip turns red, and the detection line (T line) turns red. The test result is positive, and the CRISPR / Cas9 gene editing element is detected.

[0236] Negative: The control line (C line) of the test strip turns red, and the test line (T line) does not change color. The test result is negative, indicating that no CRISPR / Cas9 gene editing elements were detected.

[0237] invalid:

[0238] (1) T line color development of negative control;

[0239] (2) The T line of the positive control was not colored;

[0240] (3) The C line is not colored.

[0241] The above three situations indicate that the operation process is wrong or the test strip is lost. Figure 2 .

[0242] 3.PCR Primer Verification

[0243] The primer verification results are as follows Figure 3 Figure A is the capillary gel electrophoresis result, and Figure B is the LFS detection result. The capillary gel electrophoresis results showed that the positive control well had a single band of 125bp in size, no nonspecific amplification band, and the negative control had no band; the LFS results showed that both the T line and the C line of the positive control sample were colored, and only the C line of the negative control sample was colored. In summary, the constructed primers can achieve the expected purpose, specifically amplify the 125bp target band on the pYLCRISPR / Cas9Pubi-H gene, and will not produce primer dimers, meeting the special requirements of the PCR-LFS detection method constructed in this application for primers.

[0244] 4. Optimization of PCR amplification system

[0245] LFS has the advantage of rapid on-site visualization, while conventional PCR amplification procedures often take a long time, about 60-90 minutes, which seriously hinders the practicality of the PCR-LFS detection system. In order to construct an efficient PCR-LFS detection system, this application selects efficient amplification systems of different brands for optimization and verification. The optimization factors select the number of amplification cycles and the 72°C extension time. In the optimization of the number of amplification cycles, the 72°C extension time is 15s; then the 72°C extension time optimization test is carried out with the obtained optimal number of amplification cycles. The amplified product was subjected to capillary gel electrophoresis to determine the DNA concentration of the target band and determine the amplification efficiency. The optimization data is shown in Table 2. After comprehensively analyzing the concentration of the amplified product and the amplification time, the PCR amplification reagent 2X Rapid Taq Master Mix (P222-01) was selected for subsequent verification, and the amplification system was 95°C 3min, (95°C 15s, 50°C 15s, 72°C 5s) × 30cycles, 72°C 3min, and stored at 4°C.

[0246] Table 2 PCR amplification system optimization test data

[0247]

[0248] Different letters in the same row indicate significant differences (p < 0.05);

[0249] The same letters in the same row indicate no significant differences (p>0.05);

[0250] Different letters in the same column indicate significant differences (p < 0.05);

[0251] The same letters in the same column indicate no significant difference (p>0.05)

[0252] 5. Display sensitivity comparison analysis

[0253] As result reporting tools, test strips and gel electrophoresis are key links in the detection system. Their ability to display test results is directly related to the sensitivity of the detection system. Compared with capillary gel electrophoresis, test strips are more efficient, cheaper, and easier to carry. Figure 4 , where 4A is the test strip display result, and 4B is the capillary gel electrophoresis display result. Figure 4 It can be seen that in Figure A, A01-A03 test strips have clear strips on the detection line, while A09 still has a fuzzy strip, and its display sensitivity reaches 10 -8 Dilution; In Figure B, clear target bands can be seen in lanes B02-B03, and fuzzy target bands can also be seen in lane B09, and the display sensitivity is 10 -7It can be concluded that the test strip constructed in the present application has more advantages in display sensitivity than capillary electrophoresis.

[0254] 6. Detection Specificity Verification

[0255] To verify the accuracy of the constructed method, specificity studies were conducted. Based on actual testing needs, plasmid standards and two positive plants were selected in the inclusive validation, and common transgenic crops that do not contain Cas9, such as corn, rice, soybeans, tomato seeds, rapeseed seeds, and pepper seeds, were selected in the exclusive validation. The test results are as follows Figure 5 The standard plasmid and two Cas9-positive tomatoes tested positive; the non-transgenic tomato leaves, corn, rice, soybeans, tomato seeds, rapeseed seeds, pepper seeds and other transgenic crops that do not contain Cas9 and the blank control tested negative.

[0256] 7. Detection Sensitivity Analysis

[0257] The concentration of the plasmid standard was 33.9 ng / μL as measured by spectrophotometer. Figure 1 As shown, the converted plasmid concentration is 1.75×10 9 copies / μL, the three methods were used to test the gradient dilution of plasmid standards, and the results were as follows Figure 6 PCR-LFS in A09(10 -8 The detection line fuzzy bands can still be seen at B09 (10 dilution), and the detection sensitivity can reach 17.5 copies / μL; PCR capillary gel electrophoresis -7 dilution) fuzzy bands can be seen, and the detection sensitivity is 1.75×10 2 copies / μL; Fluorescence quantitative PCR at 10 0 -10 -5 The amplification curve can be seen at the dilution, but no amplification curve can be seen at other dilutions and negative controls. The detection sensitivity is 1.75×10 4 copies / μL.

[0258] 8. Sample testing

[0259] In order to verify the detection ability of the constructed method for actual samples, this example uses mixed samples with different mass ratios to carry out comparative analysis. On the one hand, the difference between PCR-LFS and PCR capillary gel electrophoresis in actual sample detection is compared, and on the other hand, the detection limit of PCR-LFS for actual samples is analyzed. The verification results show that the detection ability of the PCR-LFS constructed in this application for actual samples is better than that of PCR capillary gel electrophoresis, such as Figure 7 PCR-LFS in positive samples with a mass ratio of 1:2 13 Fuzzy bands can still be seen on the detection line, while the PCR capillary gel electrophoresis has a positive sample mass ratio of 1:210 The detection limit of PCR-LFS for transgenic tomato leaf samples can reach 0.012% (mass fraction), while the detection limit of PCR capillary for transgenic tomato leaf samples is 0.1% (mass fraction).

[0260] Although the present invention has been described in detail above by general description and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made to the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all belong to the scope of protection claimed by the present invention.

Claims

1. A rapid detection technology for gene editing elements CRISPR / CAS9 based on PCR-LFS, characterized in that: The following steps are involved: S1. Select plant samples, prepare plasmid standards, design and synthesize primers, prepare probes, and prepare colloidal gold; S2. Construct a plasmid containing CRISPR / Cas9 gene editing elements, then transform the plasmid through DH5α competent cells, and finally extract the plasmid and measure the concentration; S3. Preparation of PCR test strips; S4. Extract DNA from plant samples and perform PCR amplification and detection; S5. Optimization and verification of PCR-LFS detection technology.

2. The PCR-LFS-based gene editing element CRISPR / CAS9 rapid detection technology according to claim 1, characterized in that: The S3 comprises the following specific steps: S31. Reagent preparation: Use ultrapure water to prepare 200 mL of 1 mol / L pH 8.0 Tris-HCl buffer, 10 mL of 0.1 mol / L potassium carbonate solution, 100 mL of 1% trisodium citrate solution, 10 mM PB, and 5 g / L chloroauric acid solution; Dilute the goat anti-mouse secondary antibody to 1 mg / mL with 10 mM PBS; S32. Colloidal gold preparation: The conical flask and magnetic stirring bar were cleaned with tap water and distilled water respectively, and then the magnetic stirring bar was placed in the conical flask, soaked in aqua regia overnight, and then the conical flask and magnetic stirring bar were cleaned with tap water, pure water, and ultrapure water in turn, and then dried; Add 196 mL of ultrapure water and 4 mL of 5 g / L chloroauric acid to a clean conical flask, place it on a magnetic stirrer, stir it, and then heat it. Quickly add 2.4 mL of 1% trisodium citrate solution to the flask, continue heating and stirring until the liquid changes color to wine red, continue heating and stirring for 5 minutes, then cool it to room temperature, seal it with a sealing film, and store it at 2-8°C; S33. Preparation of colloidal gold conjugate: Take 1000 μL of colloidal gold and inject it into a 1.5mL conical centrifuge tube, add 7 μL of 0.1mol / L potassium carbonate solution, shake and mix, then add 5 μL of 1mg / mL Anti-Digoxin, shake and mix, and shake on a 3D rotating mixer for 60 minutes, then add 85 μL of 10% BSA solution, shake and mix, then shake and seal on a 3D rotating mixer for 30 minutes, centrifuge at 10500r / min at 4°C on a low-temperature high-speed centrifuge for 15 minutes, after the centrifugation, quickly aspirate 25 μL of wine red precipitate and transfer it to a 200 μL PCR tube, add 10 μL of 10% sucrose solution, 50 μL of 10% BSA solution and 25 μL PBS to prepare a resuspension, shake on a vortex for 8 seconds, mix and store at 4°C for later use; S34. Preparation of gold label pad: VL98 polyester film was cut into pre-treated strips, soaked in gold label treatment solution for 2 h, then dried in an oven at 37°C for 120 min, and then cut into 4×6 mm gold label pads using a strip cutter. The prepared resuspension solution was transferred and dropped onto the gold label pad at 7 μL / strip, and dried at 37°C for 60 min. S35. Preparation of NC film on the bottom plate: remove the adhesive tape reserved in the middle of the PVC bottom plate, stick the cut NC film on the corresponding position in the middle of the PVC rubber plate, suck the prepared C and T line antibodies from the marking needle of the film spraying instrument into the marking conduit, expel the air sucked in the marking conduit and wipe off the antibodies overflowing from the marking needle, set the C and T line marking volume to 0.6 μL / cm, and dry the PVC bottom plate after marking; S36. Sample pad preparation: Cut the glass fiber board and cardboard into long strips, soak the sample pad in the treatment solution for 120 min and dry it for later use; S37. Assembly: Remove the adhesive tape on the 19 mm width side of the PVC base plate, and place the sample pad flush with the PVC base plate. Then remove the adhesive tape on the 17 mm width side of the PVC base plate, and place one side of the absorbent paper flush with the edge of the PVC base plate, and press the other side onto the NC film for bonding. S38. Cutting: Cut the assembled PVC board into 4 mm width strips, put the cut test strips into a sealed bag, add desiccant, and seal; S39. Installation of gold label pad: lift up the sample pad with tweezers, and then use another pair of tweezers to place the dried gold pad between the sample pad and the NC membrane, and adjust the overlapping size of the gold label pad and the NC membrane to 2.0±0.2mm. After the test strip is made, place it in a dry and cool place for storage.

3. The PCR-LFS-based gene editing element CRISPR / CAS9 rapid detection technology according to claim 1, characterized in that: The specific steps for preparing the probe primers and amplification internal standards in S1 are as follows: centrifuge the newly synthesized primer probe at high speed for 5 seconds in a centrifuge, centrifuge the powder on the tube wall to the bottom of the tube, add 100 μL of nuclease-free water to the centrifuge tube, shake up and down, and centrifuge at high speed for 5 seconds in a centrifuge to obtain 10 μM upstream and downstream primers and probes, and store them in a -20°C refrigerator. The probe needs to be protected from light.

4. The PCR-LFS-based gene editing element CRISPR / CAS9 rapid detection technology according to claim 3, characterized in that: The primer pair in S1 includes a first primer pair, a second primer pair and a probe: The first primer pair includes a forward primer as shown in SEQ ID NO.1 and a reverse primer as shown in SEQ ID NO.2; The second primer pair includes a forward primer as shown in SEQ ID NO.3 and a reverse primer as shown in SEQ ID NO.4; The probe includes a nucleotide sequence as shown in SEQ ID NO.

5.

5. The PCR-LFS-based gene editing element CRISPR / CAS9 rapid detection technology according to claim 1, characterized in that: The step of transforming the purified plasmid into DH5α competent cells in S2 comprises the following specific steps: Take out DH5α competent cells from -80℃, add all the plasmid DNA solution into the competent cells in a clean bench, and mix gently. Place the competent cells on ice for 30 minutes, place the competent cell centrifuge tube in a 42℃ water bath for heat shock for 90 seconds, and then quickly place it on ice for 2 minutes. Finally, add 200L of non-resistant liquid LB to the competent cell centrifuge tube, and spread the mixed competent cells on the LB plate containing ampicillin resistance. After spreading, place the plate in a 37℃ constant temperature incubator and culture it for 12-16 hours until a single colony grows. Pick a single colony, inoculate it into a new non-resistant liquid LB culture medium, and culture it on a shaker at 37℃, 250rpm / min for 14-16 hours.

6. The PCR-LFS-based gene editing element CRISPR / CAS9 rapid detection technology according to claim 5, characterized in that: The plasmid extraction steps in S2 are as follows: Take 1-5mL of bacterial solution and centrifuge at 10000rpm for 1min. Collect the bacteria in a 1.5mL EP tube and discard the supernatant LB medium. Add 250L buffer P1 to the bacterial precipitate to resuspend the bacteria. Then add 250L buffer P2 to the centrifuge tube and gently invert it to mix. Then add 350L buffer P3 and immediately invert it gently until white flocculent precipitate appears. Centrifuge at 12000rpm for 10min. Transfer the supernatant of the centrifuged product to a FastPure DNA Mini Columns adsorption column with a waste liquid collection tube, centrifuge at 12000rpm for 30s, and discard the waste liquid in the collection tube. Then add PW2 diluted with anhydrous ethanol to the adsorption column to wash the ionic substances in the column, discard PW2 by centrifugation at 12000rpm for 30s, and repeat this step. Completely remove the residual washing liquid in the adsorption column by empty centrifugation at 12000rpm for 2min. Place the adsorption column in a clean 1.5mL EP tube, and add 50L Elution buffer to the center of the membrane of the adsorption column to elute the DNA. Let it stand at room temperature for 1min and centrifuge at 12000 rpm for 1min. The result is the target plasmid.

7. The PCR-LFS-based gene editing element CRISPR / CAS9 rapid detection technology according to claim 1, characterized in that: The S4 specifically includes the following steps: S41. DNA extraction: After the plant samples were processed by a grinder, DNA was extracted using a DNA kit, and the DNA concentration was measured using Nanodrop; S42. Amplify using a Veriti 96-well PCR instrument. The procedure is as follows: Pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, repeat for 30-40 cycles; final extension at 72°C for 3 min; S43. PCR product detection: Take 6 μL of DNA amplification product, add 44 μL of 10 mM Tris-HCl and mix well, and drop 50 μL of the mixture on the sample pad of LFS. After 10 minutes, observe the signals of the test area and control area on the LFS, and confirm the PCR product by capillary gel electrophoresis.

8. The PCR-LFS-based gene editing element CRISPR / CAS9 rapid detection technology according to claim 1, characterized in that: The S5 includes: PCR amplification system optimization, display sensitivity comparison analysis, detection specificity verification, detection sensitivity analysis, actual sample detection and data analysis.

9. The PCR-LFS-based gene editing element CRISPR / CAS9 rapid detection technology according to claim 2, characterized in that: The C-line antibody in the S35 is 1 mg / mL goat anti-mouse secondary antibody, and the T-line antibody is 1 mg / mL streptavidin.

10. The PCR-LFS-based gene editing element CRISPR / CAS9 rapid detection technology according to claim 2, characterized in that: The S36 fiberglass board is cut into strips with a width of 17×300 mm, and the cardboard is cut into strips with a width of 19×300 mm.

Images