Bacterial cell disruption preparation and method

Abstract

The invention relates to a bacterial cell disruption preparation and method. Escherichia coli for expressing lysozyme is adopted to disrupt bacterial cells to be disrupted. The method comprises the following steps: adding escherichia coli expressing lysozyme into a breaking system of bacteria to be broken, and cracking the bacteria to be broken by combining the effects of a surfactant, freezing and the like in the breaking process; the method is simple, efficient, mild in condition and low in cost.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a bacterial cell disruption preparation and method. Background Art

[0002] Escherichia coli is currently the most widely used prokaryotic expression host. When Escherichia coli expresses foreign proteins, they are generally present in the intracellular or periplasmic space. To obtain recombinant proteins, the cells must be firstly broken. Usually, the more effective methods of breaking are physical methods such as high-pressure homogenization, bead milling and ultrasonic breaking. However, these are relatively violent breaking methods. The shear force and temperature rise generated during the breaking process have the risk of denaturing the target product, and the energy consumption is relatively high, requiring special mechanical equipment. Other methods such as chemical permeation and freeze-thaw methods have very low efficiency in breaking Escherichia coli.

[0003] There are currently two methods for enzymatic disruption of E. coli based on various lysozymes: (1) Direct use of lysozyme to disrupt E. coli. The conditions are mild and can effectively reduce protein denaturation, but the price of lysozyme is relatively high and the disruption cost is high; (2) Lysozyme is expressed in the E. coli that needs to be disrupted, and the recombinant protein and lysozyme are expressed simultaneously in E. coli. After freeze-thaw or treatment with surfactants, low-concentration organic solvents such as chloroform, the cells are lysed to release intracellular proteins. This method does not require the direct addition of lysozyme and is low in cost, mild, and has a high disruption efficiency. However, lysozyme and recombinant protein are expressed simultaneously in E. coli, and the expression of lysozyme will interfere with the expression of recombinant protein. During the growth of E. coli, a small amount of lysozyme leaks, which will reduce the growth rate of E. coli and affect the growth of E. coli and the expression of recombinant protein.

[0004] Therefore, it is currently necessary to research and develop a low-cost, mild, and efficient E. coli disruption method that will not affect the growth of E. coli and the expression of recombinant proteins. Summary of the invention

[0005] The object of the present invention is to provide a bacterial cell disruption preparation and method. The method is simple and efficient for bacterial cell disruption, has mild conditions and is low in cost.

[0006] The principle of the present invention is to express lysozyme in Escherichia coli cells. Since the lysozyme in the cytoplasm does not contact the cell wall outside the cell membrane, it will not have a very extreme adverse effect on the growth of bacteria. Other Escherichia coli to be broken are mixed with the Escherichia coli expressing lysozyme. Under the action of surfactants, metal complexing agents, organic solvents, freeze-thaw and other methods, the lysozyme in the cells containing lysozyme will be released, thereby hydrolyzing the bacterial wall of the Escherichia coli to be broken without lysozyme, and the combined action leads to the breaking of the Escherichia coli cells to be broken.

[0007] To this end, the first aspect of the present invention provides a bacterial cell disruption preparation, which comprises Escherichia coli cells expressing lysozyme and / or crude lysozyme produced by Escherichia coli cells expressing lysozyme as a main bacterial cell disruption agent, wherein the lysozyme is an enzyme capable of hydrolyzing peptidoglycan.

[0008] In some embodiments of the present invention, the lysozyme comprises one or more of T4 lysozyme, T7 lysozyme and λ lysozyme.

[0009] According to the present invention, the cell disruption preparation further comprises a cell disruption aid, which includes one or more of a cell disruption fluid viscosity reducing preparation, a surfactant, a metal complexing agent, a tris buffer and an organic solvent.

[0010] In some embodiments of the present invention, the cell disruption fluid viscosity reducing preparation includes one or more of a nuclease that non-specifically hydrolyzes DNA, an Escherichia coli cell expressing a nuclease that non-specifically hydrolyzes DNA, and a crude nuclease produced by an Escherichia coli cell expressing a nuclease that non-specifically hydrolyzes DNA.

[0011] The second aspect of the present invention provides a cell disruption method, which uses the cell disruption preparation as described in the first aspect of the present invention to disrupt the bacteria to be disrupted.

[0012] In the present invention, the bacteria to be disrupted include Gram-negative bacteria and / or Gram-positive bacteria.

[0013] According to the present invention, the cell disruption method comprises mixing a suspension of bacteria to be disrupted with a cell disruption preparation to form a cell disruption system, and then performing a cell disruption treatment to lyse the bacteria to be disrupted.

[0014] According to the present invention, in the cell disruption system, the bacterial suspension to be disrupted is mixed with the Escherichia coli suspension expressing lysozyme to form a mixed bacterial suspension.

[0015] In some embodiments of the present invention, in the mixed bacterial suspension, the ratio of the concentration of the Escherichia coli suspension expressing lysozyme to the concentration of the bacteria to be disrupted is ≥1:5000.

[0016] In the present invention, the cell disruption preparation comprises Escherichia coli cells expressing lysozyme and / or crude lysozyme produced by Escherichia coli cells expressing lysozyme as a main agent for bacterial cell disruption, wherein the lysozyme is an enzyme capable of hydrolyzing peptidoglycan.

[0017] In some embodiments of the present invention, the lysozyme includes but is not limited to one or more of T4 lysozyme, T7 lysozyme and λ lysozyme.

[0018] According to the present invention, the cell disruption preparation further comprises a cell disruption aid, which includes one or more of a cell disruption fluid viscosity reducing preparation, a surfactant, a metal complexing agent, a tris buffer and an organic solvent.

[0019] In the present invention, the surfactant includes but is not limited to one or more of alkyl glycoside APG0814, alkyl glycoside APG0810 and Triton X-100; preferably, the working concentration of the surfactant in the present invention includes but is not limited to 0-5% (w / v).

[0020] In the present invention, the metal complexing agent includes but is not limited to EDTA and the like; preferably, the working concentration of the metal complexing agent includes but is not limited to 0-30 mM.

[0021] In the present invention, the organic solvent includes but is not limited to toluene and / or chloroform, etc.; preferably, the working concentration of the organic solvent includes but is not limited to 0-2% (v / v).

[0022] Preferably, the concentration of the tris buffer includes but is not limited to 0-100 mM.

[0023] As mentioned above, the principle of the present invention is to express lysozyme in E. coli cells. Since the lysozyme in the cytoplasm does not contact the cell wall outside the cell membrane, it will not have a very extreme adverse effect on the growth of bacteria.

[0024] In some specific examples of the present invention, Escherichia coli expressing lysozyme is used to disrupt the bacteria to be disrupted, and a bacterial suspension of the bacteria to be disrupted is mixed with a bacterial suspension of Escherichia coli expressing lysozyme to form a mixed bacterial suspension, to which one or more cell disruption aids such as surfactants, metal chelators, tris buffer, and organic solvents are added. Under the action of the cell disruption aid, the lysozyme in the cells containing lysozyme will be released, thereby hydrolyzing the bacterial wall of the Escherichia coli to be disrupted that does not contain lysozyme, and the combined action leads to the disruption of the Escherichia coli cells to be disrupted.

[0025] In some specific examples, the Escherichia coli expressing lysozyme includes but is not limited to Escherichia coli containing a DNA sequence of the T4 lysozyme target sequence designed according to Escherichia coli codon optimization (as shown in SEQ ID NO.1), and Escherichia coli containing a DNA sequence of the T7 lysozyme target sequence designed according to Escherichia coli codon optimization (as shown in SEQ ID NO.3).

[0026] In some specific examples, the cell disruption aid also includes a cell disruption fluid viscosity reducing agent, which can reduce the viscosity of the cell disruption fluid during the cell disruption process, is beneficial to cell disruption, and is convenient for the processing of the disruption fluid.

[0027] In the present invention, the cell disruption fluid viscosity reducing preparation comprises one or more of a nuclease that non-specifically hydrolyzes DNA, an Escherichia coli cell expressing a nuclease that non-specifically hydrolyzes DNA, and a crude nuclease produced from an Escherichia coli cell expressing a nuclease that non-specifically hydrolyzes DNA.

[0028] Preferably, the cell lysis fluid viscosity reducing preparation comprises Escherichia coli bacteria expressing a nuclease that non-specifically hydrolyzes DNA and / or a crude nuclease produced from Escherichia coli bacteria expressing a nuclease that non-specifically hydrolyzes DNA.

[0029] Preferably, the nuclease that non-specifically hydrolyzes DNA includes one or more of universal nuclease, Staphylococcus aureus nuclease B and deoxyribonuclease I.

[0030] Further preferably, in the cell disruption system, the ratio of the concentration of the viscosity reducing agent to the bacterial concentration in the bacterial suspension containing the bacteria to be disrupted is ≥ 1:200,000.

[0031] In some specific examples, the Escherichia coli expressing a nuclease that non-specifically hydrolyzes DNA includes but is not limited to an Escherichia coli designed according to codon optimization of Escherichia coli containing a DNA sequence of a universal nuclease target sequence derived from Serratia marcescens (as shown in SEQ ID NO.2).

[0032] In some embodiments of the present invention, in the cell disruption system, the main cell disruption agent and the cell disruption auxiliary agent in the cell disruption preparation are added simultaneously or in batches.

[0033] Preferably, the system containing the bacteria to be disrupted is frozen during the cell disruption process.

[0034] The "system containing bacteria to be disrupted" in the present invention includes bacterial bodies of bacteria to be disrupted, bacterial suspension containing bacteria to be disrupted, and a mixed solution formed by mixing a bacterial suspension containing bacteria to be disrupted and a bacterial cell disruption preparation.

[0035] In some specific examples, the system containing the bacteria to be disrupted (eg, a mixed bacterial suspension) is frozen, thawed, and allowed to stand, and then the cells of the bacteria to be disrupted are disrupted.

[0036] The term "working concentration" in the present invention refers to the concentration of reactants or reagents in the reaction system.

[0037] The invention provides a bacterial cell disruption preparation and method. In the method, Escherichia coli expressing lysozyme and bacteria to be disrupted are two different bacterial bodies. The cell disruption of the invention does not require direct addition of lysozyme, and the use of Escherichia coli expressing lysozyme has low cost. There is no lysozyme in the bacterial cells to be disrupted, which will not affect the growth and protein expression of the bacterial cells to be disrupted. The cells can be disrupted gently and efficiently. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] The present invention will be described below with reference to the accompanying drawings.

[0039] Figure 1 The SDS-PAGE protein electrophoresis analysis results of Example 1 of the present invention are shown; wherein, M: protein marker; 1: total protein in the system; 2: crushed supernatant; 3: crushed precipitate.

[0040] Figure 2 The SDS-PAGE protein electrophoresis analysis results of Example 2 of the present invention are shown; wherein, M: protein marker; 1: total protein in the system; 2: crushed supernatant; 3: crushed precipitate.

[0041] Figure 3 The SDS-PAGE protein electrophoresis analysis results of Example 3 of the present invention are shown; wherein, M: protein marker; 1: total protein in the system; 2: crushed supernatant; 3: crushed precipitate.

[0042] Figure 4 The SDS-PAGE protein electrophoresis analysis results of Example 4 of the present invention are shown; wherein, M: protein marker; 1: total protein in the system; 2: crushed supernatant; 3: crushed precipitate.

[0043] Figure 5 The SDS-PAGE protein electrophoresis analysis results of Example 5 of the present invention are shown; wherein, M: protein marker; 1: total protein in the system; 2: crushed supernatant; 3: crushed precipitate.

[0044] Figure 6 The SDS-PAGE protein electrophoresis analysis results of Example 6 of the present invention are shown; wherein, M: protein marker; 1: total protein in the system; 2: crushed supernatant; 3: crushed precipitate.

[0045] Figure 7 The SDS-PAGE protein electrophoresis analysis results of Example 7 of the present invention are shown; wherein, M: protein marker; 1: total protein in the system; 2: crushed supernatant; 3: crushed precipitate. DETAILED DESCRIPTION

[0046] In order to make the present invention easy to understand, the present invention will be described in detail below in conjunction with the accompanying drawings. However, before describing the present invention in detail, it should be understood that the present invention is not limited to the specific embodiments described. It should also be understood that the terms used herein are only for describing specific embodiments and are not intended to be limiting.

[0047] Unless otherwise defined, all terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, preferred methods and materials are now described.

[0048] Example

[0049] In order to make the present invention easier to understand, the present invention will be further described in detail below in conjunction with the accompanying drawings and examples, which are merely illustrative and are not intended to limit the scope of application of the present invention. The raw materials or components used in the present invention can be obtained through commercial channels or conventional methods unless otherwise specified.

[0050] Example 1

[0051] 1) Obtain E. coli expressing T4 lysozyme

[0052] A DNA sequence containing the target sequence of T4 lysozyme was designed based on codon optimization of Escherichia coli (as shown in SEQ ID NO.1), the designed DNA sequence was chemically synthesized, and inserted into pET-28a(+) through XbaI and HindIII restriction sites to form a recombinant plasmid pET-T4Lys. The plasmid pET-T4Lys was transformed into Escherichia coli BL21 (DE3) (Beijing Biolab Technology Co., Ltd., Shanghai Yaji Biotechnology Co., Ltd.), and a single clone colony was picked and inoculated into 3 mL LB culture medium containing kanamycin (50 μg / mL), and cultured at 37°C 200rpm for 16 hours. Then, it was inoculated at a 1% inoculation ratio into 50 mL lactose induction medium (1% peptone, 0.5% yeast powder, 0.5% glycerol, 0.05% glucose, 0.2% α-lactose, 25mM Na2HPO4, 25mM KH2PO4, 50mM NH4Cl, 5mM Na2SO4, 2mM Mg2SO4) containing kanamycin (50 μg / mL). After culturing at 28°C 200rpm for 24 hours, the bacteria were collected by centrifugation to obtain Escherichia coli expressing T4 lysozyme, the bacteria were washed with water and resuspended, and the cell concentration of the bacterial suspension was adjusted to about 20OD at OD600.

[0053] 2) Obtaining Escherichia coli expressing universal nuclease

[0054] A DNA sequence containing the target sequence of the universal nuclease from Serratia marcescens (as shown in SEQ ID NO.2) was designed based on the codon optimization of Escherichia coli, the designed DNA sequence was chemically synthesized, and inserted into pET-28a(+) through the XbaI and EcoRI restriction sites to form a recombinant plasmid pET-nucA.

[0055] The plasmid pET-nucA was transformed into Escherichia coli BL21 (DE3), and a single clone colony was picked and inoculated into 3 mL LB culture medium containing kanamycin (50 μg / mL), and cultured at 37°C 200rpm for 16 hours. Then, it was inoculated into 50 mL lactose induction medium (1% peptone, 0.5% yeast powder, 0.5% glycerol, 0.05% glucose, 0.2% α-lactose, 25mM Na2HPO4, 25mM KH2PO4, 50mM NH4Cl, 5mM Na2SO4, 2mM Mg2SO4) containing kanamycin (50 μg / mL) at a 1% inoculation ratio. After culturing at 28°C 200rpm for 24 hours, the cells were centrifuged and collected to obtain Escherichia coli cells expressing the omnipotent nuclease. The cells were washed with water and resuspended, and the cell concentration of the bacterial suspension was adjusted to about 20OD OD600. A portion of the bacterial suspension was frozen at -70°C for storage.

[0056] A bacterial suspension of Escherichia coli expressing T4 lysozyme with an OD600 of 20 OD was mixed with a bacterial suspension of Escherichia coli expressing omnipotent nuclease with an OD600 of 20 OD at a volume ratio of 4:1 to form a disruption reagent, and the unused disruption reagent was frozen and stored at -70°C.

[0057] 3) Disruption of Escherichia coli BL21 (DE3) by Disruption Reagent

[0058] Escherichia coli BL21 (DE3) was inoculated into LB medium, cultured at 37°C and 200 rpm for 16 hours, and then the cells were harvested by centrifugation. The cells were washed twice with water and resuspended to obtain an Escherichia coli BL21 (DE3) bacterial suspension.

[0059] Prepare a 100 mM EDTA solution at pH 8.0 and a 10% surfactant alkyl polyglycoside APG0814 solution at pH 8.0.

[0060] Take the E. coli BL21 (DE3) bacterial suspension, add EDTA and alkyl glycoside APG0814, and form a total volume of 500 μL of the disruption system. The concentration of E. coli BL21 (DE3) in the system is 20OD, EDTA is 2mM, and APG0814 concentration is 0.5%. Add 10 μL of the above disruption reagent to the disruption system and mix well to disrupt. The bacterial suspension begins to become transparent after adding the disruption reagent, and becomes completely transparent after 20 minutes of standing. After 30 minutes, perform SDS-PAGE protein electrophoresis analysis on the total protein, lysis supernatant, and lysis precipitate of the system. The results are as follows Figure 1 As shown, the results show that under this disruption condition, Escherichia coli can be completely disrupted, the total protein in the system is consistent with the supernatant band, and there is no visible protein band in the disruption precipitate.

[0061] Embodiment 2:

[0062] Escherichia coli BL21 (DE3) was cultured in LB medium and harvested by centrifugation. The cells were washed twice with water and resuspended to obtain Escherichia coli BL21 (DE3) bacterial suspension. 500 μL of BL21 (DE3) bacterial suspension with an OD600 concentration of 25 OD was taken and 10 μL of 100 mM EDTA solution with a pH of 8.0 was added.

[0063] Then, the disrupting reagent frozen in Example 1 was taken, thawed, 10 μL was added to the above BL21 (DE3) bacterial suspension, mixed well, and then frozen at -70°C for 15 min.

[0064] The frozen broken system was taken out and thawed at room temperature. After it was completely thawed, 25 μL of 1M Tris-HCL buffer solution at pH 8.0 and 25 μL of 10% surfactant Triton X-100 were added, mixed, and allowed to stand for 30 minutes before SDS-PAGE protein electrophoresis analysis of the total protein, lysis supernatant, and lysis precipitate of the system was performed. The results are as follows: Figure 2 As shown, the results showed that Escherichia coli could be fully disrupted under this disruption condition, the total protein in the system was consistent with the supernatant band, and only trace protein bands existed in the disruption precipitate.

[0065] Embodiment 3:

[0066] Escherichia coli BL21 (DE3) was cultured in LB medium and harvested by centrifugation. The cells were washed twice with water and resuspended to obtain Escherichia coli BL21 (DE3) bacterial suspension. 500 μL of BL21 (DE3) bacterial suspension with an OD600 concentration of 25 OD was taken and frozen at -70°C for 15 min.

[0067] The frozen BL21 (DE3) bacterial suspension was taken out and thawed at room temperature, and the frozen disruption reagent in Example 1 was thawed. 10 μL of the thawed disruption reagent, 10 μL of 100 mM EDTA solution at pH 8.0, 25 μL of 1 M Tris-HCL buffer solution at pH 8.0, and 25 μL of 10% surfactant Triton X-100 were added to the thawed BL21 (DE3) bacterial suspension, mixed well, and allowed to stand for 30 minutes. The total protein, lysis supernatant, and lysis precipitate of the system were subjected to SDS-PAGE protein electrophoresis analysis. The results are shown as follows. Figure 3 The results showed that under this disruption condition, E. coli could be fully disrupted, the total protein in the system was consistent with the supernatant band, and only a few protein bands existed in the disruption precipitate.

[0068] Embodiment 4:

[0069] After culturing Escherichia coli BL21 (DE3) in LB medium, the cells were harvested by centrifugation, washed twice with water and resuspended to obtain an Escherichia coli BL21 (DE3) bacterial suspension. 500 μL of the BL21 (DE3) bacterial suspension with an OD600 concentration of 25 OD was taken, 10 μL of the thawed disruption reagent stored in Example 1 was added, and the mixed bacterial suspension was frozen at -70°C for 15 min.

[0070] The frozen bacterial suspension was taken out and thawed at room temperature, and 25 μL of 10% surfactant alkyl glycoside APG0814 solution at pH 8.0 was added and mixed. After 30 minutes, the total protein, lysis supernatant, and lysis precipitate were analyzed by SDS-PAGE protein electrophoresis. The results are as follows: Figure 4 The results showed that under this disruption condition, E. coli could be fully disrupted, the total protein in the system was consistent with the supernatant band, and only trace protein bands existed in the disruption precipitate.

[0071] Embodiment 5:

[0072] After culturing Escherichia coli BL21 (DE3) in LB medium, the cells were harvested by centrifugation, washed twice with water and resuspended to obtain an Escherichia coli BL21 (DE3) bacterial suspension. 500 μL of the BL21 (DE3) bacterial suspension with an OD600 concentration of 85 OD was taken, 35 μL of the thawed disruption reagent stored in Example 1 was added, and the mixed bacterial suspension was frozen at -70°C for 15 min.

[0073] The frozen bacterial suspension was taken out and thawed at room temperature, and 50 μL of 10% pH 8.0 surfactant alkyl glycoside APG0814 solution and 10 μL of 100 mM pH 8.0 EDTA solution were added and mixed. After 30 minutes, the total protein, lysis supernatant, and lysis precipitate were analyzed by SDS-PAGE protein electrophoresis. The results were as follows: Figure 5 The results showed that the E. coli was well disrupted under this disruption condition, most of the proteins in the cells were released into the disruption supernatant, and a small amount of protein bands existed in the disruption precipitate.

[0074] Embodiment 6:

[0075] 1) Obtain E. coli expressing T7 lysozyme

[0076] A DNA sequence containing the T7 lysozyme target sequence was designed based on the codon optimization of Escherichia coli (as shown in SEQ ID NO.3), and the designed DNA sequence was chemically synthesized and placed between the plasmid pET-28a(+) sequence 1 CGAGATCTCGATCCCGCGAAAT and the plasmid pET-28a(+) sequence 2 GTCTTGAGGGGTTTTTTGCTGAAA in a seamless cloning manner to form a recombinant plasmid pT7Lys.

[0077] The plasmid pT7Lys was transformed into Escherichia coli BL21 (DE3), and a single clone colony was picked and inoculated into 3 mL LB culture medium containing kanamycin (50 μg / mL), and cultured at 37°C 200 rpm for 16 hours. Then, it was inoculated into 50 mL lactose induction medium (1% peptone, 0.5% yeast powder, 0.5% glycerol, 0.05% glucose, 0.2% α-lactose, 25 mM Na2HPO4, 25 mM KH2PO4, 50 mM NH4Cl, 5 mM Na2SO4, 2 mM Mg2SO4) containing kanamycin (50 μg / mL) at a 1% inoculation ratio. After culturing at 28°C 200 rpm for 24 hours, the cells were collected by centrifugation to obtain Escherichia coli expressing T7 lysozyme, the cells were washed with water and resuspended, and the cell concentration OD600 of the bacterial suspension was adjusted to 20 OD.

[0078] 2) Disruption of Escherichia coli BL21(DE3)

[0079] After culturing Escherichia coli BL21 (DE3) in LB medium, the cells were harvested by centrifugation, washed with water and resuspended to obtain an Escherichia coli BL21 (DE3) suspension. 500 μL of the BL21 (DE3) suspension with an OD600 concentration of 20 OD was taken, 50 μL of the above-mentioned Escherichia coli suspension expressing T7 lysozyme and 2 μL of the Escherichia coli suspension expressing the totipotent nuclease in Example 1 were added, mixed and frozen at -70°C for 15 min.

[0080] The frozen bacterial suspension was taken out and thawed at room temperature, and 25 μL of 10% surfactant alkyl glycoside APG0814 solution at pH 8.0 and 10 μL of 100 mM EDTA solution at pH 8.0 were added and mixed. After 30 minutes, the total protein, lysis supernatant, and lysis precipitate of the system were analyzed by SDS-PAGE protein electrophoresis. The results are as follows: Figure 6 The results showed that under this disruption condition, E. coli could be completely disrupted, the total protein in the system was consistent with the supernatant band, and only trace protein bands existed in the disruption precipitate.

[0081] Embodiment 7:

[0082] A 10% solution of surfactant alkyl polyglycoside APG0810 was prepared at pH 8.0.

[0083] Escherichia coli BL21 (DE3) was cultured in LB medium and then centrifuged to harvest the cells. The cells were washed twice and then resuspended to obtain an Escherichia coli BL21 (DE3) bacterial suspension. 500 μL of the BL21 (DE3) bacterial suspension with an OD600 concentration of 25 OD was taken, 10 μL of the thawed disruption reagent stored in Example 1 and 25 μL of the above-mentioned pH 8.0 10% surfactant alkyl glycoside APG0810 solution were added, mixed and placed at room temperature. After 50 minutes, the total protein, lysis supernatant, and lysis precipitate of the system were subjected to SDS-PAGE protein electrophoresis analysis. The results are as follows: Figure 7 As shown, the results show that Escherichia coli can be fully disrupted under this disruption condition, the total protein in the system is consistent with the supernatant band, and only a small amount of protein bands remain in the disruption precipitate.

[0084] It should be noted that the embodiments described above are only preferred embodiments of the present invention, which are used to explain the present invention and do not constitute any limitation to the present invention. The present invention has been described with reference to typical embodiments, but it should be understood that the words used therein are descriptive and explanatory words, rather than restrictive words. The present invention may be modified as specified within the scope of the claims of the present invention, and the present invention may be revised without departing from the scope and spirit of the present invention. Although the present invention described therein relates to specific methods, materials and embodiments, it does not mean that the present invention is limited to the specific examples disclosed therein. On the contrary, the present invention can be extended to all other methods and applications with the same functions.

Claims

1. A bacterial cell disruption preparation, comprising as a main bacterial cell disruption agent Escherichia coli cells expressing lysozyme and / or crude lysozyme produced by Escherichia coli cells expressing lysozyme, wherein: The lysozyme is an enzyme capable of hydrolyzing peptidoglycan.

2. The bacterial cell disruption preparation according to claim 1, characterized in that The lysozyme includes one or more of T4 lysozyme, T7 lysozyme and λ lysozyme.

3. The cell disruption preparation according to claim 1 or 2, characterized in that The bacterial cell disruption preparation further comprises a cell disruption aid, which includes one or more of a cell disruption solution viscosity reducing preparation, a surfactant, a metal complexing agent, a tris buffer and an organic solvent.

4. The cell disruption preparation according to claim 3, characterized in that The cell disruption fluid viscosity reducing preparation comprises one or more of a nuclease that non-specifically hydrolyzes DNA, an Escherichia coli cell expressing a nuclease that non-specifically hydrolyzes DNA, and a crude nuclease prepared from an Escherichia coli cell expressing a nuclease that non-specifically hydrolyzes DNA.

5. A cell disruption method, comprising using the cell disruption preparation according to any one of claims 1 to 4 to disrupt the cells of bacteria to be disrupted.

6. The cell disruption method according to claim 5, characterized in that The cell disruption method comprises mixing a suspension of bacteria to be disrupted with a cell disruption preparation to form a cell disruption system, and then performing a cell disruption treatment to lyse the bacteria to be disrupted.

7. The cell disruption method according to claim 6, characterized in that: In the cell disruption system, the main cell disruption agent and the cell disruption auxiliary agent in the cell disruption preparation are added simultaneously or in batches.

8. The cell disruption method according to claim 7, characterized in that: In the cell disruption system, the bacterial suspension to be disrupted is mixed with the Escherichia coli suspension expressing lysozyme to form a mixed bacterial suspension; preferably, in the mixed bacterial suspension, the ratio of the concentration of the Escherichia coli suspension expressing lysozyme to the concentration of the bacteria to be disrupted is ≥1:5000.

9. The cell disruption method according to any one of claims 5 to 8, characterized in that: Cell disruption was performed by freezing.

10. The cell disruption method according to any one of claims 5 to 9, characterized in that: The bacteria to be disrupted include Gram-negative bacteria and / or Gram-positive bacteria.

Images