AAV vector for regulating smooth muscle contraction as well as construction method and application of AAV vector

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to an AAV vector for regulating smooth muscle contraction as well as a construction method and application of the AAV vector. The AAV vector for regulating and controlling the contraction of the smooth muscle, disclosed by the invention, is obtained by inserting a gene for regulating and controlling the contraction of the smooth muscle between restriction enzyme cutting sites of multiple cloning sites of a pssAAV-CBA-LUC-P2A-GFP-bGH-141 vector. The obtained AAV vector expresses an exogenous gene, such as a gene ACTA2 for regulating smooth muscle contraction, and has the advantages of long time and good stability. Animal experiments show that the AAV vector can directly increase the contractility of smooth muscle by regulating expression of smooth muscle contraction related genes such as ACTA2, so that the aim of treating related diseases such as gastroesophageal reflux disease, fecal incontinence and the like is fulfilled.

Description

Technical Field

[0001] The present invention belongs to the technical field of biopharmaceuticals, and specifically relates to an AAV vector for regulating smooth muscle contraction, and a construction method and application thereof. Background Art

[0002] Smooth muscle contraction is caused by the activation of calcium ion-related signal transduction pathways by the enteric nervous system and the autonomic nervous system under the comprehensive regulation of relevant neurotransmitters. Under the energy supply of ATP, myosin and actin bind, and myofilaments slide between thick and thin filaments, thereby achieving smooth muscle contraction. Smooth muscle contraction disorders may lead to a variety of diseases, such as gastroesophageal reflux disease, irritable bowel syndrome, fecal incontinence, chronic constipation, gastroparesis, urinary incontinence, etc. The main causes of smooth muscle contraction disorders include abnormal cell function, neural dysfunction, electrolyte disorders, drug effects, etc. At present, the regulatory strategies for the contractile function of smooth muscle cells mainly focus on the targets of signal pathways, such as calcium ion-dependent smooth muscle contraction mechanism, RhoA / ROCK pathway and PKC pathway. However, the regulation of these pathways not only affects the contraction of smooth muscle, but also easily produces systemic effects and lacks specificity.

[0003] The cytoskeleton is a three-dimensional grid structure formed by the organic assembly of multiple structural proteins and contractile proteins in a specific pattern. It is an important material basis for maintaining specific cell morphology and contractile function. Among them, microfilaments composed of actin and its binding proteins are the most important cytoskeleton in smooth muscle cells (SMC). Cytoskeleton-related genes include smooth muscle-specific myosin heavy chain (SMMHC, encoded by the Myh11 gene), smooth muscle α-actin (α-SMA, encoded by the Acta2 gene), transcollin (SM22α, encoded by the Tagln gene), calmodulin (calponin, encoded by the gene Cnn1) and calmodulin (caldesmon, encoded by the CALD1 gene). Taking α-SMA as an example, α-SMA is an actin-binding protein, which is mainly located on the tension fibers of the cytoskeleton. It promotes the binding of actin and myosin by cross-linking with actin, myosin and tropomyosin, thereby inducing the contraction of smooth muscle. Therefore, the contractile function of cells can be regulated by regulating the expression of α-SMA.

[0004] Adeno-associated virus (AAV) is a small virus with a diameter of about 26 nanometers. It is favored in the field of gene therapy for its low immunogenicity, low gene integration ability, ability to express foreign genes for a long time, and ability to infect cell types specifically. AAV has high safety and biocompatibility, and can effectively deliver therapeutic genes to a variety of tissues, including the eyes, liver, brain, inner ear, myocardium, and skeletal muscle. Currently, recombinant AAV is used clinically, which removes most of the wild-type AAV genes, cannot replicate, and has extremely low genome integration rate and immunogenicity, thus ensuring its safety. AAV has multiple serotypes, allowing researchers to select specific serotypes as needed to target different cell populations in vivo. Recombinant AAV gene therapy drugs can stably express therapeutic genes in vivo for a long time, achieving long-term or even lifelong effects of one-time treatment, making it an ideal choice for the treatment of genetic diseases or degenerative diseases. As of August 2024, 8 AAV gene therapy drugs have been approved for marketing worldwide, and thousands of gene therapy clinical trials are underway, of which more than a quarter use AAV vectors. Some studies have explored the transduction efficiency of AAV when locally injected into skeletal muscle and the transfection efficiency of different serotypes of AAV in different muscle tissues. Currently, there is no relevant literature at home or abroad reporting methods for local injection targeted regulation of smooth muscle contractile function.

[0005] Therefore, the present invention constructs a gene therapy drug that targets genes that regulate smooth muscle contraction, such as ACTA2, using AAV as a vector. By local injection, its effect on the contractility of smooth muscle cells is verified, and then its therapeutic effect on diseases related to decreased smooth muscle contraction, such as gastroesophageal reflux disease, is explored, and its effect on the lower esophageal sphincter and the therapeutic effect on the gastroesophageal reflux animal model are observed. Summary of the invention

[0006] The purpose of the present invention is to provide an AAV vector for regulating smooth muscle contraction and a construction method and application thereof, so as to solve the problems raised in the above-mentioned background technology.

[0007] To achieve the above object, the present invention provides the following technical solutions:

[0008] The first aspect of the present invention provides an AAV vector for regulating smooth muscle contraction, wherein the AAV vector is obtained by inserting a gene for regulating smooth muscle contraction between restriction sites of the multiple cloning site of the pssAAV-CBA-LUC-P2A-GFP-bGH-141 vector.

[0009] In a preferred embodiment of the present invention, the gene regulating smooth muscle contraction is a gene enhancing the contractile function of smooth muscle.

[0010] In a preferred embodiment of the present invention, the gene that promotes smooth muscle contractility is the ACTA2 gene, and the AAV vector obtained is pssAAV-CBA-ACTA2-P2A-GFP-bGH-141. The sequence of pssAAV-CBA-ACTA2-P2A-GFP-bGH-141 is shown in SEQ ID NO.7.

[0011] In a preferred embodiment of the present invention, the gene that promotes smooth muscle contractility is the CNN1 gene, and the AAV vector obtained is pssAAV-CBA-CNN1-P2A-GFP-bGH-141. The sequence of pssAAV-CBA-CNN1-P2A-GFP-bGH-141 is shown in SEQ ID NO.8.

[0012] In a preferred embodiment of the present invention, the gene that promotes smooth muscle contractility is the TAGLN gene, and the AAV vector obtained is pssAAV-CBA-TAGLN-P2A-GFP-bGH-141. The sequence of pssAAV-CBA-TAGLN-P2A-GFP-bGH-141 is shown in SEQ ID NO.9.

[0013] In a preferred embodiment of the present invention, the restriction sites of the multiple cloning site are restriction endonucleases HindIII and Kpn2I.

[0014] The second aspect of the present invention provides a method for constructing an AAV vector for regulating smooth muscle contraction as described above, comprising the following steps:

[0015] S1: The pssAAV-CBA-LUC-P2A-GFP-bGH-141 plasmid was double-digested and agarose electrophoresis was performed, followed by gel excision and recovery to obtain the pssAAV-CBA-P2A-GFP-bGH-141 vector fragment;

[0016] S2: PCR amplification of the gene sequence regulating smooth muscle contraction, gel electrophoresis and gel cutting and recovery, to obtain the gene fragment regulating smooth muscle contraction;

[0017] S3: connecting the pssAAV-CBA-P2A-GFP-bGH-141 vector fragment obtained above and the gene fragment regulating smooth muscle contraction to obtain a connection product;

[0018] S4: taking the above ligation product and transforming it into competent E. coli, and then spreading it on an LB agar plate containing ampicillin to obtain a recombinant E. coli containing a recombinant plasmid of a gene regulating smooth muscle contraction;

[0019] S5: Pick a single clone colony and inoculate it in liquid LB containing ampicillin for shaking culture to screen out the positive plasmid;

[0020] S6: After double restriction digestion identification, the positive plasmid is sequenced and identified to obtain the AAV vector containing the gene that regulates smooth muscle contraction.

[0021] The third aspect of the present invention provides a transformant, which comprises the AAV vector for regulating smooth muscle contraction as described above.

[0022] The fourth aspect of the present invention provides a pharmaceutical composition, which comprises the AAV vector as described above as an active ingredient; and

[0023] Pharmaceutically acceptable carrier or adjuvant.

[0024] The fifth aspect of the present invention provides an application of an AAV vector, transformant or pharmaceutical composition as described above in the preparation of a drug for treating related diseases by regulating smooth muscle contraction, wherein the related diseases include gastroesophageal reflux disease, fecal incontinence, chronic constipation, gastroparesis or urinary incontinence.

[0025] Technical effects and advantages of the present invention:

[0026] 1. The present invention constructs an AAV recombinant vector inserted with a gene regulating smooth muscle contraction. The recombinant vector can target smooth muscle cells, reduce the probability of insertion mutation, has low immunogenicity, good safety and high specificity; it can also increase the existence time and expression time of the exogenous gene, providing the possibility of a one-time therapeutic effect.

[0027] 2. Animal experiments show that the AAV recombinant vector of the present invention can directly increase the contractile force of smooth muscle by regulating the expression of genes related to smooth muscle contraction, such as ACTA2. This result suggests that this type of recombinant AAV vector plays an important role in regulating the contractile ability of smooth muscle and has a high application potential. It is expected to become an effective target for the clinical treatment of diseases related to decreased smooth muscle contractile function, and to develop a drug that efficiently regulates smooth muscle contraction for the treatment of diseases such as gastroesophageal reflux disease, fecal incontinence, chronic constipation, gastroparesis, and urinary incontinence, providing a new research direction. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Changes of lower esophageal sphincter pressure in rats 4 weeks after LES myotomy to establish GERD model;

[0029] Figure 2 The macroscopic changes of esophageal mucosa in GERD model rats 4 weeks after surgery;

[0030] Figure 3The histopathological changes of the esophagus in GERD model rats 4 weeks after surgery;

[0031] Figure 4 The following are representative waveforms of the lower esophageal sphincter pressure of rats in each group;

[0032] Figure 5 The esophageal sphincter pressure of each group of rats at baseline and the changes of esophageal sphincter pressure 4 weeks after AAV injection;

[0033] Figure 6 Different AAV viruses (concentration: 8.5×10 12 ) Histological fluorescence image after 4 weeks;

[0034] Figure 7 Fluorescence (4×) images of smooth muscle cells after transfection with different overexpression plasmids;

[0035] Figure 8 The corresponding protein expression of smooth muscle cells after being treated with different overexpression plasmids;

[0036] Fig. 9 This is the corresponding RNA expression of smooth muscle cells after being treated with different overexpression plasmids;

[0037] Fig.10 This is the plasmid map constructed in Example 2 of the present invention. DETAILED DESCRIPTION

[0038] The specific embodiments of the present invention are further described below in conjunction with the accompanying drawings. It should be noted that the description of these embodiments is used to help understand the present invention, but does not constitute a limitation of the present invention. In addition, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0039] Example 1: Acquisition of target genes and design of amplification primers

[0040] In this embodiment, after preliminary screening, three genes to be tested were screened from many genes that enhance the contractile function of smooth muscle, namely ACTA2, CNN1 and TAGLN, and experimental sequences of ACTA2, CNN1 and TAGLN genes with restriction sites were prepared, wherein seamless cloning primers ACTA2-HindIII-F and ACTA2-Kpn2I-R, CNN1-HindIII-F and CNN1-Kpn2I-R, TAGLN-HindIII-F and TAGLN-Kpn2I-R were designed according to the sequences of ACTA2, CNN1 and TAGLN genes, and their sequence information is as follows:

[0041] Acta2-HindIII-F:

[0042] CCGGGGATCCTCTAGAGTCGACCTGCAGAAGCTTGCCACCATGTGT GAAGAAGAGGA (as shown in SEQ ID NO. 1 in the sequence listing);

[0043] ACTA2-Kpn2I-R:

[0044] CAGAGAGAAGTTTGTTGCGCCGGATCTGAGTCCGGAGAAGCATTTG CGGTGGACAA (as shown in SEQ ID NO.2 in the sequence listing);

[0045] CNN1-HindIII-F:

[0046] CCGGGGATCCTCTAGAGTCGACCTGCAGAAGCTTGCCACCATGTCC TCTGCTCA (as shown in SEQ ID NO.3 in the sequence listing);

[0047] CNN1-Kpn2I-R:

[0048] GAGAGAAGTTTGTTGCGCCGGATCTGAGTCCGGAGGCGGAATTGTAGTAGTTGT (as shown in SEQ ID NO.4 in the sequence listing);

[0049] TAGLN-HindIII-F:

[0050] CCGGGGATCCTCTAGAGTCGACCTGCAGAAGCTTGCCACCATGGCC AACAAGGG (as shown in SEQ ID NO.5 in the sequence listing);

[0051] TAGLN-Kpn2I-R:

[0052] GAGAGAAGTTTGTTGCGCCGGATCTGAGTCCGGAACTGATGATCTGCCGAGGTC (as shown in SEQ ID NO. 6 in the sequence listing).

[0053] Example 2: Construction of plasmid pssAAV-CBA-ACTA2-P2A-GFP-bGH-141

[0054] In this example, plasmid pssAAV-CBA-ACTA2-P2A-GFP-bGH-141 (its structure is as follows) was constructed. Fig.10 The specific method is as follows:

[0055] 1. The pssAAV-CBA-LUC-P2A-GFP-bGH-141 plasmid was double-digested with restriction endonucleases HindIII and Kpn2I at 37.0°C for 90 min. The digestion product was recovered by agarose electrophoresis and then cut off the gel to obtain the pssAAV-CBA-P2A-GFP-bGH-141 vector fragment.

[0056] 2. According to the seamless cloning primers ACTA2-HindIII-F and ACTA2-Kpn2I-R designed in Example 1, the synthesized ACTA2 gene sequence was amplified by PCR, and the amplified product was recovered by agarose gel electrophoresis and then cut to obtain the ACTA2 gene fragment.

[0057] 3. The recovered pssAAV-CBA-P2A-GFP-bGH-141 vector fragment and the recovered ACTA2 gene fragment were connected using the CloneSmarter seamless cloning kit, 10ul system, 50°C for 15min to obtain a connection product.

[0058] 4. Take 5ul of the ligation product and transform it into the competent E. coli TransStbl3, mix gently; place it in an ice bath for 20min, heat shock at 42.0℃ for 45s, and immediately place it in an ice bath for 2min; add liquid LB without antibiotics and culture at 37℃ with shaking for about 60min; after the culture is completed, use a sterile glass spreader to evenly spread the obtained bacterial liquid on the LB agar plate containing ampicillin; culture it upside down at 37.0℃ for 15h to obtain recombinant E. coli containing the recombinant plasmid of ACTA2.

[0059] 5. Pick a single clone colony and inoculate it in liquid LB containing ampicillin, and culture it at 37.0℃ with shaking for 16 hours. After the culture is completed, use the Axygen plasmid extraction kit to extract the positive plasmid.

[0060] 6. The obtained positive plasmid was double-digested with HindIII and Kpn2I and then sequenced to obtain an AAV recombinant plasmid with ACTA2 inserted, named pssAAV-CBA-ACTA2-P2A-GFP-bGH-141, and its sequence is shown in SEQ ID NO.7.

[0061] SEQ ID NO.7:

[0062]

[0063] Example 3: Construction of plasmid pssAAV-CBA-CNN1-P2A-GFP-bGH-141

[0064] In this example, the plasmid pssAAV-CBA-CNN1-P2A-GFP-bGH-141 was constructed, and the specific method is as follows:

[0065] 1. The pssAAV-CBA-LUC-P2A-GFP-bGH-141 plasmid was double-digested with restriction endonucleases HindIII and Kpn2I at 37.0°C for 90 min. The digestion product was recovered by agarose electrophoresis and then cut off the gel to obtain the pssAAV-CBA-P2A-GFP-bGH-141 vector fragment.

[0066] 2. According to the seamless cloning primers CNN1-HindIII-F and CNN1-Kpn2I-R designed in Example 1, the synthesized CNN1 gene sequence was amplified by PCR, and the amplified product was subjected to agarose gel electrophoresis and then cut and recovered to obtain the CNN1 gene fragment.

[0067] 3. The recovered pssAAV-CBA-P2A-GFP-bGH-141 vector fragment and the recovered CNN1 gene fragment were connected using the CloneSmarter seamless cloning kit, 10ul system, 50°C reaction for 15min to obtain a connection product.

[0068] 4. Take 5ul of the ligation product and transform it into the competent E. coli TransStbl3, mix gently; place in an ice bath for 20min, heat shock at 42℃ for 45s, and immediately place in an ice bath for 2min; add liquid LB without antibiotics and culture at 37.0℃ with shaking for about 60min; after the culture is completed, use a sterile glass spreader to evenly spread the obtained bacterial solution on the LB agar plate containing ampicillin; culture at 37.0℃ inverted for 15h to obtain recombinant E. coli containing the recombinant plasmid of CNN1.

[0069] 5. Pick a single clone colony and inoculate it in liquid LB containing ampicillin, and culture it at 37.0℃ with shaking for 16 hours. After the culture is completed, use the Axygen plasmid extraction kit to extract the positive plasmid.

[0070] 6. The obtained positive plasmid was double-digested with HindIII and Kpn2I and then sequenced to obtain an AAV recombinant plasmid with CNN1 inserted, named pssAAV-CBA-CNN1-P2A-GFP-bGH-141, and its sequence is shown in SEQ ID NO.8.

[0071] SEQ ID NO.8:

[0072]

[0073] Example 4: Construction of plasmid pssAAV-CBA-TAGLN-P2A-GFP-bGH-141

[0074] In this example, the plasmid pssAAV-CBA-TAGLN-P2A-GFP-bGH-141 was constructed, and the specific method is as follows:

[0075] 1. The pssAAV-CBA-LUC-P2A-GFP-bGH-141 plasmid was double-digested with restriction endonucleases HindIII and Kpn2I at 37.0°C for 90 min. The digestion product was recovered by agarose electrophoresis and then cut off the gel to obtain the pssAAV-CBA-P2A-GFP-bGH-141 vector fragment.

[0076] 2. According to the seamless cloning primers TAGLN-HindIII-F and TAGLN-Kpn2I-R designed in Example 1, the synthesized TAGLN gene sequence was amplified by PCR, and the amplified product was recovered by agarose gel electrophoresis to obtain the TAGLN gene fragment.

[0077] 3. The recovered pssAAV-CBA-P2A-GFP-bGH-141 vector fragment and the recovered TAGLN gene fragment were connected using the CloneSmarter seamless cloning kit, 10ul system, 50°C reaction for 15min to obtain a connection product.

[0078] 4. Take 5ul of the ligation product and transform it into the competent E. coli TransStbl3, mix gently; place in an ice bath for 20min, heat shock at 42.0℃ for 45s, and immediately place in an ice bath for 2min; add liquid LB without antibiotics and culture at 37.0℃ with shaking for about 60min; after the culture is completed, use a sterile glass spreader to evenly spread the obtained bacterial liquid on the LB agar plate containing ampicillin; culture at 37.0℃ inverted for 15h to obtain recombinant E. coli containing the recombinant plasmid of TAGLN.

[0079] 5. Pick a single clone colony and inoculate it in liquid LB containing ampicillin, and culture it at 37.0℃ with shaking for 16 hours. After the culture is completed, use the Axygen plasmid extraction kit to extract the positive plasmid.

[0080] 6. The obtained positive plasmid was double-digested with HindIII and Kpn2I and then sequenced to obtain an AAV recombinant plasmid with TAGLN inserted, named pssAAV-CBA-TAGLN-P2A-GFP-bGH-141, and its sequence is shown in SEQ ID NO.9.

[0081] SEQ ID NO.9:

[0082]

[0083] Example 5: Production and purification of AAV

[0084] This example produces and purifies four AAV viruses: ssAAV9-CBA-Luc-2A-GFP, ssAAV9-CBA-ACTA2-P2A-GFP, ssAAV9-CBA-TAGLN-P2A-GFP, and ssAAV9-CBA-CNN1-P2A-GFP. Taking ssAAV9-CBA-Luc-2A-GFP as an example, the specific method is as follows:

[0085] 1. Production of AAV

[0086] 1.1 Cell culture: WayneLVPro TM HEK293T suspension cells (Zhongshan Kangtian Shenghe Biotechnology Co., Ltd.) were cultured in a shaker using Wayne293TM Transfection Medium, Liquid Transfection Medium (Zhongshan Kangtian Shenghe Biotechnology Co., Ltd., Catalog No.: A21501). The culture conditions were: 37°C, 5% CO2, 90% humidity, and the shaker speed was 125 rpm. When the cell density reached 3.0×10 6 cells / mL, 5×10 5 cells / mL for passaging.

[0087] 1.2 Cell transfection: WayneLVPro TM HEK293T cells were passaged into 5L cell shake flasks 48 h in advance, and the cell density was 3.0×10 6 The total amount of plasmid was 1 μg / million cells, and the shuttle vector plasmid pssAAV-CBA-Luc-2A-GFP, auxiliary plasmid pHelper, and packaging plasmid pAAV-RC9 were co-transfected into the above 293T cells at a ratio of 1:1:1. The transfection reagent used was (Polyplus, catalog number: 301-01L), with a plasmid ratio of 1:1 (volume μL: mass μg). The glucose concentration was measured before transfection and adjusted to 6 g / L, and then adjusted every 24 h until the virus was harvested.

[0088] 1.3 Cell harvesting: 24 hours after cell transfection, add 1 / 1000th of the transfection volume of anti-agglomeration agent (Thermo, catalog number: 0010057DG). 72 hours after cell transfection, centrifuge at 2500g for 10 minutes to harvest the cells.

[0089] 2. Purification of AAV

[0090] 2.1 Cell lysis and digestion: Lyse the above harvested cells using lysis buffer (50 mM Tris-HCl, 150 mM NaCl, 2 mM MgCl2, 0.1% TritonX-100). Then, add 50 U / mL of Benzo GMP Grade (nearshore protein GMP-1707) was digested at 37°C for 60 min to obtain the digestion product.

[0091] 2.2 Virus liquid harvesting and clarification: The digestion product was centrifuged at 10000g for 30 min to harvest the crude virus lysate. The crude virus lysate was filtered (0.45 μm) to remove insoluble particles such as 293T cell fragments and improve the clarity of the solution for subsequent chromatography purification.

[0092] 2.3 Chromatographic purification

[0093] 2.3.1 Affinity chromatography: POROS AAVX chromatography filler is used to capture specific adeno-associated viruses. This step can remove 99% of protein and DNA contaminants, and the virus yield is as high as over 90%.

[0094] 2.3.2 Anion exchange chromatography: The monolithic column CIM QA was used for anion exchange chromatography. This step can remove most of the empty shells of the adeno-associated virus, increase the solid rate of the adeno-associated virus, and achieve the purpose of purification.

[0095] 2.3.3 Concentration and salt exchange: Anion exchange chromatography purification liquid uses a membrane with a molecular weight cutoff of 300 kDa for TFF (tangential flow filtration) to replace the adeno-associated virus to conditions suitable for storage and use.

[0096] 2.4 Storage: The purified AAV samples were filtered through a 0.2 μm membrane, aliquoted, and stored at -80°C. Since adeno-associated viruses are prone to aggregation and inactivation under high concentrations and repeated freezing and thawing, 0.001% poloxamer 188 was added to the preservation solution to prevent aggregation and inactivation of adeno-associated viruses.

[0097] The other three AAVs were produced and purified according to the above method and will not be described in detail here.

[0098] Example 6: Effects of different AAV viruses on the contractility of the rat lower esophageal sphincter (LES)

[0099] This example explores the effects of different types of AAV viruses and different injection volumes obtained in Example 5 on the contractility of rat LES. The specific operation is as follows: First, four groups of experiments are set up for verification, namely the following four groups (i) to (iv):

[0100] (i) ssAAV9-CBA-Luc-2A-GFP (control group, referred to as OE-NC),

[0101] (ii) ssAAV9-CBA-ACTA2-P2A-GFP (experimental group 1, hereinafter referred to as OE-ACTA2),

[0102] (iii) ssAAV9-CBA-TAGLN-P2A-GFP (experimental group 2, hereinafter referred to as OE-TAGLN),

[0103] (iv) ssAAV9-CBA-CNN1-P2A-GFP (experimental group 3, hereinafter referred to as OE-CNN1).

[0104] Construction of GERD model rats: A stable rat gastroesophageal reflux (GERD) model was constructed by LES myotomy, and the pathological changes were observed by comparing the decrease in LES pressure after surgery compared with the baseline and HE staining of gross specimens and tissue sections to verify the successful construction of the model. The model construction process is discussed in detail below.

[0105] First, SD rats (purchased from Nanjing Carles Biotechnology Co., Ltd.) were fasted for 24h in advance, and 3% sodium pentobarbital was injected to anesthetize the SD rats (the amount of sodium pentobarbital injected was: body weight × 3 + 100 μL). The anesthetized SD rats were fixed and their abdomens were depilated to expose the abdominal skin, and then disinfected with iodine tincture for standby use. A 2-3cm incision was cut longitudinally in the middle of the abdomen of the above-mentioned rats to expose the internal organs to the visual field, and gauze soaked with physiological saline was laid around the incision to prevent infection. The stomach and gastroesophageal junction were found and exposed to the visual field, and the surrounding tissues were bluntly separated. The cardia muscle was longitudinally cut about 0.5cm at the esophageal-gastric junction to construct a gastroesophageal reflux (GERD) model rat.

[0106] Then, the LES pressure, esophageal mucosa and esophageal tissue pathology of the model rats were tested after surgery. The results are shown in Figure 1-3 .

[0107] like Figure 1 The figure shows the changes in LESP 4 weeks after LES myotomy to establish a GERD model. Compared with the baseline LESP before surgery, the LESP of rats 4 weeks after modeling was significantly reduced (6.62±2.38vs.2.99±1.03, P=0.002). (*: P<0.01)

[0108] like Figure 2 The figure shows the macroscopic changes of the esophageal mucosa in GERD model rats. Compared with the smooth esophageal mucosa of normal rats, the esophagus of rats 4 weeks after surgery showed congestion and erosion of the mucosa.

[0109] like Figure 3 The figure shows the pathological changes of esophageal tissue in GERD model rats. Compared with normal rats with no obvious inflammatory response in the esophageal tissue layers, the LES of rats in the 4-week postoperative group showed thickening of the esophageal squamous epithelium, extension of the papillae in the mucosal lamina propria, and infiltration of a large number of inflammatory cells.

[0110] In summary, the gastroesophageal reflux (GERD) rat model was successfully established.

[0111] Animal experiment process: The GERD model rats constructed above were divided into four large groups, and each large group was divided into two small groups. LES myotomy was first performed at the gastroesophageal junction of each group of rats to construct a GERD model, and the four different AAV viruses obtained in Example 5 (ssAAV9-CBA-Luc-2A-GFP, ssAAV9-CBA-ACTA2-P2A-GFP, ssAAV9-CBA-TAGLN-P2A-GFP and ssAAV9-CBA-CNN1-P2A-GFP) were injected circumferentially, and each group was injected with two doses of 2 μL and 4 μL. The virus titer injected in each group was 8.5×10 12 vg / mL, and the injection method was 4 sites around the LES of each rat, one site in each quadrant.

[0112] The esophageal manometry of rats was performed using the GAP-36A digestive tract motility monitoring system 4 weeks after the virus injection. The rats in each group were fed routinely during the injection period. The changes in LESP of rats before and 4 weeks after the operation were compared. Figure 4-5 .

[0113] like Figure 4 As shown, the changes in LES pressure of rats injected with different doses and types of AAV viruses before and after surgery and 4 weeks after surgery are shown, and representative waveforms are selected for before and after comparison observation. It can be seen that the pressure waveforms of rats in the two dose groups of the empty virus control group OE-NC before and after are significantly reduced; while the LESP of rats in the OE-ACTA2, OE-TAGLN and OE-CNN1 groups have no significant changes compared to before surgery.

[0114] like Figure 5As shown, the LESP statistics of each group of rats before and 4 weeks after surgery are shown (ns: P>0.05; *: P<0.05; **: P<0.01). In the control empty virus OE-NC group, the LESP of the low-dose group (2μL) and the high-dose group (4μL) 4 weeks after surgery were significantly reduced compared with the preoperative baseline value (2μL group: 7.55±0.77 vs. 3.95±0.18, P=0.009; 4μL group: 7.72±1.08 vs. 3.80±0.54, P=0.015), and the LESP decrease value of the low-dose group was not significantly different from that of the high-dose group (3.60±0.06 vs. 3.92±0.84, P=0.613). This shows that the empty virus OE-NC cannot improve the LES pressure of gastroesophageal reflux model rats. In the OE-ACTA2 group of trial 1, there was no significant change in LESP compared with the preoperative baseline value in both the low-dose group (2μL) and the high-dose group (4μL) 4 weeks after surgery (2μL group: 8.42±0.72 vs.

[0115] 7.94±0.42, P>0.05; 4μL group: 8.63±0.64 vs 8.01±0.47, P>0.05), and the difference in LESP between the low-dose group and the high-dose group did not change significantly (0.48±0.30 vs. 0.62±0.40, P>0.05). This indicates that overexpression of the ACTA2 gene can significantly improve the LES pressure of gastroesophageal reflux model rats and restore it to the baseline level, and the low-dose group showed an improvement effect comparable to that of the high-dose group. In the OE-TAGLN group of the experiment 2, there was no significant change in LESP 4 weeks after surgery in the low-dose group (2μL) and the high-dose group (4μL) compared with the preoperative baseline value (2μL group: 9.04±0.63 vs. 8.08±0.26, P>0.05; 4μL group: 8.86±0.73 vs. 7.54±0.0.19, P>0.05), and there was no significant change in the difference in LESP between the low-dose group and the high-dose group (0.96±0.89 vs. 1.32±0.85, P>0.05). This indicates that overexpression of the TAGLN gene can significantly improve the LES pressure of gastroesophageal reflux model rats and restore it to the baseline level, and the low-dose group showed an improvement effect comparable to that of the high-dose group. In the OE-CNN1 group of the three experimental groups, the LESP of the low-dose group (2μL) and the high-dose group (4μL) had no significant changes compared with the preoperative baseline value 4 weeks after surgery (2μL group: 9.00±0.73 vs. 6.78±0.74, P>0.05; 4μL group: 8.90±0.28 vs. 7.27±0.64, P>0.05), and the LESP difference of the low-dose group had no significant change compared with the high-dose group (2.22±1.05 vs. 1.63±0.89, P>0.05). This indicates that overexpression of the CNN1 gene can significantly improve the LES pressure of gastroesophageal reflux model rats and restore it to the baseline level, and the low-dose group showed an improvement effect comparable to that of the high-dose group.

[0116] In order to further observe the AAV virus transfection in each group of rats, esophageal immunofluorescence analysis was performed on each group of rats. The specific process was as follows: the esophageal tissue of the rats in the above experiment was placed in 4% paraformaldehyde (PFA) at 4°C overnight, and then transferred to a 30% sucrose solution for dehydration for at least 3 days until the tissue sank to the bottom. The tissue was taken out and sliced ​​using a cryostat. The slicer temperature was adjusted to -20°C, and the slice thickness was generally selected to be 30-40 μm. First, drop the OCT cryoembedding agent (SAKURA, 4583) on the sample stage, press the 10-minute quick freeze, adjust the front and back keys, install the blade, press tightly, and after quick freezing, cut out the plane first. Place the tissue on the sample stage and drop OCT on it. First, you can cut off the discarded plane with 50 μm, and when you are close to the tissue, you can use 30 μm for the esophagus. Turn it over and unfold it, and stick it directly to the adhesive slide. The slices have been attached to the adhesive slide. After removing the surrounding OCT with a cotton swab, draw circles around it with a water-blocking pen / nail polish, and place it in a black wet box to dry for 1 hour. Use a pipette to drop PFA on the tissue, cover the tissue, wait for 10 minutes, and then use a pipette to absorb the PFA. Add PBS and wait for 10 minutes before aspirating and discarding. Repeat three times. Then, add blocking solution and incubate for 1 hour. Add primary antibody for incubation (α-SMA, proteintech, 14395-1-AP, 1:800 configuration), incubate in a 4°C refrigerator for more than 12 hours, and add water to the wet box. After taking it out in advance, warm it to room temperature for 30 minutes, recover the primary antibody, and then wash it three times with PBS. Finally, stain with secondary antibody Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, AlexaFluor TM 594 (Invitrogen, A-21207), incubate for 1-2h. After incubation, wash three times with PBS. Add DAPI and incubate for 10min, then let it dry. First, use a pipette to take 150μL of anti-fluorescence quenching mounting medium (SouthernBiotech, SBA-0100-01) and squeeze it evenly on the coverslip, then take out the dried slide and place it close to the edge of the coverslip and perpendicular to the table. Use tweezers to stand the coverslip and stick it on the slide so that the two are adhered, and let it dry. Use a thunder microscope to observe fluorescence, and the observation results are shown in Figure 6 .

[0117] like Figure 6 As shown, the immunofluorescence of the lower esophageal sphincter of each group of rats, including smooth muscle cell nuclei, smooth muscle cell marker α-SMA, and virus-borne fluorescence GFP. Figure 6 As shown, each group of viruses successfully infected rat lower esophageal sphincter smooth muscle cells.

[0118] Example 7: Analysis of expression of different AAV vectors in cells

[0119] In this example, the protein expression of different AAV vectors in cells was investigated. The specific operation process was as follows: a six-well plate was laid one day in advance, with 200,000 rat vascular smooth muscle cells USMC (BeNa Culture Collection, BNCC338250) in each well; USMC was transfected with plasmids, including the control plasmid ssAAV-CBA-LUC-P2A-GFP-bGH-141 and the three overexpression plasmids obtained in the above examples: ssAAV-CBA-ACTA2-P2A-GFP-bGH-141, ssAAV-CBA-TAGLN-P2A-GFP-bGH-141 and ssAAV-CBA-CNN1-P2A-GFP-bGH-141. Prepare 8 1.5mlep tubes in total, evenly divided into A and B tubes, A: 125μL opti-MEM (Gibco, 31985-070) + 3μL lipo3000 (ThermoFisher, L3000150); B tube: 125μL opti-MEM + 3μL P3000 + 2.5μg different plasmids, mix well and let stand for 5 minutes, then add B tube to A tube, mix well and let stand for 20 minutes. Take out the six-well plate, wash 3 times with PBS, add 500μL complete culture medium (DMEM + 10% FBS, DMEM: WISENT, 319-005-CL; FBS: Bio-Channel, BC-SE-FBS01), add the configured transfection system to the cells in different wells, incubate in the box and take fluorescence photos. See the results. Figure 7 shown.

[0120] like Figure 7 The fluorescence of USMC after transfection with different overexpression plasmids at 48h and 72h of culture is shown. It can be seen that the infection efficiency of each group of cells can reach 80%-90% at 48h, and the fluorescence is brighter and the expression is stronger at 72h.

[0121] In order to further explore the corresponding protein expression of the three groups of USMC after transfection with different overexpression plasmids, protein extraction operations were then performed on each group of cells, including:

[0122] Cell lysis: Digest the cultured cells with trypsin and centrifuge them. Resuspend them in PBS and place them in an epoxies tube. Centrifuge them at 1500rpm for 5min. Prepare 1mL of complete lysis solution: 990μL RIPA; 10μL PMSF; 1μL protease inhibitor mixture. Add 100μL to each epoxies tube and place them on ice for more than half an hour. Precool the grinder and add grinding beads for grinding: 55HZ 5 groups of 5min, 10s interval. Precool the centrifuge to 4℃ in advance and centrifuge at 12000rpm for 20min. Gently aspirate the supernatant, transfer it to a newly precooled epoxies tube, place it on ice, record the aspirated sample volume, and discard the precipitate.

[0123] Protein quantification: Use BCA kit (Keygene, KGP903) to measure protein concentration in supernatant, A solution: B solution = 50:1 (volume ratio). Take 96-well plate: add 2μL of protein solution to be tested and 18μL of deionized water to each well in turn. After all are added, add 200μL / well of BCA solution. Mix at room temperature, shake on a shaker, and mix at high speed for 1min. Then quickly take it to a 37℃ incubator and incubate for 30min. Detect the absorbance value with an enzyme marker, and set the OD value to 562. According to the protein standard curve (y=0.9547x-0.1904, R 2 =0.9961), and the absorbance value was known, and the protein concentration of each sample was obtained (NC: 2.32 μg / μL; OE-ACTA2: 2.08 μg / μL; OE-TAGLN: 1.93 μg / μL; OE-CNN1: 2.25 μg / μL).

[0124] Protein denaturation: The samples with measured protein concentration were treated uniformly. According to the results of the measured protein concentration, the concentration of all samples was set to 1 μg / μL. The sample loading buffer was added to level the protein concentration of all samples. The samples were placed in a 100°C metal bath for 10 minutes and stored at -80°C. The stored samples were taken out and melted in an ice basin.

[0125] The BIO-RAD kit (TGX Stain-Free TM FastCast TM Acrylamide Kit, 10% 1610183) is used to prepare the gel. Arrange the layout of the lanes of each gel in advance. Different samples can be separated by markers. If there are less than 15 lanes, the remaining empty lanes are separated by 1*loading buffer. Generally, 30μg of sample is loaded, 2μL of marker is loaded, and the volume is filled with 1*loading buffer. Fill the electrophoresis tank with electrophoresis buffer (1*running buffer). Adjust the electrophoresis instrument to 90V and run for 30 minutes. In the concentrated gel, pull the protein to the same horizontal line, turn to 120V, and run for 45 minutes.

[0126] After the electrophoresis, transfer the membrane: take out the glass plate, press the glass plate with both hands to pry open the joint, use a small shovel to gently scratch the glue and glass joint surface, discard the concentrated gel part, and use a shovel to gently shovel out the separation gel part and put it in the sink with transfer buffer. "Transfer sandwich" method: black glue and white membrane. Put in the order of filter paper, glue, membrane, and filter paper. Fill the transfer tank with transfer solution, and put an ice bag to cool it down. Put the transfer tank in an ice basin. The transfer current is 200mA, and the membrane is transferred at 4℃ for 2 hours. Then block it, use 1 bag of skim milk, add it to 500mL of TBST, prepare it now, put the membrane face up in the blocking solution, be careful not to stack the membranes together, and block it on a shaker at a medium speed for 1 to 2 hours. After blocking, wash it with TBST 3 times on a shaker, 5 minutes each time, at a medium speed. After blocking, perform antibody incubation. Primary antibody incubation: GAPDH (proteintech, 60004-1-Ig), α-SMA (proteintech, 14395-1-AP), SM22α (Affinity, AF9266), Calponin1 (abclonal, A3734) were diluted according to the dilution ratio in the instructions, and the strips were placed in the antibody and shaken overnight at 4°C. After overnight, the primary antibody was recovered and washed 3 times with TBST on a shaker for 5 minutes each time. Secondary antibody incubation: The secondary antibody Anti-mouse IgG, HRP-linked Antibody (Cell Signaling, 7076S) and Anti-rabbit IgG, HRP-linked Antibody (Cell Signaling, 7074S) were taken out of the refrigerator (to distinguish rabbit antibodies and mouse antibodies), mixed and centrifuged, and the amount of antibody required for the sample was calculated. Dilute the secondary antibody with milk at 1:5000. Incubate for 1 hour. After incubation, wash with TBST on a shaker at medium speed for 3 times, 10 min each time. Finally, prepare the luminescent solution in a 1:1 ratio and expose the strips with an exposure machine. Figure 8 .

[0127] like Figure 8 As shown, the corresponding protein expression of three groups of USMC after transfection with different overexpression plasmids is shown. Compared with the blank and OE-NC groups, the expression of α-SMA, SM22α and calponin1 in the OE-ACTA2, OE-TAGLN and OE-CNN1 virus groups was significantly increased. (Where blank is the blank control group)

[0128] Example 8: Expression of corresponding genes in cells after transfection with different AAV vectors

[0129] In this example, the expression of the three genes ACTA2, TAGLN and CNN1 in cells transfected with the three different vectors in the above example was investigated. The specific operation method is: qPCR is used for determination, and the specific experimental process is as follows:

[0130] The cells infected with the virus in Example 7 were used to extract RNA from the transfected cells using the FreeZol Reagent kit (Vazyme, R711-01). After the extraction, the RNA concentration was measured. The extracted RNA was then reverse transcribed into cDNA. The reverse transcription system was: 5*RT 4μL+RNA 1000 / concentration μL+DEPC water 16-RNA μL=total volume 20μL, and reverse transcription was performed after mixing. The conditions were: 37°C, 15:00; 85°C, 0:05; 4°C, ∞. After the reaction, cDNA was obtained.

[0131] The obtained cDNA was amplified by PCR. The specific operation was as follows: first, 80 μL of DEPC water was added to the 20 μL cDNA system to dilute it 5 times. A 20 μL PCR amplification system was prepared, which consisted of: 10 μL 2*SYBR, 0.4 μL F-primer, 0.4 μL R-primer, 2 μL c-DNA, 7.2 μL DEPC water, and a total volume of 20 uL.

[0132] Apply sealing film, centrifuge at 3000rpm for 5min, mix well, and put on the machine. After the reaction is completed, process the data.

[0133] The amplification conditions are shown in Table 1 below:

[0134] Table 1

[0135] Pre-incubation 95℃ 30s Amplification reaction (40 cycles) 95℃ 10s 60℃ 30s Melting 95℃ 15s 65℃ 60s 95℃ 15s

[0136] The PCR amplification primer sequences are shown in Table 2:

[0137] Table 2

[0138]

[0139] like Fig. 9 As shown, compared with the empty plasmid OE-NC group, the expression of corresponding regulatory genes in USMC cells transfected with different gene overexpression plasmids increased significantly (OE-ACTA2 group: 3.71±0.35 vs. 1.00±0.07, P<0.001; OE-TAGLN group: 2.50±0.31 vs. 1.00±0.12, P<0.001; OE-CNN1 group: 2.18±0.05 vs. 1.00±0.02, P<0.001). (*: P<0.001.)

[0140] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any form. Although the present invention has been disclosed as a preferred embodiment as above, it is not used to limit the present invention. Any technician familiar with this profession can make some changes or modifications to equivalent embodiments of equivalent changes by using the methods and technical contents disclosed above without departing from the scope of the technical solution of the present invention. However, any simple modification, equivalent change and modification made to the above embodiments according to the technical essence of the present invention without departing from the content of the technical solution of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. An AAV vector for regulating smooth muscle contraction, characterized in that: The AAV vector is obtained by inserting a gene regulating smooth muscle contraction between the restriction sites of the multiple cloning site of the pssAAV-CBA-LUC-P2A-GFP-bGH-141 vector.

2. An AAV vector for regulating smooth muscle contraction according to claim 1, characterized in that: The gene regulating smooth muscle contraction is a gene that enhances the contractile function of smooth muscle.

3. An AAV vector for regulating smooth muscle contraction according to claim 2, characterized in that: The gene that promotes smooth muscle contractility is the ACTA2 gene, and the AAV vector obtained is pssAAV-CBA-ACTA2-P2A-GFP-bGH-141. The sequence of pssAAV-CBA-ACTA2-P2A-GFP-bGH-141 is shown in SEQ ID NO.

7.

4. The AAV vector for regulating smooth muscle contraction according to claim 2, characterized in that: The gene that promotes smooth muscle contractility is the CNN1 gene, and the AAV vector obtained is pssAAV-CBA-CNN1-P2A-GFP-bGH-141. The sequence of pssAAV-CBA-CNN1-P2A-GFP-bGH-141 is shown in SEQ ID NO.

8.

5. The AAV vector for regulating smooth muscle contraction according to claim 2, characterized in that: The gene that promotes smooth muscle contractility is the TAGLN gene, and the AAV vector obtained is pssAAV-CBA-TAGLN-P2A-GFP-bGH-141. The sequence of pssAAV-CBA-TAGLN-P2A-GFP-bGH-141 is shown in SEQ ID NO.

9.

6. The AAV vector for regulating smooth muscle contraction according to claim 1, characterized in that: The restriction enzyme cutting sites of the multiple cloning site are restriction enzyme cutting sites of HindIII and Kpn2I.

7. A method for constructing an AAV vector for regulating smooth muscle contraction according to any one of claims 1 to 6, characterized in that: The following steps are involved: S1: The pssAAV-CBA-LUC-P2A-GFP-bGH-141 plasmid was double-digested and agarose electrophoresis was performed, followed by gel excision and recovery to obtain the pssAAV-CBA-P2A-GFP-bGH-141 vector fragment; S2: PCR amplification of the gene sequence regulating smooth muscle contraction, gel electrophoresis and gel cutting and recovery, to obtain the gene fragment regulating smooth muscle contraction; S3: connecting the pssAAV-CBA-P2A-GFP-bGH-141 vector fragment obtained above and the gene fragment regulating smooth muscle contraction to obtain a connection product; S4: taking the above ligation product and transforming it into competent E. coli, and then spreading it on an LB agar plate containing ampicillin to obtain a recombinant E. coli containing a recombinant plasmid of a gene regulating smooth muscle contraction; S5: Pick a single clone colony and inoculate it in liquid LB containing ampicillin for shaking culture to screen out positive plasmids; S6: After double restriction digestion identification, the positive plasmid is sequenced and identified to obtain the AAV vector containing the gene that regulates smooth muscle contraction.

8. A transformant, characterized in that: The transformant comprises the AAV vector for regulating smooth muscle contraction according to any one of claims 1 to 6.

9. A pharmaceutical composition, characterized in that: The pharmaceutical composition comprises the AAV vector according to any one of claims 1 to 6 as an active ingredient; and a pharmaceutically acceptable carrier or adjuvant.

10. Use of the AAV vector according to any one of claims 1 to 6, the transformant according to claim 8, or the pharmaceutical composition according to claim 9 in the preparation of a drug for treating related diseases by regulating smooth muscle contraction, wherein the related diseases include gastroesophageal reflux disease, fecal incontinence, chronic constipation, gastroparesis, or urinary incontinence.

Images