Application of schizophyllum commune ergothioneine synthetase genes ScEgt1a and ScEgt2b in synthesis of ergothioneine

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to application of schizophyllum commune ergothioneine synthetase genes ScEgt1a and ScEgt2b in synthesis of ergothioneine, and the ergothioneine synthetase genes ScEgt1a and ScEgt2b are obtained by finding out the sequences of the ergothioneine synthetase genes ScEgt1a and ScEgt2b in genome annotation of schizophyllum commune, performing codon optimization and then utilizing a direct synthesis method. The obtained ergothioneine synthase genes ScEgt1a and ScEgt2b are utilized to construct an engineering vector for starting efficient expression of the ergothioneine synthase genes ScEgt1a and ScEgt2b by using a pichia pastoris promoter pGCW14, the engineering vector is transformed and integrated into a pichia pastoris X33 genome, and a recombinant engineering strain for high yield of ergothioneine is obtained through screening; by optimizing the culture medium composition and fermentation conditions, under the optimal conditions, the recombinant pichia pastoris engineering bacteria are subjected to shake-flask fermentation for 96 hours, the yield of ergothioneine reaches 1.67 g / L, and the method has industrial production prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and particularly relates to application of schizophyllum ergothioneine synthase genes ScEgt1a and ScEgt2b in synthesizing ergothioneine. Background Art

[0002] Ergothioneine (EGT), also known as 2-mercaptohistidine trimethylol salt, is an L-histidine derivative that was isolated from the sclerotium of Claviceps purpurea by scientist Charles Tanret in 1909. It was later discovered that Physarum polycephalum, Cyanobacteria sp., Mycobacterium smegmatis, Mycobacterium tuberculosis, and most non-yeast fungi have the ability to synthesize ergothioneine, among which large edible fungi are richer in ergothioneine.

[0003] The biosynthetic pathway of ergothioneine has been elucidated in the bacteria Mycolicibacteriumsmegmatis and the fungus Neurospora crassa. In Mycolicibacterium smegmatis, there are five genes involved in the synthesis of ergothioneine (egtABCDE), among which EgtD catalyzes the trimethylation of histidine to produce histidine betaine (HER); EgtA catalyzes the synthesis of γ-glutamylcysteine ​​(γ-GC) from glutamate and cysteine; 2+ In the presence of γ-GC and O2, EgtB catalyzes γ-GC and HER to generate γ-glutamyl-histidine trimethyl cysteine ​​sulfoxide (γGC-HER); EgtC removes glutamate to generate histidine trimethyl cysteine ​​sulfoxide (Cys-HER); finally, in the presence of pyridoxal phosphate (PLP), EgtE converts Cys-HER to ergothioneine. In Neurospora crassa, there are two genes involved in the synthesis of ergothioneine (NcEgt1, 2), among which NcEgt1 catalyzes the trimethylation of histidine to HER and the oxidation of HER sulfonic acid to Cys-HER; NcEgt2 converts Cys-HER to ergothioneine. There is no doubt that compared with bacteria, the fungal synthesis of ergothioneine is more concise and efficient, creating more favorable conditions for the production and application of ergothioneine.

[0004] Ergothioneine is an antioxidant with anti-inflammatory and health-care functions. It has been applied to food, health products, cosmetics and other fields. At present, the main methods for producing ergothioneine are direct extraction, chemical synthesis and biosynthesis. Direct extraction is limited by resources, and the extraction process is complicated and the yield is low; chemical synthesis has problems such as expensive raw materials, lengthy synthesis routes and low yields, which is difficult to meet market needs; and with the development of genetic engineering, biosynthesis is highly anticipated and is considered to be the best way to mass produce ergothioneine. Summary of the invention

[0005] The present invention aims to provide a schizophyllum ergothioneine synthase gene ScEgt1a, ScEgt2b and the protein encoded by the gene and the application of the gene in synthesizing ergothioneine.

[0006] In order to achieve the purpose of the present invention, the present invention will be implemented by adopting the technical solution described below.

[0007] A strain of schizophyllum commune synthesizing ergothioneine is isolated from a seabed sediment sample at a depth of nearly 2 km, wherein the genome of the schizophyllum commune comprises ergothioneine synthase genes ScEgt1a and ScEgt2b; the schizophyllum commune was deposited in the General Microbiological Center of China Microbiological Culture Collection Administration on November 24, 2015, with a deposit number of CGMCC NO.11604, an address of the depository unit of No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, a name of the depository unit of the Institute of Microbiology, Chinese Academy of Sciences, a classification name of Schizophyllum commune, a biological material number of 15-5-F01, and the strain is alive.

[0008] A Pichia strain for producing ergothioneine, wherein the Pichia strain simultaneously expresses ergothioneine synthase ScEgt1a and ScEgt2b genes obtained by direct synthesis after codon optimization using the ergothioneine synthase genes ScEgt1a and ScEgt2b; wherein,

[0009] The CDS sequence of the ergothioneine synthase ScEgt1a gene is shown in SEQ ID NO: 1;

[0010] The CDS sequence of the ergothioneine synthase ScEgt2b gene is shown in SEQ ID NO: 3;

[0011] The expression plasmids expressing the ergothioneine synthase genes ScEgt1a and ScEgt2b were transformed into the genome of Pichia pastoris for constitutive expression, thereby obtaining a Pichia pastoris strain for producing ergothioneine.

[0012] The amino acid sequence of the protein ScEgt1a encoded by the ergothioneine synthase ScEgt1a gene is shown in SEQ ID NO:2.

[0013] The amino acid sequence of the protein ScEgt2b encoded by the ergothioneine synthase ScEgt2b gene is shown in SEQ ID NO:4.

[0014] As a preferred embodiment of the present invention, the Pichia pastoris strain is Pichia pastoris X33.

[0015] As a preferred embodiment of the present invention, the expression plasmid is driven by the Pichia pastoris promoter pGCW14 to insert the ergothioneine synthase ScEgt1a gene or the ergothioneine synthase ScEgt2b gene for expression, and has bleomycin or blasticidin resistance; wherein,

[0016] The sequence of the pGCW14 promoter is shown in SEQ ID NO: 5;

[0017] The codon-optimized sequence of the blasticidin resistance gene fragment is shown in SEQ ID NO:6.

[0018] A method for preparing ergothioneine, wherein the preparation method uses the Pichia yeast strain for producing ergothioneine as an engineering strain and optimizes the culture medium composition and culture conditions; wherein,

[0019] The optimized medium included 1% yeast extract, 2% peptone, 2% glucose, 2.5 mM histidine, 2.5 mM cysteine, and 2.5 mM S-adenosylmethionine;

[0020] The optimized culture conditions were: 3% (v / v) seed solution inoculation amount, rotation speed 250 rpm, culture temperature 30°C, and culture time 96 h.

[0021] Application of ergothioneine synthase genes ScEgt1a and ScEgt2b from Schizophyllum in the synthesis of ergothioneine.

[0022] As a further embodiment of the present invention, the ergothioneine synthase genes ScEgt1a and ScEgt2b of Schizophyllum are used in the combined biosynthesis of ergothioneine in vitro.

[0023] As a further embodiment of the present invention, the ergothioneine synthase genes ScEgt1a and ScEgt2b of Schizophyllum are used in the synthesis of ergothioneine in Pichia pastoris.

[0024] Application of a Pichia yeast strain in enhancing ergothioneine synthesis.

[0025] As a further embodiment of the present invention, the Pichia yeast strain is used to increase the content of ergothioneine.

[0026] The invention also provides a recombinant expression vector, a host bacterium and primers for amplifying any fragment of the gene.

[0027] A recombinant expression vector, using pGAPZA as a starting vector, after modification, using a yeast constitutive promoter pGCW14 to start expression of an inserted gene, the inserted gene is ScEgt1a, and has bleomycin resistance; or, using pGAPZA as a starting vector, after modification, using a yeast constitutive promoter pGCW14 to start expression of an inserted gene, the inserted gene is ScEgt2b, and has blasticidin resistance.

[0028] A host bacterium contains the above-mentioned recombinant expression vector.

[0029] Among them, ScEgt1a enzyme can catalyze substrates such as histidine and S-adenosylmethionine to generate histidine trimethyl salt, and then the latter reacts with cysteine, ferrous ions, etc. as substrates to generate histidine trimethyl salt cysteine ​​sulfoxide under the catalysis of ScEgt1a enzyme.

[0030] ScEgt2b enzyme can catalyze the conversion of histidine trimethylolate cysteine ​​sulfoxide into ergothioneine in the presence of substrates such as coenzyme pyridoxal phosphate.

[0031] The mechanism of the present invention is to optimize the preferred codon of Pichia pastoris with the DNA sequence of ergothioneine synthase genes ScEgt1a and ScEgt2b in the genome of Schizophyllum commune Fr. as a template, and then clone the optimized sequence into a vector for starting heterologous gene expression with pGCW14 as a promoter, and integrate the pGCW14-heterologous gene sequence into the genome of Pichia pastoris X33 by homologous recombination technology to obtain a recombinant engineering strain G2, which can efficiently synthesize ergothioneine. Then, the output of Pichia pastoris synthesizing ergothioneine is further improved by optimizing the composition of the culture medium and the fermentation conditions. The composition of the optimized culture medium is: 1% yeast extract, 2% peptone, 2% glucose, 2.5mM histidine, 2.5mM cysteine, and 2.5mM S-adenosylmethionine. The optimized culture conditions are: 3% (v / v) seed liquid inoculation amount, rotation speed 250rpm, culture temperature 30°C, and culture time 96h. Under optimized culture medium and culture conditions, the recombinant engineering strain G2 shake flask fermentation ergothioneine production reached about 1.67g / L, which laid a good foundation for the industrial production of ergothioneine by Pichia pastoris strains. The present invention provides a new biosynthetic pathway for the production of ergothioneine.

[0032] Compared with the prior art, the present invention has the following advantages and effects:

[0033] (1) The origin of ScEgt1a and ScEgt2b genes. The ScEgt1a and ScEgt2b genes reported in the present invention are derived from the basidiomycete Schizophyllum obtained from a seabed sediment sample at a depth of nearly 2 km. The sequence homology of ScEgt1a and ScEgt2b with the ergothioneine synthase genes NcEgt1 and NcEgt2 of Neurospora crassa are 46.3% and 47.8%, respectively, and they are clustered in different branches in the phylogenetic evolutionary tree. ScEgt1a has two Methyltransf_33 domains, while NcEgt1 has only one Methyltransf_33 domain; similarly, ScEgt2b contains two Aminotran_5 domains, while NcEgt2 has only one Aminotran_5 domain. This indicates that ScEgt1a and ScEgt2b are new ergothioneine synthase genes and may have stronger catalytic activity.

[0034] (2) Number of heterologous genes expressed. Using Mycobacterium smegmatis as the gene source, five genes need to be heterologously expressed to complete the catalytic synthesis of ergothioneine. The construction process is complicated and the host bacteria have a heavy burden. However, this study only needs two genes to perform the de novo synthesis of ergothioneine, which is simpler to operate and has high feasibility.

[0035] (3) Selection of Pichia pastoris constitutive expression vector. At present, most ergothioneine biosynthesis schemes select Escherichia coli and Saccharomyces cerevisiae as engineering bacteria, which have the risk of affecting protein expression and further affecting catalytic efficiency due to inappropriate induction conditions. The present invention uses Pichia pastoris constitutive expression vector pGAPZA as a starting vector, which is easy to operate, does not require induction, and has stable expression. In addition, the pGCW14 promoter is selected to replace the pGAP promoter, which further improves the heterologous expression efficiency of the schizophyllum ergothioneine synthase genes ScEgt1a and ScEgt2b cloned using pGAPZA, and achieves efficient synthesis of ergothioneine.

[0036] (4) High ergothioneine yield. A culture medium and culture conditions suitable for the synthesis of ergothioneine by shake flask fermentation of the recombinant engineered strain G2 were obtained. Under these conditions, the yield of ergothioneine synthesized by the recombinant engineered strain G2 was as high as 1.67 g / L, which is better than the yield of wild and engineered strains reported in shake flask fermentation, and lays a good foundation for the industrial production of ergothioneine by Pichia pastoris strains. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 Figure a is the phylogenetic tree of microorganism Egt1, and Figure b is the phylogenetic tree of microorganism Egt2;

[0038] Figure 2The protein domain analysis diagram of Schizophyllum ScEgt1a and ScEgt2b and Neurospora crassa NcEgt1 and NcEgt2;

[0039] Figure 3 The figure shows the agarose electrophoresis detection result of the PCR amplification product of BSD gene, where M: Marker DL5000, lanes 1 and 2: BSD gene;

[0040] Figure 4 The figure is the result of agarose gel electrophoresis detection of pGAPZA-ScEgt2b plasmid PCR amplification product, wherein, M: Marker DL5000, lane 1: PCR amplification product obtained by using plasmid pGAPZA-ScEgt2b as template and ZT-KZ-F / R as primers;

[0041] Figure 5 The figure is the result of agarose gel electrophoresis detection of colony PCR of pGAPZA-ScEgt2b-BSD transformants, wherein, M: Marker DL5000, lanes 1-6: PCR amplification products of homologous recombination connection fragments of pGAPZA-ScEgt2b-BSD transformants;

[0042] Figure 6 Figure 1 is a graph showing the results of agarose gel electrophoresis of PCR amplification products during the construction of the pGCW14 promoter plasmid, wherein Figure a is M: Marker DL15000, Lane 1: PCR amplification product of the pGCW14 sequence; Figure b is M: Marker DL5000, Lane 1: PCR amplification product using plasmid pGAPZA-ScEgt1a as template and G14-KZ-F1 / R1 as primers; Figure c is M: Marker DL5000, Lane 1: PCR amplification product using plasmid pGAPZA-ScEgt2b-BSD as template and G14-KZ-F2 / R2 as primers;

[0043] Figure 7 The results of agarose gel electrophoresis detection of colony PCR of pGCW14 promoter plasmid transformants are shown in Figure a, wherein Figure a is M: Marker DL5000, lanes 1-8: PCR amplification results of homologous recombination connection fragments of pGCW14-ScEgt1a transformants; Figure b is M: Marker DL5000, lane 1: PCR amplification results of homologous recombination connection fragments of pGCW14-ScEgt2b-BSD transformants;

[0044] Figure 8 is the plasmid map of pGCW14-ScEgt1a;

[0045] Fig. 9This is the plasmid map of pGCW14-ScEgt2b-BSD;

[0046] Fig.10 It is the HPLC detection result figure of thioneine, wherein, a figure is the standard curve for detecting thioneine by HPLC; b figure is the HPLC detection peak figure of thioneine standard substance; c figure is the HPLC detection peak figure of sample extracted in the recombinant strain cell;

[0047] Fig.11 The ergothioneine production and growth comparison diagram of the recombinant engineering strains M5 and G2 obtained by cloning and transforming ScEgt1a and ScEgt2b using a plasmid with a promoter of pGAP and a plasmid with a promoter of pGCW14, respectively;

[0048] Fig.12 This is the yield diagram of ergothioneine synthesized by the recombinant engineering strain G2 at different amino acid concentrations (p<0.05);

[0049] Fig.13 This is a graph showing the production of ergothioneine synthesized by the recombinant engineering strain G2 under different culture conditions (p<0.05). DETAILED DESCRIPTION

[0050] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0051] The experimental methods in the following examples without specific experimental conditions are usually carried out under conventional experimental conditions or the experimental conditions recommended by the manufacturer. The materials and reagents used are commercially available unless otherwise specified.

[0052] As an embodiment of the present invention, Figure 1 to Figure 2 As shown, the acquisition and bioinformatics analysis of the sequences of ScEgt1a and ScEgt2b of ergothioneine synthase from Schizophyllum:

[0053] Based on the genome information of Schizophyllum, the genes ScEgt1a and ScEgt2b annotated as ergothioneine synthase were obtained. The sequence homology of ScEgt1a and ScEgt2b with the ergothioneine synthesis genes NcEgt1 and NcEgt2 of Neurospora crassa were 46.3% and 47.8%, respectively, and their protein sequences were clustered in different branches in the phylogenetic tree, such as Figure 1As shown in Figures a and b in the figure, it shows that the two are distantly related. In addition, ScEgt1a and NcEgt1 both have similar activity to sulfoxide synthase EgtB and histidine-specific methyltransferase EgtD, but NcEgt1 has only one Methyltransf_33 domain at the N-terminus of the sequence, while ScEgt1a has two Methyltransf_33 domains; ScEgt2b and NcEgt2 have pyridoxal phosphate-dependent cysteine ​​desulfurase activity similar to EgtE, but NcEgt2 has only one Aminotran_5 domain, while ScEgt2b contains two Aminotran_5 domains, such as Figure 2 This indicates that ScEgt1a and ScEgt2b are new ergothioneine synthases, which may have stronger catalytic activity.

[0054] As an embodiment of the present invention, Figures 3 to 7 As shown in the figure, the expression vector of ScEgt1a and ScEgt2b of ergothioneine synthase gene of Schizophyllum is constructed:

[0055] (1) Strains and plasmids

[0056] The Schizophyllum was isolated from a sample of ocean floor sediment at a depth of nearly 2 km and was deposited in the General Microbiology Center of the China Culture Collection Administration on November 24, 2015, with the deposit number CGMCC NO.11604.

[0057] Pichia pastoris X33: used to express heterologous proteins and preserved in this laboratory.

[0058] M5: An engineered strain constructed by transforming Pichia pastoris X33 into pGAPZA-ScEgt1a and pGAPZA-ScEgt2b-BSD plasmids. The pGAP promoter drives the expression of ScEgt1a and ScEgt2b genes. It is preserved in this laboratory.

[0059] pGAPZA: Pichia pastoris protein expression vector, high copy, with strong promoter pGAP, zeocin resistance, and a histidine tag sequence at the C-terminus; preserved in this laboratory; used for the expression of heterologous proteins.

[0060] The CDS sequences of the obtained ergothioneine synthase genes ScEgt1a and ScEgt2b were codon-optimized according to the codon preference of Pichia pastoris, and then handed over to a biological company to directly synthesize plasmids pGAPZA-ScEgt1a and pGAPZA-ScEgt2b.

[0061] The sequence fragment of the blasticidin resistance gene (BSD) was obtained from the Snapgene official website, codon optimized according to the codon preference of Pichia pastoris, and then directly synthesized by a biological company.

[0062] The pGCW14 promoter sequence fragment was obtained from the literature, codon optimized according to the codon preference of Pichia pastoris, and directly synthesized by a biological company.

[0063] (2) Construction of pGAPZA-ScEgt2b-BSD plasmid: Using the plasmid containing the BSD gene as a template and BSD-KZ-F / R5 as primers, PCR amplification of the BSD gene was performed. After the program was completed, the band size was detected by 1% agarose gel electrophoresis. Figure 3 As shown, the amplified fragment of BSD with homology arms was obtained, gel recovery and sequencing verification. ZT-KZ-F / R primers were selected, and high-fidelity enzyme was used to perform reverse PCR amplification on plasmid pGAPZA-ScEgt2b to obtain the linear fragment of the vector. The electrophoresis results of the fragment are shown in Figure 4 The amplified fragment of BSD was connected to the linear fragment of the vector by homologous recombination. For details, see II One Step Cloning Kit instructions, transformed into E. coli DH5α competent cells, picked transformants, and used BSD-YZ-F / R primers for colony PCR verification. The electrophoresis results are as follows Figure 5 The correct transformants were inoculated into LB liquid medium and cultured overnight at 37°C. The plasmids were extracted and sequenced. The correct sequence was the recombinant plasmid pGAPZA-ScEgt2b-BSD.

[0064] (3) Construction of pGCW14ZA-ScEgt1a and pGCW14ZA-ScEgt2b-BSD vectors: Using the Pichia pastoris X33 genome as a template and G14-KZ-F1 / R1 and G14-KZ-F2 / R2 as primers, the promoter pGCW14 sequence was amplified by PCR to obtain the amplified fragment of pGCW14 with homology arms, such as Figure 6 As shown in Figure a, gel recovery and sequencing verification; G14-KZ-F1 / R1 and G14-KZ-F2 / R2 were selected to use high-fidelity enzymes to perform reverse PCR amplification on plasmids pGAPZA-ScEgt1a and pGAPZA-ScEgt2b-BSD to obtain vector linear fragments. The results are shown in Figure 6 As shown in Figure b and Figure c; the amplified fragment was connected to the linear vector by homologous recombination method and transformed into Escherichia coli DH5α competent cells. The transformants were picked and colony PCR amplification was performed using G1-YZ-F / R and G2-YZ-F / R. The PCR amplification products were shown in Figure 7As shown in Figure a and Figure b in the figure; the correctly verified transformant was inoculated into LB liquid culture medium, and after overnight culture, the plasmid was extracted and sequenced for further verification. If the verification was correct, the recombinant plasmids pGCW14-ScEgt1a and pGCW14-ScEgt2b-BSD were obtained, as shown in Figure 2. Figure 8 and Fig. 9 shown.

[0065] As an embodiment of the present invention, the expression strains of ScEgt1a and ScEgt2b genes of Schizophyllum ergothioneine synthase were constructed:

[0066] (1) Linearization of recombinant plasmid: Prepare the enzyme digestion system according to the following ratio and perform enzyme digestion in a metal bath at 37°C overnight.

[0067]

[0068] (2) Preparation of Pichia competent cells: Pick a single colony of Pichia and inoculate it in 5 mL of YPD medium, and culture it at 30°C overnight to prepare a seed solution. In a 250 mL conical flask containing 100 mL of YPD medium, inoculate 20-100 μL of the seed solution and culture it at 30°C overnight until OD600 = 1.3-1.5. Then take 100 mL of the bacterial solution, centrifuge it at 4°C and 1500g for 5 min, and discard the supernatant. Wash the precipitate twice with 0°C sterile water and once with 50 mL of 1M sorbitol, then completely remove the supernatant and resuspend it with 1M sorbitol to a final volume of about 0.3 mL.

[0069] (3) Linearized recombinant plasmid transformation: pGCW14-ScEgt1a and pGCW14-ScEgt2b-BSD plasmids were transformed successively. 80-100 μL of Pichia competent cells were mixed with 5-10 μL of linearized pGCW14-ScEgt1a and pGCW14-ScEgt2b-BSD plasmids, and quickly transferred to a pre-cooled 0.2 cm electrode cup and placed on ice for 5 min. Then the electrode cup was placed in an electroporator and electroporated according to the following parameters: 1.5 kV, capacitance 25 μF, resistance 200 Ω, 4.8-5.5 ms. Immediately after the electroporation, 900 μL of ice-cold 1 M sorbitol was added and the mixture was allowed to stand at 30°C for 1-2 h. After standing, the mixture was transferred to a 1.5 mL EP tube and centrifuged at 5000 g for 2 min at 4°C. 400-600 μL of supernatant was discarded and resuspended. Take 50-200 μL of bacterial solution and spread it evenly on the plate containing the corresponding resistance, invert it in a 30°C incubator away from light and culture for about 4-5 days until the transformants grow.

[0070] (4) Identification of recombinant strains: Pick a single colony from the resistance plate and inoculate it into a 50 mL conical flask containing 3 mL YPD medium, and culture it overnight at 30°C, 200 rpm. Take 1 mL of the overnight culture solution and place it in a 1.5 mL centrifuge tube, centrifuge it at 12000g for 2 min to remove the supernatant, and resuspend it in 1 mL of deionized water for washing. Centrifuge it at 12000g for 2 min to remove the supernatant, and resuspend it in 100 μL TE buffer. After boiling it in a 100°C boiling water bath for 15 min, quickly transfer it to ice, ice bath it for 15 min, and then centrifuge it at 12000g for 2 min. The supernatant obtained by centrifugation is amplified by PCR using primers G1-YZ-F / R and G2-YZ-F / R respectively. The amplified products are sent to a sequencing company for sequencing after being detected by agarose gel electrophoresis. The ones with correct sequencing are the successfully constructed recombinant engineering strains G2, which are stored in glycerol with a final concentration of 15% and stored at -80°C for future use.

[0071] As an embodiment of the present invention, Fig.10 As shown in Figures a, b and c, detection of ergothioneine synthesis by the recombinant engineering strain G2:

[0072] (1) The recombinant engineered strain G2 was inoculated into a 25 mL conical flask containing 5 mL YPD medium and cultured at 30°C and 250 rpm until OD600 = 2, which was used as seed liquid. The seed liquid was inoculated into new YPD liquid medium at a 1% v / v inoculation amount and cultured at 30°C and 250 rpm for 24 h. 1-5 mL of the bacterial liquid was centrifuged at 5000 g for 5 min at 25°C to separate the medium and the bacteria. The bacteria were fully washed with ddH2O and resuspended, and then boiled in 100°C water for 30 min and then ice-bathed for 15 min. The supernatant was collected, i.e., the cell extract. The cell extract was filtered with a 0.22 μm filter membrane, and the filtrate was used for HPLC detection.

[0073] (2) Standard curve preparation method: prepare thioneine standard solutions with concentrations of 10 mg / L, 25 mg / L, 50 mg / L, 75 mg / L, and 100 mg / L, use HPLC to detect peak area, and the test results are plotted as shown in Fig.10 The standard curve of ergothioneine concentration-peak area shown in Figure a.

[0074] (3) HPLC detection conditions: The HPLC instrument is Thermo Fisher's Ultimate 3000 HPLC instrument and ChromeleonTM chromatography data system. The chromatographic column is Waters' XBridge C18 reverse phase column, with specifications of 4.6 mm × 250 mm and an inner diameter of 5 μm. The detection conditions are as follows: the mobile phase ratio is pure water: acetonitrile = 95:5, column temperature is 30°C, flow rate is 0.7 mL / min, detection wavelength is 258 nm, injection volume is 5 μL, and detection time is 15 min. The detection results are as follows: Fig.10 As shown in Figures b and c in Figure 2, substitute into the standard curve to obtain the concentration of ergothioneine.

[0075] Adopting the above method, the synthetic ergothioneine yield of M5 strain is detected and compared with G2. The result is as follows Fig.11 As shown, the ergothioneine production of the G2 engineered bacteria driven by the pGCW14 promoter was significantly higher than that of the M5 strain driven by the pGAP promoter.

[0076] As an embodiment of the present invention, Fig.12 and Fig.13 As shown, the optimization of the conditions for synthesizing ergothioneine by the recombinant engineering strain G2 is as follows:

[0077] (1) For culture medium optimization: Different concentrations of histidine, cysteine, and S-adenosylmethionine were added to a culture medium containing 1% yeast extract, 2% peptone, and 2% glucose to explore the effects of different concentrations of histidine, cysteine, and S-adenosylmethionine on the production of ergothioneine synthesized by the recombinant engineered strain G2.

[0078] (2) For optimization of culture conditions: In the culture medium optimized by d, the effects of inoculum size (volume ratio: 1%, 2%, 3%, 4%, 5%), temperature (24, 27, 30, 33, 36°C) and rotation speed (100, 150, 200, 250, 300rpm) on the production of thioneine synthesized by the recombinant engineering strain G2 were explored respectively. Then, under the optimal combination of the above factors, the effects of incubation time (24, 48, 72, 96, 120h) on the production of thioneine synthesized by the recombinant engineering strain G2 were explored. The production of thioneine was detected by HPLC method.

[0079] According to the thioneine production, the optimized medium composition is 1% yeast extract, 2% peptone, 2% glucose, 2.5mM histidine, 2.5mM cysteine, and 2.5mM S-adenosylmethionine. The recombinant engineering strain G2 was cultured with this medium, and the thioneine production was 251.12mg / L, which is 1.56 times that before optimization. Fig.12 and Fig.13The optimized culture medium was used to culture the recombinant engineered strain G2, and the optimal culture conditions of 3% (v / v) seed solution inoculation, 250 rpm rotation speed, 30°C culture temperature, and 96 h culture were selected to produce 1.67 g / L of ergothioneine, which was 6.62 times that before optimization.

[0080] Primer sequences

[0081]

[0082]

[0083]

[0084] Gene sequence:

[0085] SEQ ID NO:1

[0086] ScEgt1a optimized CDS sequence

[0087]

[0088] SEQ ID NO:2

[0089] ScEgt1 amino acid sequence

[0090] Met Pro Ala Glu Ile Leu Asp Val His Pro His Asp Glu Gly Val Val ValAsp Asp Ile His Gln Gln Ile Arg Asp Gly Leu Thr Lys Pro Ala Gly Glu Lys HisLeu Pro Thr Met Leu Leu Tyr Asp Glu Arg Gly Leu Arg Leu Tyr Asp Thr Ile ThrThr Asp Ala Lys Glu Tyr Tyr Leu Phe Gly Ala Glu Glu Glu Ile Leu Lys Gln HisSer Asp Ala Ile Val Arg Ala Met His Gly Gly Arg Asp Val Val Gly Gly Asp GluVal Val Leu Glu Leu Gly Ala Gly Ala Leu Arg Lys Thr Ser His Ile Leu Ser AlaLeu Ala Arg Leu Val Pro Lys Pro Gln Ala Met Pro Pro Ile Thr Tyr Tyr Ala LeuAsp Leu Glu Gln Asn Glu Leu Gln Arg Thr Leu Asp Gly Ile Ala His Asp Glu ValGly Thr Ala Leu Glu Gly Arg Val Ala Thr Lys Gly Met Cys Gly Thr Tyr Asp GlyGly Ile Lys Phe Val Lys Thr Gly Gly Leu Leu Met Arg Gly Val Ala Asp Arg LeuSer Ser Ala Ser Pro Ser Ser Ser Arg Ser Pro Glu Ser Ser Arg Ser Pro Pro ArgAsp Arg Glu Arg Ser Leu Ser Asp Ser Ser Ser Ala Ser Thr Glu Glu Ser Ser LeuPro Ala Thr Pro Arg Ser Asp Ile Ala Glu Ala Ala Asp Ile Pro Ala Asp Ser ProPro Leu His Ile Leu Phe Leu GlySer Ser Leu Gly Asn Phe Asp Arg Asp Ala GlySer Ala Phe Leu Lys Ala Leu Pro Leu Arg Pro Gly Ser Gly Asp Thr Leu Leu LeuGly Met Asp His Asp Asn Asp Lys Ser Arg Ile Glu Val Ala Tyr Asn Asp Pro GluGly His Thr Lys Arg Phe Ile Met Asn Gly Leu His His Ala Gly Arg Leu Leu GlyAsp Glu Thr Met Phe Asp Asp Ser Lys Trp Asp Tyr Val Asn Arg Tyr Asn Val GluGlu Arg Arg His Glu Ala Phe Leu Val Ser Lys Ile Glu Gln Thr Val Val Glu ProSer Thr Gly Lys Ala Tyr Ser Phe Leu Pro Asn Glu Lys Leu Lys Ile Glu Glu SerLeu Lys Phe Ser Glu Leu Asp Ala Tyr Thr Leu Phe Thr Glu Ala Gly Leu Arg ProVal His Arg Trp Thr Asp Ser Ala Arg Gln Tyr Ser Leu Trp Leu Leu Glu Arg ProAla Phe Val Phe Pro Leu Val Lys Thr Pro Val Ala Arg Thr Pro Asp Asp Ile ValLeu Ser Ser Ser Pro Phe Gly Ile Pro Ser Val Ser Asp Trp Gln Thr Met Trp AlaCys Trp Asp Thr Ile Thr Leu Ser Met Ile Pro Glu Glu Met Leu His Thr Lys ProIle Asp Leu Arg His Ile Cys Leu Phe Tyr Leu Gly His Ile Pro Ala Phe Leu AspIle Phe Leu Ser Arg Tyr Phe Lys Glu Pro His Thr Glu ProGlu Tyr Phe Lys AspIle Phe Glu Arg Gly Ile Asp Pro Asp Val Asp Asp Pro Thr Gln Cys His Ser HisSer Gln Val Pro Glu Arg Pro Glu Asp Trp Pro Ala Leu Gln Gln Val Leu Asp PheGlu Lys Arg Val Arg Gln Arg Leu Thr Ser Ile Tyr Glu Gly Val Val Ala Arg ArgIle Pro Leu Thr Ala Arg Leu Ala Arg Val Leu Met Ile Thr Tyr Glu His Glu AlaMet His Ala Glu Thr Leu Leu Tyr Met Leu Leu Met Lys Ala Gly Glu Gly Leu ArgAla Pro Lys Gly Phe Ala Pro Pro Pro Trp Glu Ala Leu Met Glu Ala Trp Asp AlaGlu Pro Glu Leu Glu Gly Glu Pro Leu Thr Ile Gly Pro Ala Glu Val Ser Leu GlyHis Asp Asp Asp Glu Thr Leu Asp Glu Gln Val Ser Glu Glu Asp Val Arg Arg ArgGlu Phe Gly Trp Asp Asn Glu His Pro Val Arg Thr Glu Lys Val Gly Lys Val ArgMet Ser Trp Arg Pro Ile Ser Asn Gly Glu Phe Tyr Thr Tyr Trp Ser Ala Asn ArgAla Thr Val Pro Leu Pro Pro Ser Trp Val Glu Pro Ala Lys Asp Asp Thr Ser ThrSer Asn Thr Ala Asp Pro Tyr Gly Gly Met Arg Val Arg Thr Leu Tyr Gly Ser ValPro Met Lys Tyr Ala His Arg Trp Pro Val Met Ala Ser Tyr Asp Met Leu Ser ThrTyrAla Val Val Arg Gly Gly Arg Leu Pro Thr Glu Ala Glu Leu Arg Leu Phe Leu Asp Lys Phe Glu Ser Gly Tyr Glu Gly Gly Ala Asn Val Gly Phe Arg Asn Trp His Pro Thr Pro Pro Arg Val Val Lys Gly Lys Ala Glu Gly Gly Glu Val Lys Leu Thr Asn Gly Gly Val Trp Glu Trp Thr Ser Thr Val Phe Asp Lys Val Glu Gly Phe Lys Ala Ser Val Leu Tyr Pro Gly Tyr Ser Gln Asp Phe Phe Asp Gly Arg His Asn Val Val Leu Gly Gly Ser Tyr Ala Thr Ile Pro Arg Leu Ala Gly Arg Arg Ser Leu Arg Asn Trp Tyr Gln Arg Asn Tyr Pro Tyr Pro Trp Val Gly Ala Arg Ile Val Tyr Asp Ala。

[0091] SEQ ID NO:3

[0092] Optimized CDS sequence of ScEgt2b

[0093]

[0094] SEQ ID NO:4

[0095] ScEgt2b amino acid sequence

[0096] Met Ser Val Tyr Pro Pro Ala Ser Ser Arg Gly Arg Leu Gly Arg Asp HisVal Leu Arg Leu Asp Pro Asp Tyr Val Asn Leu Asn His Gly Ser Tyr Gly Ser CysPro Ser Ser Val Met Glu Phe Ala Phe Asp Leu Gly Arg Lys Ile Glu Arg Asn ProAsp Tyr Phe Asp Arg Val Ala Val Lys Pro Met Leu Ala Lys Ile Arg Ala Gln LeuAla Glu Phe Ile Gly Val Lys Ser Ser Glu Val Val Ile Val His Asn Ala Ser HisGly Val Asn Thr Val Leu Trp Asn Ile Glu Trp Ala Pro Glu Asp Thr Ile Val IleThr His Leu Pro Asp Gly Ser Pro Asn Ala Asn Pro Thr Ser Thr Gly Lys Ile ValAla Ile Ile Asp Thr Ile Ser Ser Asn Pro Gly Ile Leu Asn Pro Trp Val Asp MetVal Lys Ile Ala Lys Arg His Gly Ala Leu Ala Val Tyr Gly Ala His Ser LeuGly Gln Glu Val Asp Leu Lys Asp Lys Leu Ala Glu Ala Asp Pro Asp Phe Phe ValSer Asn Ala His Lys Trp Leu Tyr Ala Lys Arg Gly Ala Ala Leu Phe Tyr Val ProGlu Arg Asn Gln Gly Ile Val Lys Ala Ser Phe Pro Val Ser Pro Tyr Tyr Val SerPro Lys Asp Arg Glu Ser Pro Ser Asp Asn Phe Val Val Gln His Asn Leu Thr AlaThr Ile Asp Trp Ser Asn Phe PheThr Ile Pro Ala Ala Leu Gln Phe Arg Ala TrpLeu Gly Gly Glu Ala Ala Ile Asn Ala Tyr Thr His Lys Leu Ala Phe Glu Gly GlyLys Arg Ile Ala Glu Ile Leu Gln Thr Glu Met Tyr Pro Asp Glu Asp Ser GlyMet Glu Leu Ser Met Val Asn Val Ala Leu Pro Leu Pro Ala Phe Gly Lys Val ValGly Pro Gly Ala Gly Gly Glu Ile Ser Arg Glu Glu Tyr Ala Phe Gln Met Lys ValGln Gly Leu Ile Gln Arg Lys Leu Leu Glu Glu Arg Asn Leu Gly Arg Pro Gly IleIle Ile Thr Asp Gly Cys Gly Cys Gly Leu Val Gly Arg Cys Gly Trp Arg Cys MetGlu Asp Phe Glu Lys Val Gly Trp Ala.

[0097] SEQ ID NO:5

[0098] Nucleotide sequence of blasticidin resistance fragment

[0099] ATGGCCAAGCCTTTGTCTCAAGAAGAATCCACCCTCATTGAAAGAGCAACGGCTACAATCAACAGCATCCCCATCTCTGAAGACTACAGCGTCGCCAGCGCAGCTCTCTCTAGCGACGGCCGCATCTTCACTGGTGTCAATGTATATCATTTTACTGGGGGACCTTGTGCAGAACTCGTGGTGCTGGGCACTGCTGCTGCTGCGGCAGCTGGCAACCTGACTTGTATCGTCGCGATCGGAAATGAGAACAGGGGCATCTTGAGCCCCTGCGGACGGTGCCGACAGGTGCTTCTCGATCTGCATCCTGGGATCAAAGCCATAGTGAAGGACAGTGATGGACAGCCGACGGCAGTTGGGATTCGTGAATTGCTGCCCTCTGGTTATGTGTGGGAGGGCTAA。

[0100] SEQ ID NO:6

[0101] Nucleotide sequence of the pGCW14 promoter

[0102] .

[0103] The implementation modes of the present invention are described in detail above in conjunction with the embodiments / drawings, but the present invention is not limited to the above-mentioned implementation modes. For ordinary technicians in this technical field, after knowing the contents recorded in the present invention, they can make several equivalent changes and substitutions thereto without departing from the principle of the present invention, and these equivalent changes and substitutions should also be regarded as belonging to the protection scope of the present invention.

Claims

1. A strain of Schizophyllum commune Fr. producing ergothioneine, characterized in that The schizophyllum is isolated from a seabed sediment sample at a depth of nearly 2 km, and the genome of the schizophyllum contains ergothioneine synthase genes ScEgt1a and ScEgt2b; the ergothioneine-producing schizophyllum was deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration on November 24, 2015, with a deposit number of CGMCC NO.11604.

2. A Pichia pastoris strain for producing ergothioneine, characterized in that, The Pichia pastoris strain simultaneously expresses the ergothioneine synthase ScEgt1a and ScEgt2b genes obtained by direct synthesis after codon optimization using the ergothioneine synthase genes ScEgt1a and ScEgt2b in claim 1; wherein, The CDS sequence of the ergothioneine synthase ScEgt1a gene is shown in SEQ ID NO: 1; The CDS sequence of the ergothioneine synthase ScEgt2b gene is shown in SEQ ID NO: 3; The expression plasmids expressing the ergothioneine synthase genes ScEgt1a and ScEgt2b were transformed into the genome of Pichia pastoris for constitutive expression, thereby obtaining a Pichia pastoris strain for producing ergothioneine.

3. a kind of Pichia yeast strain for producing thioneine according to claim 2, is characterized in that, The expression plasmid is driven by the Pichia pastoris promoter pGCW14 and inserted into the ergothioneine synthase gene ScEgt1a or ScEgt2b for expression, and has bleomycin or blasticidin resistance; wherein, The sequence of the pGCW14 promoter is shown in SEQ ID NO: 5; The codon-optimized sequence of the blasticidin resistance gene fragment is shown in SEQ ID NO:

6.

4. A Pichia yeast strain for producing ergothioneine according to claim 3, characterized in that, The Pichia pastoris strain is Pichia pastoris X33.

5. A method for preparing ergothioneine, characterized in that, The preparation method is prepared by using the Pichia yeast strain for producing ergothioneine as claimed in claim 2 as an engineering strain and optimizing the culture medium composition and culture conditions; wherein, The optimized medium included 1% yeast extract, 2% peptone, 2% glucose, 2.5 mM histidine, 2.5 mM cysteine, and 2.5 mM S-adenosylmethionine; The optimized culture conditions were: 3% (v / v) seed solution inoculation amount, rotation speed 250 rpm, culture temperature 30°C, and culture time 96 h.

6. Application of ergothioneine synthase genes ScEgt1a and ScEgt2b from Schizophyllum in the synthesis of ergothioneine.

7. The use according to claim 6, characterized in that: The invention relates to the application of the schizophyllum ergothioneine synthase genes ScEgt1a and ScEgt2b in the in vitro combined biosynthesis of ergothioneine.

8. The use according to claim 6, characterized in that: The schizophyllum ergothioneine synthase genes ScEgt1a and ScEgt2b are used in synthesizing ergothioneine in Pichia pastoris.

9. Use of a Pichia yeast strain in enhancing ergothioneine synthesis.

10. The use according to claim 9, characterized in that: The application of the Pichia yeast strain in improving the yield of ergothioneine.

Images