Tobacco CBL family gene NtCBL10, bio-based material containing same and application

Abstract

The invention discloses an application of a tobacco CBL family gene NtCBL10 in regulation and control of a tobacco chloride ion accumulation process, a nucleotide sequence of the gene NtCBL10 is shown as SEQ ID NO.1 or SEQ ID NO.3, and an amino acid sequence coded by the gene NtCBL10 is shown as SEQ ID NO.2 or SEQ ID NO.4. A new high-quality tobacco variety with a chloride ion absorption regulation and control capability is cultivated through a transgenic technology, and the tobacco CBL family gene NtCBL10 can be applied to regulation and control of chloride ion accumulation of tobacco leaves. The method has good scientific significance and application value in the aspects of improving the combustibility of the tobacco, improving the quality of the tobacco and the like.

Description

Technical Field

[0001] The present invention relates to the field of gene editing technology, and more specifically, to the application of tobacco CBL family gene NtCBL10 in regulating the chloride ion accumulation process of tobacco leaves. Background Art

[0002] Tobacco is a crop that is sensitive to chlorine. Too low or too high a chlorine content will have an adverse effect on tobacco. If the chlorine content of tobacco leaves is too high, the plants will be short, the leaf area will be small, the leaf color will be dull, the oil content will be low, and the potassium-chlorine ratio will decrease, which will directly affect the aroma, taste, hygroscopicity and combustibility of tobacco leaves, making them difficult to store and easy to deteriorate. If the chlorine content is too low, it will easily lead to insufficient content in tobacco leaves, and reduced elasticity and silk yield. Therefore, controlling the chloride ion content in tobacco leaves is crucial to ensuring the quality of tobacco leaves.

[0003] In recent years, the results of the study on the chlorine content of domestic tobacco leaves show that there is an imbalance in the chlorine content in tobacco areas across the country. The tobacco growing season in the south is the rainy season, so the soil chlorine content in most tobacco fields in the south is low, which is also the main reason for the low chlorine content of tobacco in the south; while the northern tobacco areas, especially the Huanghuai tobacco areas, have excessively high chloride ion content, and high chloride is the main factor affecting the smoking quality of tobacco leaves in the north. Therefore, the present invention simulates a high-chlorine environment, explores and applies genes that regulate the chloride ion content of tobacco leaves, which has great scientific significance and application value for cultivating new high-quality tobacco varieties with the ability to regulate chloride ion absorption, improving tobacco combustibility, and improving tobacco quality. Summary of the invention

[0004] In order to solve the problems existing in the prior art, the present invention proposes a new application of a tobacco CBL family gene NtCBL10 in tobacco. Through identification, it is obtained that the gene has a new function of regulating chlorine accumulation in tobacco leaves, and expands the new use of the gene in regulating chloride ion absorption in tobacco.

[0005] The technical problem to be solved by the present invention is achieved through the following technical solutions:

[0006] The present invention provides an application of a tobacco CBL family gene NtCBL10 in regulating the accumulation of chloride ions in tobacco leaves, wherein the nucleotide sequence of the gene comprises any one of the following (1) to (4):

[0007] (1) the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.3; or,

[0008] (2) a nucleotide sequence having at least 90% sequence identity with the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.3; or,

[0009] (3) a nucleotide sequence that adds, replaces, deletes or modifies one or more bases in the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.3 and expresses a protein with the same function; or,

[0010] (4) A nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO.1 or SEQ ID NO.3 under stringent conditions.

[0011] Preferably, the amino acid sequence of the protein encoded by the NtCBL10 gene comprises any one of the following (5) to (7):

[0012] (5) the amino acid sequence shown in SEQ ID NO.2 or SEQ ID NO.4; or,

[0013] (6) an amino acid sequence having at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO.2 or SEQ ID NO.4; or,

[0014] (7) Adding, substituting, deleting or modifying one or more amino acid residues in the amino acid sequence shown in SEQ ID NO.2 or SEQ ID NO.4, and expressing the amino acid sequence of a protein with the same function.

[0015] The present invention also provides a biological material comprising the NtCBL10 gene, wherein the biological material is a recombinant expression vector, an expression cassette or a recombinant bacterium.

[0016] The present invention also provides application of the above biological material in transgenic plants for regulating chlorine accumulation.

[0017] Preferably, the tobacco CBL family gene NtCBL10 gene can affect the chloride ion content in tobacco leaves, and knocking out the NtCBL10 gene can reduce the chloride ion content in tobacco leaves.

[0018] Preferably, the transgenic plant is tobacco.

[0019] The present invention also provides a method for cultivating transgenic plants with improved potassium accumulation capacity, wherein the transgenic plants are obtained by introducing the recombinant expression vector of the NtCBL10 gene into a recipient plant, or by using CRISPR / Cas9-mediated gene editing technology, a CRISPR / Cas9 gene editing vector for knocking out the NtCBL10 gene is constructed, and the transgenic plants with edited NtCBL10 gene are obtained through genetic transformation.

[0020] Preferably, the promoter contained in the recombinant expression vector is a 35S promoter, and the recombinant expression vector includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment; the recombinant expression vector contains the 3′ non-translated region of the exogenous gene.

[0021] Preferably, the recombinant expression vector is pCAMBIA-1300-221, pGreen0029, pCAMBIA3301, pBI121, pBin19, pCAMBIA2301, pCAMBIA1301-UbiN, pORE-Cas9, pYLCRISPR / cas9-MT, pCas9gRNA7, pCas9gRNA7-GFP or other derived plant expression vectors.

[0022] When the gene is used to construct a recombinant expression vector, any enhancing, constitutive, tissue-specific or inducible promoter can be added before the transcription start nucleotide, such as the cauliflower mosaic virus (CAMV) 35S promoter, the ubiquitin gene Ubiquitin promoter (pUbi), the stress-induced promoter rd29A, etc., which can be used alone or in combination with other plant promoters.

[0023] In addition, when using the gene of the present invention to construct a recombinant expression vector, an enhancer may also be used, including a translation enhancer or a transcription enhancer. These enhancer regions may be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are wide-ranging and may be natural or synthetic.

[0024] The translation initiation region can be derived from the transcription initiation region or the structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the recombinant expression vector used can be processed, such as adding genes encoding enzymes or luminescent compounds that can be expressed in plants and can produce color changes, antibiotic markers with resistance, or chemical agent resistance marker genes. It is also possible to directly screen transformed plants by adversity without adding any selective marker genes.

[0025] More specifically, the recombinant expression vector is a pDC45-NtCBL10 gene knockout vector.

[0026] The present invention also provides a tobacco variety, which is cultivated by adopting the above method.

[0027] The beneficial effects of the present invention are:

[0028] The tobacco CBL family gene NtCBL10 of the invention is a positive regulatory factor for the chloride ion content in tobacco leaves.

[0029] The present invention can regulate the chloride ion content in tobacco leaves by adjusting the expression level of the NtCBL10 gene, and obtain transgenic crops with different expression levels of the NtCBL10 gene by genetic engineering means. The present invention meets the needs of modern agricultural development, and has important practical value and market prospects for regulating the chloride content in tobacco leaves, improving the combustibility of cigarettes, and improving tobacco quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] The accompanying drawings, which are incorporated in and constitute a part of the specification, illustrate embodiments of the invention and, together with the description, serve to explain the principles of the invention.

[0031] Figure 1 Alignment of NtCBL10A and NtCBL10B protein sequences.

[0032] Figure 2 Phylogenetic tree and protein sequence alignment of CBL10 proteins. (A): Phylogenetic analysis of AtCBLs and NtCBL10A, NtCBL10B, EsCBL10a, EsCB110b, PtCBL10A, PtCBL10B, S1CBL10 proteins. (B): Sequence alignment of CBL10 proteins from different plant sources, with identical amino acids shown as a black background.

[0033] Figure 3 Editing sites and sequencing peak diagram for NtCBL10 gene knockout material.

[0034] Figure 4 The phenotypes of tobacco leaves of wild-type material (WT) and double mutant (Nt-cbl10a10b) on the 8th day of high chlorine treatment (the second day when the NaCl concentration reached 100 mM), scale bar = 10 cm.

[0035] Figure 5 Analysis of chloride ion content in tobacco leaves of wild-type (WT) and double mutant (Nt-cbl10a10b) plants under high chloride treatment (100 mM NaCl) and normal treatment (1 / 2 Hoagland nutrient solution). Statistical significance was analyzed using one-way ANOVA with LSD test (*p<0.05).

[0036] Figure 6 The phenotypes of the wild-type material (WT) and the double mutant material (Nt-cbl10a10b) at different time points (0-5 days) under high chloride treatment (100 mM NaCl) conditions.

[0037] Figure 7Figure 2 shows the chloride ion content of leaves of wild-type and double mutant materials at different time points (0-5 days) under high chloride treatment (100 mM NaCl). Statistical significance was analyzed using one-way ANOVA with LSD test (*p<0.05). DETAILED DESCRIPTION

[0038] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0039] Example 1: Construction of NtCBL10 gene knockout material

[0040] 1. The NtCBL10 gene includes NtCBL10A and NtCBL10B.

[0041] The NtCBL10A gene is the CDS and UTR fragment in the LOC107817068 gene sequence (GenBank No. XM 016642847.1), as shown below:

[0042]

[0043]

[0044] The amino acid sequence of the NtCBL10A protein encoded by the NtCBL10A gene is shown below:

[0045]

[0046] The nucleotide sequence of the NtCBL10B gene is the CDS and UTR fragments in the LOC107831597 gene sequence (GenBank No. XM_016659380.1), as shown below:

[0047]

[0048]

[0049] The amino acid sequence of the NtCBL10B protein encoded by the NtCBL10B gene is as follows:

[0050]

[0051] 2. Based on the obtained NtCBL10A (SEQ ID NO: 1) and NtCBL10B sequences (SEQ ID NO: 3), the sgRNA was determined to be: CGTCCCAACAAGAAGAAGTT, and the knockout primers pDC45-NtCBL10-F / pDC45-NtCBL10-R were designed. The knockout pDC45 plasmid was digested with BsaI restriction endonuclease and the pDC45-NtCBL10 gene knockout vector was constructed.

[0052]

[0053] Example 2: Screening and identification of NtCBL10 knockout materials

[0054] 1. Screening of NtCBL10 knockout materials. The pDC45-NtCBL10 knockout vector constructed in Example 1 was transferred into tobacco Zhongyan 100 using the Agrobacterium-mediated leaf disc method to obtain C0 generation transgenic materials. Primers pDC45-NtCBL10A-JCF / pDC45-NtCBL10A-JCR and pDC45-NtCBL10B-JCF / pDC45-NtCBL10B-JCR were used for PCR amplification and sequencing to screen out plants with different editing modes.

[0055]

[0056] 2. To further characterize the mutation event, the PCR products were deeply sequenced and the data were collected and analyzed using the Hi-TOM platform. These methods were used to screen primary transformants (T1) carrying the mutant allele and to generate T2 progeny through selfing. Homologous plants were selected from two T2 biallelic lines for high chlorine treatment experiments.

[0057] Example 3: Tobacco material planting, cultivation, high chlorine treatment and sampling

[0058] Tobacco material planting and cultivation: The plant material used in this embodiment is tobacco (N. tabacum) variety Zhongyan 100. Tobacco plants are planted in a greenhouse. The greenhouse conditions are: 16 hours of light / 8 hours of darkness, temperature 23-25°C, and relative humidity 70%. Tobacco seeds are first sown in the soil. 20 days after germination, the tobacco seedlings are transplanted to rock wool cuttings in a floating tray (1 / 2 Hogland nutrient solution) for hydroponics.

[0059] Tobacco high chlorine treatment test: After a 6-day adaptation period (about 26 days), the plants were transplanted into a circulation hydroponic system filled with 1 / 2 Hoagland nutrient solution (500L). The water used to prepare 1 / 2 Hoagland nutrient solution contains trace amounts of Na + and Cl -(5.51 μg / mL and 7.88 μg / mL, respectively). After a 6-day adaptation period (about 32 days), to avoid high chloride shock, 50 mM NaCl was added to the nutrient solution on the first day, 100 mM NaCl was added on the second day, and 200 mM NaCl was added on the second day after 100 mM NaCl treatment.

[0060] Chloride index determination sampling: The ion content was measured using three biological replicates, each consisting of three plants. The leaves of the whole plant (without veins) were collected and dried at 105°C until a stable weight was reached, and then the dried tissue was ground into powder. About 30-50 mg of the dried sample was placed in a test tube. 1 mL of 3M formic acid was added to the test tube, and then shaken at 99.9°C at 5000 rpm for 20 minutes. Subsequently, 9 mL of water and mix. Take 0.2mL of sample and use 9.8mL The samples were diluted with water, and the dilution factor was 50. The chloride ion content in the diluted samples was measured using an ion chromatography (IC) system Professional (Metrohm, Switzerland).

[0061] like Figure 5 As shown, under normal conditions, the Cl - There was no significant difference in the content of Cl in the double mutant Nt-cbl10a10b after high chloride treatment. - In order to study the phenotype of the double mutant Nt-cbl10a10b and Cl - The phenotypes and Cl content of Nt-cbll0a10b double mutant and WT tobacco plants were monitored daily after application of 100 mM NaCl. - The results showed that Cl - The contents in Nt-cbl10a10b double mutant were significantly lower than those in WT.

[0062] In summary, the present invention has discovered the tobacco CBL family gene NtCBL10, and found that knocking out the gene can reduce the chloride ion content in tobacco leaves.

[0063] Although the present invention has been disclosed as above by the embodiments, it is not intended to limit the present invention. Any person skilled in the art may make various choices and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention is limited by the claims and their equivalents.

Claims

1. Application of tobacco CBL family gene NtCBL10 in regulating chloride ion accumulation in tobacco leaves, characterized in that: The nucleotide sequence of the gene comprises any one of the following (1) to (4): (1) the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.3; or, (2) a nucleotide sequence having at least 90% sequence identity with the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.3; or, (3) a nucleotide sequence that adds, replaces, deletes or modifies one or more bases in the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.3 and expresses a protein with the same function; or, (4) A nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO.1 or SEQ ID NO.3 under stringent conditions.

2. The use of the tobacco CBL family gene NtCBL10 in regulating the accumulation of chloride ions in tobacco leaves as claimed in claim 1, characterized in that: The amino acid sequence of the protein encoded by the NtCBL10 gene comprises any one of the following (5) to (7): (5) the amino acid sequence shown in SEQ ID NO.2 or SEQ ID NO.4; or, (6) an amino acid sequence having at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO.2 or SEQ ID NO.4; or, (7) Adding, substituting, deleting or modifying one or more amino acid residues in the amino acid sequence shown in SEQ ID NO.2 or SEQ ID NO.4, and expressing the amino acid sequence of a protein with the same function.

3. A biological material comprising the NtCBL10 gene according to claim 1 or 2, characterized in that: The biological material is a recombinant expression vector, an expression cassette or a recombinant bacterium.

4. Use of the biological material according to claim 3 in transgenic plants for regulating chlorine accumulation.

5. The use according to claim 4, characterized in that: The biological material is used for knocking out the NtCBL10 gene and can reduce the chloride ion content of tobacco leaves.

6. The use according to claim 4, characterized in that: The transgenic plant is tobacco leaf.

7. A method for cultivating a transgenic plant with improved potassium accumulation capacity, characterized in that: A transgenic plant is obtained by introducing a recombinant expression vector comprising the NtCBL10 gene according to claim 1 into a recipient plant, or a CRISPR / Cas9 gene editing vector for knocking out the NtCBL10 gene is constructed through CRISPR / Cas9-mediated gene editing technology, and a transgenic plant in which the NtCBL10 gene is edited is obtained through genetic transformation.

8. The method for cultivating a transgenic plant with improved potassium accumulation capacity according to claim 7, characterized in that: The promoter contained in the recombinant expression vector is 35S promoter.

9. The method for cultivating a transgenic plant with improved potassium accumulation capacity according to claim 7 or 8, characterized in that: The recombinant expression vector includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment.

10. The method for cultivating a transgenic plant with improved potassium accumulation capacity according to claim 7 or 8, characterized in that: The recombinant expression vector comprises the 3' non-translated region of the foreign gene.

Images