Application of ABI5 gene in enhancing plant photosynthesis

Abstract

The invention discloses application of an ABI5 gene in enhancing plant photosynthesis, and relates to the technical field of plant genetic engineering. According to the AtABI5 mutant abi5-8 disclosed by the invention, the biomass is increased, the chlorophyll content is increased, the net photosynthetic rate is improved, the growth of plants under a low-nitrogen condition is promoted, and the greening rate of cotyledons is improved. Experiments prove that the arabidopsis ABI5 can regulate the expression of genes related to photosynthesis and can be used for enhancing the photosynthesis efficiency.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and in particular to an application of an ABI5 gene in enhancing plant photosynthesis. Background Art

[0002] In recent years, due to climate change, the growth of major global crop yields has stagnated. Current crop yields are not enough to feed the world's population. Photosynthesis is the material basis for crop yields, and 90-95% of the dry weight of crops comes from photosynthetic products; however, the efficiency of plants in converting light energy into biomass through photosynthesis does not exceed 1%, and there is still a lot of room for improvement compared to its theoretical efficiency value (4-6%). It is a general trend to develop new breeding and genetic engineering strategies to optimize photosynthetic capacity.

[0003] Plant hormones play a pivotal role in the development process from organ initiation to aging. Because they not only act as growth and development regulators, but also play a core role in regulating photosynthesis. Abscisic acid (ABA) is an important stress-resistant hormone that participates in various physiological processes in the plant life cycle, including photosynthesis. The bZIPs transcription factors of the AREB / ABF / ABI5 (ABAInsensitive 5) subfamily have been shown to be the main transcription factors regulating ABA-mediated gene expression, and ABI5 is a key component. At present, there are few studies on ABI5 regulating photosynthesis. The latest study found that ABI5 interacts with FLZ13 and inhibits the expression of genes involved in chlorophyll biosynthesis, photosynthesis and cell wall tissue development, thereby regulating seed germination and early seedling development. However, it is still worth exploring how ABI5 regulates plant growth and development and photosynthesis after germination. Summary of the invention

[0004] In order to overcome the shortcomings and deficiencies of the prior art, the purpose of the present invention is to provide an application of the ABI5 gene in enhancing plant photosynthesis, a method for enhancing plant photosynthesis by knocking out or knocking down ABI5, and obtaining a new plant variety with high photosynthesis efficiency.

[0005] The purpose of the present invention is achieved through the following technical solutions:

[0006] The invention provides an application of an Arabidopsis thaliana ABI5 gene in enhancing plant photosynthesis.

[0007] Furthermore, the present invention provides an application of Arabidopsis thaliana ABI5 gene in improving plant growth and development.

[0008] Furthermore, the present invention provides an application of an Arabidopsis thaliana ABI5 gene in increasing the chlorophyll content and / or net photosynthetic rate of a plant.

[0009] Furthermore, the present invention provides an application of Arabidopsis thaliana ABI5 gene in improving plant growth and development under low nitrogen conditions.

[0010] Furthermore, the present invention provides an application of Arabidopsis thaliana ABI5 gene in improving the greening rate of plant cotyledons under low nitrogen conditions.

[0011] Preferably, the low nitrogen condition is 0.05-1 mM nitrogen source; more preferably 0.05 mM nitrogen source.

[0012] Preferably, the nitrogen source is nitrate;

[0013] Preferably, the nitrate is at least one of potassium nitrate and calcium nitrate.

[0014] Furthermore, the present invention provides an application of an Arabidopsis thaliana ABI5 gene in plant breeding.

[0015] Furthermore, the present invention provides an application of Arabidopsis thaliana ABI5 gene in cultivating transgenic plants.

[0016] The plants include, but are not limited to, Arabidopsis, rice, wheat, corn, sorghum, millet, sugarcane, cotton, tomato, alfalfa and elephant grass;

[0017] The amino acid sequence encoded by the Arabidopsis thaliana ABI5 gene is shown in GenBank No. NP_565840.1.

[0018] The Arabidopsis thaliana ABI5 gene has a sequence that is one of the following nucleotide sequences:

[0019] 1) DNA sequence shown in GenBank No.: NM_129185.4;

[0020] 2) The DNA sequence shown in bp 230 to 1558 in GenBank No. NM_129185.4;

[0021] 3) DNA sequence encoding the protein shown in GenBank No.: NP_565840.1.

[0022] The above application is achieved by knocking out or knocking down the Arabidopsis ABI5 gene.

[0023] The knockout or knockdown is achieved by RNA interference technology or genome editing technology.

[0024] A plant breeding method comprises the following steps: obtaining plants by knocking out or knocking down the ABI5 gene of plants; compared with wild plants, the biomass, chlorophyll content and / or net photosynthetic rate of the plants are significantly improved; and the cotyledon greening rate of the plants under low nitrogen conditions is significantly improved.

[0025] A method for enhancing plant photosynthesis comprises the following steps: enhancing plant photosynthesis by knocking out or knocking down the ABI5 gene of the plant.

[0026] The enhancing of plant photosynthesis includes increasing the chlorophyll content and / or net photosynthetic rate of the plant.

[0027] Compared with the prior art, the present invention has the following advantages and effects:

[0028] The AtABI5 mutant abi5-8 of the present invention has increased biomass, increased chlorophyll content, and improved net photosynthetic rate, promoting plant growth under low nitrogen conditions and increasing cotyledon greening rate. Experiments have shown that Arabidopsis ABI5 regulates the expression of photosynthesis-related genes and can be used to enhance photosynthesis efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 ABI5 mutation promotes plant growth; A: Col-0 and abi5-8 phenotypes; B: biomass analysis graph; C: chlorophyll content analysis graph; D: net photosynthetic rate graph.

[0030] Figure 2 ABI5 mutation promotes plant growth under low nitrogen conditions; A: growth phenotypes of Col-0 and abi5-8 on high nitrogen and low nitrogen 1 / 2MS medium; B: analysis of cotyledon greening rate.

[0031] Figure 3 ABI5 inhibits the expression of photosynthesis-related genes; A: Y1H experiments verified that ABI5 binds to the promoters of RCA, RBCS2B and RBCS3B; B: EMSA experiments verified that ABI5 binds to the promoters of RCA, RBCS2B and RBCS3B; C: Schematic diagram of the construction of the expression vector of the promoter of ABI5, RCA, RBCS2B or RBCS3B; D: ABI5 inhibits the transcription of RCA, RBCS2B and RBCS3B.

[0032] Figure 4 are the gene expression levels of ABI5, RCA, RBCS2B, and RBCS3B. DETAILED DESCRIPTION

[0033] The present invention is further described in detail below in conjunction with the examples and drawings, but the embodiments of the present invention are not limited thereto. The experimental methods in the following examples where specific experimental conditions are not specified are usually carried out under conventional experimental conditions or according to the experimental conditions recommended by the manufacturer. The materials, reagents, etc. used are reagents and materials obtained from commercial sources unless otherwise specified.

[0034] Wild-type Arabidopsis thaliana Columbia (Col-0) and abi5-8 (T-DNA insertion mutation, SALK_013163) were purchased from the Arabidopsis Biological Resource Center (http: / / www.arabidopsis.org / ).

[0035] Example 1: Determination of biomass, chlorophyll content and net photosynthetic rate

[0036] (1) Arabidopsis thaliana culture: Wild-type Arabidopsis thaliana plants (Col-0) and Arabidopsis thaliana ABI5 mutant abi5-8 were used as the operation objects. The seeds of the above plants were vernalized in a refrigerator at 4°C for 1 day, and then sown on 1 / 2MS culture medium plates for culture after disinfection. The culture conditions were: temperature 22°C, humidity 60%, light / dark cycle of 14h / 10h, light intensity of 100μmol / m 2 / s. After 7 days of cultivation, the plants were transferred to a growing pot filled with nutrient soil and grown for another 14 days to obtain Arabidopsis plants grown for a total of 21 days; this was used to analyze the application of the ABI5 gene in growth and development, regulation of chlorophyll content and net photosynthetic rate in Arabidopsis or other economic crops.

[0037] (2) Biomass determination: The aboveground parts of the Arabidopsis plants grown for 21 days in step (1) were taken and fresh weight was determined with 4 plants as one replicate and 3 biological replicates.

[0038] The experiment found that the biomass of the Arabidopsis thaliana ABI5 mutant abi5-8 was significantly increased compared with the wild type Col-0 ( Figure 1 A and B), indicating that ABI5 mutation promotes plant growth.

[0039] (3) Determination of chlorophyll content: About 0.5 g of leaves of the 21-day-old Arabidopsis plants obtained in step (1) (two leaves per plant, about 0.5 g from 20 to 25 plants as one biological replicate) were placed in a 15 mL centrifuge tube, and eight biological replicates were set up; then, 15 mL of 95% ethanol solution was added, and the tube was treated in the dark at 4°C for 24 to 48 h. When the leaves were almost colorless, the OD value at 665 nm (OD value) was measured using a spectrophotometer. 665 ) and 649nm(OD 649) was used as the absorbance value at 95% ethanol solution as a blank control, and the content of chlorophyll a (Chl a) and chlorophyll b (Chl b) was calculated according to the formula (Brain and Solomon, 2007; Jiang et al., 2012). Chlorophyll content (Chlorophyll cotent) is equal to Chl a content plus Chl b content. Chlorophyll content was standardized with the fresh weight of Arabidopsis thaliana and then compared. The calculation formula is as follows:

[0040] Chl a (mg / L) = 13.95 × OD 665 -6.88×OD 649 ;

[0041] Chl b (mg / L) = 24.96 × OD 649 -7.32×OD 665 ;

[0042] The experiment found that the chlorophyll content of the Arabidopsis ABI5 mutant abi5-8 was significantly increased compared with the wild type Col-0 ( Figure 1 C), which may improve the efficiency of photosynthesis, so the net photosynthetic rate was tested next.

[0043] (4) Net photosynthetic rate measurement: The net photosynthetic rate of the Arabidopsis plants grown for 21 days in step (1) was measured using a portable photosynthesis measurement system (LI-6800). The light quantum flux density of the built-in light source in the leaf chamber of the instrument during the measurement was 1000 μmol / m 2 / s, CO 2 The concentration was 400 ppm, and the temperature was controlled at the plant growth temperature of 22°C. Each plant was a replicate, and one leaf with the most vigorous growth was measured for each plant, with 5 biological replicates.

[0044] The experimental results showed that the net photosynthetic rate of the Arabidopsis ABI5 mutant abi5-8 was significantly increased compared with the wild type Col-0 ( Figure 1 D).

[0045] Example 2: High and low nitrogen culture experiments

[0046] The seeds of wild-type Arabidopsis plants (Col-0) and Arabidopsis ABI5 mutant abi5-8 were vernalized in a refrigerator at 4°C for 1 day, sterilized, and then exposed to medium containing 10 mM (high nitrogen) and 0.05 mM (low nitrogen) KNO 3 The culture conditions were as follows: temperature 22°C, humidity 60%, light / dark cycle 14h / 10h, light intensity 100μmol / m 2After 6 days, the phenotypes were observed and photographed, and the cotyledon greening rate was counted (the number of counts was no less than 100 plants, with 3 biological replicates).

[0047] The results showed that the Arabidopsis ABI5 mutant abi5-8 promoted plant growth under low nitrogen conditions ( Figure 2 A), the greening rate of cotyledons of the ABI5 mutant abi5-8 was significantly higher than that of the wild type Col-0 ( Figure 2 B).

[0048] Example 3: Yeast one-hybrid assay (Y1H)

[0049] 1. Amplify the ABI5 coding region: Using the wild-type Col-0 cDNA as a template, PCR amplification was performed using primers ABI5-pJG4-5-F / R to obtain the target fragment 1. The mRNA sequence of the ABI5 gene is shown in GenBank No.: NM_129185.4, its CDS sequence is shown in GenBank No.: NM_129185.4, the 230 bp to 1558 bp, and the amino acid sequence encoded by the ABI5 gene is shown in GenBank No.: NP_565840.1.

[0050] The primer sequences are as follows (5′-3′): the underlined part is the restriction site sequence;

[0051] ABI5-pJG4-5-F:TGCCTCTCCC GAATTC ATGGTAACTAGAGAAACGAAG;

[0052] ABI5-pJG4-5-R:TCCAAAGCTT CTCGAG GAGTGGACAACTCGGGTTCCTC;

[0053] The PCR reaction system is shown in Table 1:

[0054] Table 1 PCR reaction system

[0055] Components Dosage 2×Primer Mix 25μL ABI5-pJG4-5-F (10 μM) 2.5μL ABI5-pJG4-5-R (10 μM) 2.5μL cDNA 2μL <![CDATA[ddH 2 The]]> Up to 50μL

[0056] PCR amplification program: 98°C for 10 s; 98°C for 10 s, 55°C for 5 s, 72°C for 1 min / kb (26 cycles); 72°C for 5 min; store at 4°C.

[0057] PCR product recovery: PCR products were run on 1% agarose gel, and the gel was cut and recovered. The specific method was based on the DNA recovery kit of Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0058] Note: 2× Primer Mix was purchased from Nanjing Novozymes Biotech Co., Ltd.

[0059] 2. Double restriction enzyme linearization pJG4-5 vector

[0060] The enzyme digestion reaction system is shown in Table 2:

[0061] Table 2 Enzyme digestion reaction system

[0062] Components Dosage 10×Buffer 3μL Enzyme1(EcoR I) 1μL Enzyme2(Xho I) 1μL pJG4-5 vector 1 μg <![CDATA[ddH 2 The]]> Up to 30μL

[0063] Enzyme digestion conditions: 37°C, 4h.

[0064] Recycling of enzyme digestion products: After the digestion is completed, add 3 μL 10× Loading Buffer to the digestion product and mix well. Perform electrophoresis on 1% agarose gel and cut the gel for recovery. The recovery steps are carried out according to the instructions of the DNA purification and recovery kit of Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0065] Note: Restriction endonucleases were purchased from Takara.

[0066] 3. Amplification of RCA, RBCS2B and RBCS3B promoter sequences: Using wild-type Col-0 gDNA as a template, primers F and R were used to amplify RCA, RBCS2B and RBCS3B promoters, which correspond to target fragment 2, target fragment 3 and target fragment 4, respectively. Target fragment 2 contains the sequence shown at 15879 bp to 17804 bp in GenBank No. AC003000.3, target fragment 3 contains the sequence shown at 55111 bp to 57203 bp in GenBank No. AB005248.1, and target fragment 4 contains the sequence shown at 51439 bp to 53438 bp in GenBank No. AB005248.1.

[0067] The primer sequences are as follows (5′-3′): the underlined part is the restriction site sequence;

[0068] pRCA-pLacZi-F:TATTGGATCG GAATTC GCAATGGTAACCTCAACTC;

[0069] pRCA-pLacZi-R:GAGCACATGC CTCGAG ATCTCAAGACTGCGACGAG;

[0070] pRBCS2B-pLacZi-F:TATTGGATCG GAATTC CATTTCGCACTTGAAAGCAT;

[0071] pRBCS2B-pLacZi-R:GAGCACATGC CTCGAG TACTTCTTCTTGTTGTTTCTC;

[0072] pRBCS3B-pLacZi-F:TATTGGATCG GAATTC TTTGGCTTCAATTAAAATCC;

[0073] pRBCS3B-pLacZi-R:GAGCACATGC CTCGAG TACTACTTCTTGTTGTTTCTC;

[0074] The PCR reaction system is shown in Table 3:

[0075] Table 3 PCR reaction system

[0076] Components Dosage 2×Primer Mix 25μL Primer F (10 μM) 2.5μL Primer R (10 μM) 2.5μL gDNA 2μL <![CDATA[ddH 2 The]]> Up to 50μL

[0077] PCR amplification program: 98°C for 10 s; 98°C for 10 s, 55°C for 5 s, 72°C for 1 min / kb (26 cycles); 72°C for 5 min; store at 4°C.

[0078] PCR product recovery: PCR products were run on 1% agarose gel and recovered by gel excision.

[0079] 4. Double restriction enzyme linearization pLacZi vector

[0080] The enzyme digestion reaction system is shown in Table 4:

[0081] Table 4 Enzyme digestion reaction system

[0082] Components Dosage 10×Buffer 3μL Enzyme1(EcoR I) 1μL Enzyme2(Xho I) 1μL pLacZi Vector 1 μg <![CDATA[ddH 2 The]]> Up to 30μL

[0083] Enzyme digestion conditions: 37°C, 4h.

[0084] Recycling of enzyme digestion products: After the digestion is completed, add 3 μL 10× Loading Buffer to the digestion product and mix well. Perform electrophoresis on 1% agarose gel and cut the gel for recovery. The recovery steps are carried out according to the instructions of the DNA purification and recovery kit of Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0085] 5. Homologous recombination vector construction

[0086] Homologous recombination was performed between target fragment 1 and linearized pJG4-5 vector, and between target fragments 2 / 3 / 4 and linearized pLacZi vector; the homologous recombination reaction system is shown in Table 5.

[0087] Table 5 Homologous recombination reaction system

[0088]

[0089]

[0090] Note: The optimal vector usage X = [0.02 × number of cloning vector base pairs] ng;

[0091] The optimal amount of fragment used Y = [0.04 × number of base pairs of inserted fragment] ng.

[0092] Recombination reaction conditions: 37°C, 30 min, place on ice for 5 min. Store at -20°C.

[0093] Note: The recombinase Exnase∥ kit was purchased from Nanjing Novozymes Biotech Co., Ltd.; pJG4-5 and pLacZi vectors were purchased from Beijing Coolbo Technology Co., Ltd.

[0094] 6. Transformation: Add the ligation product to Escherichia coli DH5α competent cells (purchased from Sangon Biotech (Shanghai) Co., Ltd.), mix gently and place on ice for 30 min, heat shock at 42°C for 60 s, place on ice again for 5 min, add 1 mL of liquid antibiotic-free LB, culture at 37°C, 200 rpm for 1 h, take 200 μL and apply it to ampicillin (Amp) resistance (50 μg / mL) LB plate, and culture at 37°C overnight.

[0095] 7. Colony PCR detection: Select single colonies for colony PCR detection to exclude false positive recombinants. Send the correct single colonies to Bio-Tech for sequencing. Correct sequencing indicates that the recombinant vector was successfully constructed.

[0096] 8. Plasmid extraction: The successfully constructed plasmids were extracted using the plasmid extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. They were respectively named pJG4-5-ABI5 plasmid, pLacZi-pRCA plasmid, pLacZi-pRBCS2B plasmid, and pLacZi-pRBCS3B plasmid.

[0097] 9. Transformation of Saccharomyces cerevisiae strain EGY48: Transform EGY48 competent cells with 1 μL pJG4-5-ABI5 / pJG4-5 plasmid and 1 μL pLacZi-pRCA / pLacZi-pRBCS2B / pLacZi-pRBCS3B / pLacZi plasmid (concentration of about 500 ng / μL) together with 5 μL carrier DNA (salmon sperm DNA); spread on SD / -Trp / -Ura solid medium and culture upside down at 30°C for 3 days; take several single colonies and expand them on SD / -Trp / -Ura solid medium; culture on SD / -Trp / -Ura+X-gal solid medium containing 20 mg / mL X-gal for 1 to 3 days, and observe and record the color development. Among them, the experimental group was: pJG4-5-ABI5 plasmid and pLacZi-pRCA / pLacZi-pRBCS2B / pLacZi-pRBCS3B plasmid; the control group was: pJG4-5-ABI5 plasmid and pZacZi plasmid, pJG4-5 plasmid and pLacZi-pRCA / pLacZi-pRBCS2B / pLacZi-pRBCS3B / pLacZi plasmid.

[0098] To study how ABI5 regulates plant photosynthesis and growth, the ABI5 target gene was screened by yeast one-hybrid assay. The experiment found that yeast co-transformed with pJG4-5-ABI5 and pLacZi-pRCA, pLacZi-pRBCS2B or pLacZi-pRBCS3B showed blue color ( Figure 3 A), indicating that ABI5 can bind to the promoter regions of the key carbon assimilation genes RCA, RBCS2B, and RBCS3B.

[0099] Example 4: EMSA experiment

[0100] 1. Construction of ABI5-His vector

[0101] (1) Amplification of the ABI5 coding region: Using the wild-type Col-0 cDNA as a template, PCR amplification was performed using primers ABI5-His-F / R to obtain the target fragment 5.

[0102] The primer sequences are as follows (5′-3′): the underlined part is the restriction site sequence;

[0103] ABI5-His-F:CCG GAATTC ATGGTAACTAGAGAAACGAAGTTGACGT;

[0104] ABI5-His-R:CCC AAGCTT GAGTGGACAACTCGGGTTCCT;

[0105] The PCR reaction system is shown in Table 6:

[0106] Table 6 PCR reaction system

[0107] Components Dosage 2×Primer Mix 25μL ABI5-His-F (10 μM) 2.5μL ABI5-His-R (10 μM) 2.5μL cDNA 2μL <![CDATA[ddH 2 The]]> Up to 50μL

[0108] PCR amplification program: 98°C for 10 s; 98°C for 10 s, 55°C for 5 s, 72°C for 1 min / kb (26 cycles); 72°C for 5 min; store at 4°C.

[0109] PCR product recovery: PCR products were run on 1% agarose gel and recovered by gel excision.

[0110] (2) Double restriction enzyme linearization pET-28a(+) vector

[0111] The enzyme digestion reaction system is shown in Table 7:

[0112] Table 7 Enzyme digestion reaction system

[0113] Components Dosage 10×Buffer 3μL Enzyme1(EcoR I) 1μL Enzyme2(Hind III) 1μL pET-28a(+) vector 1 μg <![CDATA[ddH 2 The]]> Up to 30μL

[0114] Enzyme digestion conditions: 37°C, 4h.

[0115] Recycling of enzyme digestion products: After the digestion is completed, add 3 μL 10× Loading Buffer to the digestion product and mix well. Perform electrophoresis on 1% agarose gel and cut the gel for recovery. The recovery steps are carried out according to the instructions of the DNA purification and recovery kit of Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0116] (3) Homologous recombination was performed between the target fragment 5 and the linearized pET-28a(+) vector. The homologous recombination reaction system is shown in Table 5. Recombination reaction conditions: 37°C, 30 min, placed on ice for 5 min. Stored at -20°C.

[0117] (4) Transformation of DH5α strain: Add the ligation product to Escherichia coli DH5α competent cells (purchased from Sangon Biotech (Shanghai) Co., Ltd.), mix gently, place on ice for 30 min, heat shock at 42°C for 60 s, place on ice again for 5 min, add 1 mL of liquid antibiotic-free LB, culture at 37°C, 200 rpm for 1 h, take 200 μL and spread on kanamycin (Kan) resistance (50 μg / mL) LB plate, and culture at 37°C overnight.

[0118] (5) Colony PCR detection: Select a single colony for colony PCR detection to exclude false positive recombinants. Send the single colony with the correct detection to Bio-Tech for sequencing. Correct sequencing indicates that the recombinant vector was successfully constructed. It is recorded as pET28a-ABI5-His plasmid.

[0119] (6) Transformation of Rosetta (DE3) strain: Add the above successfully constructed plasmid into Rosetta (DE3) competent cells (purchased from Sangon Biotech (Shanghai) Co., Ltd.), mix gently, place on ice for 30 min, heat shock at 42°C for 60 s, place on ice again for 5 min, add 1 mL of antibiotic-free LB, culture at 37°C, 200 rpm for 1 h, take 200 μL and spread on kanamycin (Kan) resistance (50 μg / mL) LB plate, and culture at 37°C overnight.

[0120] (7) Colony PCR detection: Single colonies were selected for colony PCR detection to exclude false positive recombinants. Recombinant strain Rosetta (DE3) / pET28a-ABI5-His was obtained.

[0121] 2. Purification of ABI5-His protein

[0122] After a small amount of recombinant bacteria Rosetta (DE3) / pET28a-ABI5-His was activated, it was inoculated into 100 mL LB liquid medium at a volume ratio of 1:1000 and cultured in a shaking incubator at 37°C until the concentration was close to OD 600 It is preferably 0.4-0.6, then transferred to 4℃ for 30min, IPTG was added to make its working concentration 1mM and transferred to 16℃ shaker at 120rpm for culture for about 20 hours, and protein purification was performed after enriching the bacteria.

[0123] The bacteria were suspended in Lysis Buffer and ultrasonically disrupted until transparent and clear; centrifuged at 6000rpm and 4℃ for 30min, and filtered into a Ni column through a filter with a pore size of 0.45μm; after all the crude protein solution passed through the column, the column was balanced with Wash Buffer; the bound protein was eluted with Elution Buffer; the eluted protein was further purified by an ultrafiltration tube with a pore size of 30kDa until it was concentrated to a protein concentration of not less than 1μg / μL.

[0124] The protein purification method refers to the instructions for His-tagged protein agarose high-speed purification resin of Yisheng Biotechnology (Shanghai) Co., Ltd.

[0125] 3. Gel preparation and electrophoresis

[0126] (1) Prepare the native glue according to Table 8. Mix well after adding TEMED and add it to the mold immediately. Avoid bubbles and add a comb.

[0127] Table 8 Native gel system (50mL)

[0128] Reagents Dosage 5×TBE 5mL 30% AB 10mL 50% Glycerol 50μL 10% AP 200μL TEMED 50μL SDW Refill to 50mL

[0129] (2) Perform electrophoresis at 100 V for 30 to 40 min in pre-cooled 0.5× TBE buffer. Stop the pre-electrophoresis when bromophenol blue migrates to 2 / 3 or 3 / 4 of the bottom of the gel.

[0130] (3) Mix the sample and electrophoresis buffer and perform electrophoresis.

[0131] (4) Place the electrophoresis tank on ice or at 4°C and perform electrophoresis at a constant voltage of 100 V until the buffer indicator band is 2 to 3 cm from the bottom of the gel.

[0132] 4. Biotin-labeled probe

[0133] The probe primers were synthesized at Sangon Biotechnology Co., Ltd. and their sequences are as follows (5′-3′):

[0134] pRCAProbe-F: TCATAAACATATTCCACGTGGACCAATCAAAATAG;

[0135] pRCAProbe-R: CTATTTTGATTGGTCCACGTGGAATATGTTTATGA;

[0136] pRBCS2B Probe-F: ATGGAGTTTTCTGCCACGTGATCTTATCCTAGTGG;

[0137] pRBCS2B Probe-R: CCACTAGGATAAGATCACGTGGCAGAAAACTCCAT;

[0138] pRBCS3B Probe-F:ATGGAGTTTTTCTGCCACGTGGCCTTATCCTAGTGG;

[0139] pRBCS3B Probe-R: CCACTAGGATAAGGCCACGTGGCAGAAAACTCCAT.

[0140] Dilute the probe primer at one end of the sense chain or antisense chain to a concentration of 1 μM, set up the reaction system according to Table 9, and mix gently with a pipette; react at 37°C for 1 hour; add 1.25 μL of probe labeling stop solution and mix gently to terminate the reaction.

[0141] Table 9 Probe labeling reaction system

[0142] Ultrapure water 14.5μL TdT Buffer (5×) 5μL Probe to be labeled (1 μM) 2.5μL Biotin-11-dUTP (5 μM) 2.5μL TdT (10 U / μL) 0.5μL Total volume 25μL

[0143] Removal of TdT: After the probe labeling reaction is terminated, add 26.25 μL of chloroform:isoamyl alcohol (24:1), vortex to fully mix the organic phase and the aqueous phase to extract TdT, centrifuge at 12000-14000g for 1-2 min, the supernatant will be labeled with biotin single-stranded DNA probe, aspirate the supernatant for later use.

[0144] Preparation of biotin-labeled EMSA probe: Mix the labeled single-stranded DNA probe and its sense strand or antisense strand in equal volumes; add annealing buffer and mix well; set the PCR program according to Table 10 to perform annealing reaction; after the annealing reaction is completed, dilute the probe 6 times with sterile ultrapure water.

[0145] Table 10 Probe labeling reaction program

[0146] temperature time 95℃ 2min Drop 0.1℃ every 8s to 25℃ About 90 minutes 4℃ ∞

[0147] 5. Forming a protein-probe complex: According to the EMSA reaction system in Table 11, add the corresponding components respectively and mix them evenly. After reacting at room temperature for 20 minutes, add 1 μL DNA loading buffer.

[0148] Table 11 EMSA reaction system

[0149] Reagents Dosage SDW 4μL 10×binding buffer 1μL 50% Glycerol 0.5μL <![CDATA[100mM MgCl 2 ]]> 0.5μL 1μg / μL Poly(dI·dC) 0.5μL 1% NP-40 0.5μL Protein 2μL Biotin-Probe 1μL Overall system 10μL

[0150] 6. Transfer

[0151] (1) Soak the gel, membrane, filter paper and fiber pad in pre-cooled 0.5× TBE.

[0152] (2) Assemble the "sandwich" in the following order: fiber mat, filter paper, gel, membrane, filter paper, fiber mat. Pay attention to the electrodes, making sure the gel is at the cathode and the membrane is at the anode.

[0153] (3) Transfer the membrane in pre-cooled 0.5× TBE. The transfer device should be placed on ice or in a low-temperature chamber and transfer the membrane at a constant voltage of 100V for 35 minutes.

[0154] 7. Detection

[0155] (1) After the transfer is completed, carefully remove the nylon membrane, place it on a dry filter paper with the sample facing upward, and gently remove the obvious liquid on the lower surface. Use a UV crosslinker to crosslink twice continuously.

[0156] (2) After adding the blocking solution, shake gently and block at room temperature for 20 minutes.

[0157] (3) Add an appropriate amount of HRP-labeled streptavidin (Streptavidin-HRP conjugate) and incubate at room temperature with shaking for 45 minutes.

[0158] (4) Remove the enzyme conjugate diluent and wash the membrane three times with wash buffer, gently shaking for 10 min at room temperature each time.

[0159] (5) Prepare the reaction substrate, add it evenly to the membrane, and incubate at room temperature for 5 min.

[0160] (6) Exposure imaging using a chemiluminescence imaging system.

[0161] Note: EMSA / Gel-Shift kit was purchased from Shanghai Biotech Biotechnology Co., Ltd.

[0162] The results of EMSA experiments showed that the electrophoresis speed of the complex bound to ABI5-His protein was slower than that of the probe without protein binding ( Figure 3 B) further illustrates that ABI5 binds to the ACGTG motif-containing region of the RCA, RBCS2B, and RBCS3B promoters.

[0163] Example 5: Dual luciferase assay

[0164] 1. Amplify the ABI5 coding region: Using the pJG4-5-ABI5 plasmid as a template, use primers ABI5-62SK-F / R for PCR amplification to obtain the target fragment 6.

[0165] The primer sequences are as follows (5′-3′): the underlined part is the restriction site sequence;

[0166] ABI5-62SK-F: GGCCGCTCTAGAACTAGT GGATCC ATGGTAACTAGAGAAACGAAG;

[0167] ABI5-62SK-R:

[0168] ATCGATAAGCTTGATATC GAATTC GAGTGGACAACTCGGGTTCCTC;

[0169] The PCR reaction system is shown in Table 12:

[0170] Table 12 PCR reaction system

[0171] Components Dosage 2×Primer Mix 25μL ABI5-62SK-F (10 μM) 2.5μL ABI5-62SK-R (10μM) 2.5μL pJG4-5-ABI5 2μL <![CDATA[ddH 2 The]]> Up to 50μL

[0172] PCR amplification program: 98°C for 10 s; 98°C for 10 s, 55°C for 5 s, 72°C for 1 min / kb (26 cycles); 72°C for 5 min; store at 4°C.

[0173] PCR product recovery: PCR products were run on 1% agarose gel, and the gel was cut and recovered. The specific method was based on the DNA recovery kit of Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0174] 2. Double restriction enzyme linearization pGreenII 62-SK vector

[0175] The enzyme digestion reaction system is shown in Table 13:

[0176] Table 13 Enzyme digestion reaction system

[0177] Components Dosage 10×Buffer 3μL Enzyme1(BamHI) 1μL Enzyme2(EcoR I) 1μL pGreenII 62-SK vector 1 μg <![CDATA[ddH 2 The]]> Up to 30μL

[0178] Enzyme digestion conditions: 37°C, 4h.

[0179] Recycling of enzyme digestion products: After the digestion is completed, add 3 μL 10× Loading Buffer to the digestion product and mix well. Perform electrophoresis on 1% agarose gel and cut the gel for recovery. The recovery steps are carried out according to the instructions of the DNA purification and recovery kit of Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0180] 3. Amplify the RCA, RBCS2B and RBCS3B promoter sequences: Using pLacZi-pRCA, pLacZi-pRBCS2B or pLacZi-pRBCS3B plasmid as template, use primer F and primer R to amplify the RCA, RBCS2B and RBCS3B promoters, which correspond to target fragment 7, target fragment 8 and target fragment 9, respectively.

[0181] The primer sequences are as follows (5′-3′): the underlined part is the restriction site sequence;

[0182] pRCA-pGreenII 0800-F:CGGTATCGAT AAGCTT GCAATGGTAACCTCAACTC;

[0183] pRCA-pGreenII 0800-R:TAGAACTAGT GGATCC ATCTCAAGACTGCGACGAG;

[0184] pRBCS2B-pGreenII 0800-F:CGGTATCGAT AAGCTT CATTTCGCACTTGAAAGCAT;

[0185] pRBCS2B-pGreenII 0800-R:TAGAACTAGT GGATCC TACTTCTTCTTGTTGTTTCTC;

[0186] pRBCS3B-pGreenII 0800-F:CGGTATCGAT AAGCTT TTTGGCTTCAATTAAAATCC;

[0187] pRBCS3B-pGreenII 0800-R:TAGAACTAGT GGATCC TACTACTTCTTGTTGTTTCTC;

[0188] The PCR reaction system is shown in Table 14:

[0189] Table 14 PCR reaction system

[0190] Components Dosage 2×Primer Mix 25μL Primer F (10 μM) 2.5μL Primer R (10 μM) 2.5μL pLacZi-pRCA / pRBCS2B / pRBCS3B 2μL <![CDATA[ddH 2 The]]> Up to 50μL

[0191] PCR amplification program: 98°C for 10 s; 98°C for 10 s, 55°C for 5 s, 72°C for 1 min / kb (26 cycles); 72°C for 5 min; store at 4°C.

[0192] PCR product recovery: PCR products were run on 1% agarose gel and recovered by gel excision.

[0193] 4. Double restriction enzyme linearization pGreenII 0800-LUC vector

[0194] The enzyme digestion reaction system is shown in Table 15:

[0195] Table 15 Enzyme Digestion Reaction System

[0196] Components Dosage 10×Buffer 3μL Enzyme1(Hind III) 1μL Enzyme2(BamHI) 1μL pGreenII 0800-LUC vector 1 μg <![CDATA[ddH 2 The]]> Up to 30μL

[0197] Enzyme digestion conditions: 37°C, 4h.

[0198] Recycling of enzyme digestion products: After the digestion is completed, add 3 μL 10× Loading Buffer to the digestion product and mix well. Perform electrophoresis on 1% agarose gel and cut the gel for recovery. The recovery steps are carried out according to the instructions of the DNA purification and recovery kit of Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0199] 5. Construction of corresponding vector by homologous recombination

[0200] Homologous recombination was performed between target fragment 6 and linearized pGreenII 62-SK vector, and between target fragments 7 / 8 / 9 and linearized pGreenII0800-LUC vector. The homologous recombination reaction system is shown in Table 5. The schematic diagram of the construction of the recombinant vector is shown in Figure 3 As shown in C.

[0201] Recombination reaction conditions: 37°C, 30 min, place on ice for 5 min. Store at -20°C.

[0202] 6. Transformation: Add the ligation product to E. coli DH5α competent cells, mix gently and place on ice for 30 min, heat shock at 42°C for 60 s, place on ice again for 5 min, add 1 mL of liquid antibiotic-free LB, culture at 37°C, 200 rpm for 1 h, take 200 μL and apply it on kanamycin (Kan) resistance (50 μg / mL) LB plate, and culture at 37°C overnight.

[0203] 7. Colony PCR detection: Select single colonies for colony PCR detection to exclude false positive recombinants. Send the correct single colonies to Bio-Tech for sequencing. Correct sequencing indicates that the recombinant vector was successfully constructed.

[0204] 8. Plasmid extraction: The successfully constructed plasmids were extracted using the plasmid extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. They were respectively recorded as pGreenII 62-SK-ABI5 plasmid, pGreenII 0800-pRCA plasmid, pGreenII 0800-pRBCS2B plasmid, and pGreenII 0800-pRBCS3B plasmid.

[0205] 9. Agrobacterium transformation: Add 1 μg of recombinant plasmid to Agrobacterium EHA105 (pSoup) competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.), mix gently, place on ice for 30 min, quick freeze in liquid nitrogen for 5 min, place in a 37°C water bath for 2 min, add 500 μL of liquid antibiotic-free LB, and culture at 28°C with a shaker at 100 rpm for 3 h; spread on LB plates containing rifampicin (50 μg / mL), gentamicin (50 μg / mL) and kanamycin resistance (50 μg / mL), and culture at 28°C for 2 days.

[0206] 10. Injection tobacco: Streak on LB plates containing rifampicin (50 μg / mL), gentamicin (50 μg / mL) and kanamycin resistance (50 ug / mL) and culture for 2 days; pick a single colony and shake overnight; centrifuge to enrich the bacteria, wash the bacteria three times with sterile water; use infection buffer (10 mM MgCl 2 , 10 mM MES, 150 μM acetosyringone) to OD 600 The concentration of p247B was 0.8-1.0, and cultured in the dark at 28°C for 3 hours; the experimental group was pGreenII 62-SK-ABI5 and pGreenII 0800-pRCA, pGreenII0800-pRBCS2B or pGreenII 0800-pRBCS3B, and the control group (Control) was pGreenII 62-SK and pGreenII0800-pRCA, pGreenII 0800-pRBCS2B or pGreenII 0800-pRBCS3B. The bacterial solution was mixed at a ratio of 1:1 and injected into tobacco leaves; cultured for 36-48 hours.

[0207] 11. LUC / REN value detection: Use a hole puncher to punch the injected tobacco into leaf discs and transfer them to a grinding tube, add 100 μL of cell lysis solution, and grind into a homogenate at 4°C; centrifuge at 12000 rpm at 4°C for 10 min; aspirate 20 μL of supernatant to a white 96-well ELISA plate; add 100 μL of firefly luciferase reaction solution, and detect the LUC fluorescence value at about 560 nm; then add 100 μL of Renilla luciferase reaction solution, and detect the REN fluorescence value at about 480 nm; analyze the LUC / REN value.

[0208] Note: The dual luciferase kit was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.

[0209] The LUC / REN values ​​of the experimental groups of RCA, RBCS2B and RBCS3B promoters were significantly lower than those of the control group ( Figure 3 D), indicating that ABI5 inhibits the transcriptional expression of RCA, RBCS2B and RBCS3B.

[0210] Example 6: RT-qPCR

[0211] Take the leaves of the Arabidopsis thaliana plant grown for 21 days in step (1) of Example 1 (plant culture conditions: temperature 22°C, humidity 60%, light / dark cycle 14h / 10h, light intensity 100μmol / m 2 / s), RNA was extracted and reverse transcribed into cDNA using RNA extraction and reverse transcription kit purchased from Nanjing Novozyme Biotechnology Co., Ltd. cDNA was used for RT-qPCR, and Actin2 was used as an internal reference gene.

[0212] qActin2-F: 5′-GCACCACCTGAAAGGAAGTACA-3′;

[0213] qActin2-R: 5′-CGATTCCTGGACCTGCCTCATC-3′;

[0214] qABI5-F: 5′-AAAACATGCATTGGCGGAGT-3′;

[0215] qABI5-R: 5′-AATGTCCGCAATCTCCCGTT-3′;

[0216] qRCA-F: 5′-GAGGGCGAGAGTGTACGATG-3′;

[0217] qRCA-R: 5′-GCTGGGCTCCTTTTCCGTAG-3′;

[0218] qRBCS2B-F: 5′-GCATCAGTTTCATTGCCTACAAG-3′;

[0219] qRBCS2B-R: 5′-ACCACATAGAAATGGGTTCCAG-3′;

[0220] qRBCS3B-F: 5′-AGGATGGTCCACTTGAAAGGA-3′;

[0221] qRBCS3B-R: 5′-TGGACTCTTATCCGCAAGCC-3′.

[0222] The PCR amplification conditions were: 95°C, 30 sec; 95°C, 5 sec, 60°C, 30 sec, 40 cycles; and melting curve analysis at 60-95°C.

[0223] The expression level of ABI5 gene in the Arabidopsis thaliana ABI5 mutant abi5-8 was significantly lower than that in the wild type Col-0, and the expression levels of RCA, RBCS2B and RBCS3B in the ABI5 mutant abi5-8 were significantly higher than those in the wild type Col-0 ( Figure 4 ), which indicates that ABI5 inhibits the expression of photosynthesis-related genes, thereby inhibiting plant photosynthesis and growth; therefore, after reducing the expression level of the ABI5 gene, the expression levels of RCA, RBCS2B and RBCS3B were significantly increased, thereby promoting plant photosynthesis and growth.

[0224] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. Application of Arabidopsis thaliana ABI5 gene, characterized in that: One of the following applications: (1) Application in enhancing plant photosynthesis; (2) Application in improving plant growth and development; (3) Application in increasing the chlorophyll content and / or net photosynthetic rate of plants; (4) Application in improving plant growth and development under low nitrogen conditions; (5) Application in improving the greening rate of plant cotyledons under low nitrogen conditions.

2. The use according to claim 1, characterized in that: The low nitrogen condition is 0.05-1 mM nitrogen source; further 0.05 mM nitrogen source.

3. The use according to claim 2, characterized in that: The nitrogen source is nitrate; further, the nitrate is at least one of potassium nitrate and calcium nitrate.

4. Application of Arabidopsis thaliana ABI5 gene, characterized in that: One of the following applications: (a) Application in plant breeding; (b) Application in breeding transgenic plants.

5. The use according to any one of claims 1 to 4, characterized in that: The plants include Arabidopsis, rice, wheat, corn, sorghum, millet, sugarcane, cotton, tomato, alfalfa and elephant grass.

6. The use according to any one of claims 1 to 4, characterized in that: The amino acid sequence encoded by the Arabidopsis thaliana ABI5 gene is shown in GenBank No. NP_565840.

1.

7. The use according to any one of claims 1 to 4, characterized in that: The Arabidopsis thaliana ABI5 gene has a sequence that is one of the following nucleotide sequences: 1) DNA sequence shown in GenBank No.: NM_129185.4; 2) The DNA sequence shown in bp 230 to 1558 in GenBank No. NM_129185.4; 3) DNA sequence encoding the protein shown in GenBank No.: NP_565840.

1.

8. The use according to any one of claims 1 to 4, characterized in that: The application is achieved by knocking out or knocking down the Arabidopsis thaliana ABI5 gene.

9. A method for plant breeding, characterized in that: The method comprises the following steps: obtaining plants by knocking out or knocking down the ABI5 gene of the plants.

10. A method for enhancing plant photosynthesis, characterized in that: The method comprises the following steps: enhancing the photosynthesis of the plant by knocking out or knocking down the ABI5 gene of the plant.

Images