Preparation method of recombinant epidermal growth factor (EGF)

Abstract

The invention discloses a preparation method of a recombinant epidermal growth factor (EGF). The preparation method comprises the following steps: artificially synthesizing a gene as shown in SEQ ID NO.1 in a sequence table; constructing an expression vector; inducing expression of the fusion protein; protein purification; and purifying the inclusion body protein. The preparation method is simple, the protein and the inclusion body protein are purified, the obtained product is high in activity, high in purity, large in yield and small in loss, and the cost is reduced.

Description

Technical field:

[0001] The invention belongs to the field of biotechnology, and in particular relates to a method for preparing recombinant epidermal growth factor (EGF). Background technology:

[0002] Epidermal growth factor (EGF) is the earliest growth factor discovered, and plays an important role in regulating cell growth, proliferation and differentiation. In 1974, human epidermal growth factor (hEGF) was purified from human urine. Its gene is located at 4q25, composed of 53 amino acids, with a molecular weight of about 6KDa, containing 3 disulfide bonds, forming 3 intramolecular ring structures, which are the key to its biological activity. As a mitogen, EGF first binds to specific cell surface receptors with high affinity, and then induces its dimerization, which is crucial for activating the tyrosine kinase in the cytoplasmic domain of the receptor, thereby initiating signal transduction leading to DNA synthesis and cell proliferation. EGF binds to cell membrane receptors and forms a complex metabolic network during intracellular transmission, inducing receptor autophosphorylation, activating receptor tyrosine protein kinase activity, catalyzing the phosphorylation of tyrosine residues of various substrate proteins, and initiating, catalyzing and maintaining a series of biochemical processes related to cell growth and proliferation.

[0003] Studies have found that EGF can promote the growth and proliferation of epithelial cells and promote the repair of wounds such as cornea and skin. It is of great significance in clinical applications such as cell proliferation, tissue regeneration, body surface trauma, ulcers and burns. In addition, epidermal growth factor EGF often binds to its receptor to induce proliferative changes. Other studies have shown that adding other ingredients such as CHIR99021 and Valproic acid to the ENR (EGF, Noggin and R-Spondins) culture medium can induce specific differentiation of stem cells. EGF is one of the culture factors for small intestinal organoids, gastric organoids, liver organoids, pancreatic organoids, breast organoids, brain and other organoids.

[0004] EGF is widely used in the medical and biological markets. How to obtain EGF with high purity, high activity and high yield is an important research direction in the field of biotechnology. Summary of the invention:

[0005] The purpose of the present invention is to provide a method for preparing recombinant epidermal growth factor (EGF), which is simple, low-cost, and has high product purity, high activity and high yield.

[0006] The purpose of the present invention is implemented by the following technical solutions:

[0007] A method for preparing recombinant epidermal growth factor (EGF), comprising the following steps:

[0008] S10, the gene shown in the artificially synthesized sequence table SEQ ID NO.1;

[0009] Specifically, the restriction site and the full gene sequence of HS-EGF were designed and the following sequence was artificially synthesized in vitro: NdeI endonuclease recognition sequence (CATATG) + RGD sequence + 6*His + SUMO (S) + EGF polypeptide gene + termination codon TAA + EcoRI endonuclease recognition sequence (GAATTC). The optimized and synthesized gene sequence was atgggcagcagccgtggcgatcatcatcaccatcaccatcatatgtcagattcagaagtgaatcaagaagcaaaacctgaagtgaaacctgaagtgaaacctgaaacacatattaatctgaaagtgtcagatggctcatcagaaattttctttaaaattaagaaaacaacacctctgcgtcgtctgatg gaagcttttgctaaacgtcagggcaaagaaatggattcactgcgctttctgtatgatggcattcgtattcaagcagatcagacacctgaagatctggatatggaagataatgatattattgaagctcatcgtgaacagattggcggatccaatagtga ctctgaatgtcccctgtcccacgatgggtactgcctccatgatggtgtgtgcatgtatattgaagcattggacaagtatgcatgcaactgtgttgttggctacatcggggagcgatgtcagtaccgagacctgaagtggtgggaactgcgctaa(SEQ ID NO:1), the synthetic sequence was directly cloned into the T vector provided by Dalian Takara Company, and transformed into Escherichia coli JM109 bacteria, the positive clones were identified by PCR, and the positive clones were expanded and cultured, and the sequences of the primers used were: upstream primer 5'AAGACAGGGTAAGGAAATG3' (SEQ ID No.2), downstream primer 5'AAGACAGGGTAAGGAAATG3' (SEQ ID No.3); the RGD sequence was added to the artificial in vitro synthesized EGF sequence, because RGD is a peptide segment that mediates the adhesion of cells to the extracellular matrix, it can improve the biocompatibility of the material; and a SUMO (S) gene sequence of the small ubiquitin-related modifier protein of Saccharomyces cerevisiae artificially synthesized by the codon preference of Escherichia coli was used to increase the expression amount of the target protein;

[0010] S20, expression vector construction;

[0011] S30, induced expression of fusion protein;

[0012] S40, protein purification; comprising: S41, filtering the crude extract of the fusion protein collected in S30 and setting it aside for use; S42, purifying the filtered crude extract of the fusion protein through a Ni-NTA affinity chromatography column, adding W1, W2, W3 and E1-E9 in sequence to elute the crude extract bound to the Ni-NTA resin, and collecting the target protein;

[0013] S50, inclusion body protein purification; comprising: S51, resuspending the bacteria retained after centrifugation of S34 with 1×PBS buffer lysis solution containing 8M urea, and placing it in ice for ultrasonic lysis for 20 minutes; S52, centrifuging after lysis, retaining the supernatant after centrifugation, discarding the bacteria, and the supernatant is the inclusion body protein mixture to be purified; S53, adding Ni resin to the inclusion body protein mixture, placing it in a shaker for incubation for 30 minutes, then collecting the resin, purifying and eluting with W1 and E in turn, and collecting the target inclusion body protein.

[0014] Furthermore, the S20 comprises: inserting into the expression vector pET28a, and transfecting into Escherichia coli DH5α competent cells for expression.

[0015] Furthermore, the S30 specifically includes: S31, culturing the Escherichia coli strain containing the correctly sequenced recombinant plasmid obtained in the S20 to obtain a seed liquid; S32, adding the seed liquid of the S31 to IPTG for culturing, centrifuging the obtained induced bacterial liquid, discarding the supernatant, and collecting the bacteria; S33, resuspending the bacteria obtained in the S32 with 1×PBS buffer lysis solution, placing it in ice for ultrasonic disruption for 30 minutes; S34, centrifuging after disruption, retaining the supernatant and bacteria respectively after centrifugation, and the supernatant is the crude extract of the fusion protein.

[0016] Further, in S31, the Escherichia coli strain is cultured using a special medium for Escherichia coli fermentation; the special medium for Enterobacter fermentation includes the following components: 0.02-0.08 g / L magnesium sulfate, 5.5-7.2 g / L potassium dihydrogen phosphate, 2.2-3.4 g / L ammonium chloride, 2-4 g / L ammonium sulfate, 1.2-1.8 g / L glycerol, 4-6 g / L soy peptone, 1.5-3 g / L yeast extract, 0.008-0.012 g / L calcium chloride, 1.5-3.5 g / L ginkgo polysaccharide, 0.01-0.03 g / L ferric chloride, and 0.8-1.6 g / L sodium glutamate. A special medium for Escherichia coli fermentation is used, in which the content of soy peptone and yeast powder is low, which can reduce the cost while achieving high-density culture and reducing the impact of non-specific proteins on subsequent purification.

[0017] Advantages of the present invention:

[0018] The invention provides a method for preparing recombinant epidermal growth factor (EGF). The preparation method is simple, an EGF sequence is artificially synthesized in vitro, and the protein and inclusion body protein are purified to obtain a product with high purity and activity, large yield, low loss, and reduced cost. Description of the drawings:

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0020] Figure 1 is the gene map of the recombinant plasmid pET28a-HS-EGF;

[0021] Figure 2 This is a Coomassie Brilliant Blue staining image after protein purification; where: M. marker; 1. IN (fusion protein crude extract after filtration) stock solution; 2. IN (diluent); 3. FT (throughput solution); 4. W1 after washing; 5. W2 after washing; 6. W3 after washing; 7. E1-E9 after elution;

[0022] Figure 3 is the concentration of purified protein;

[0023] Figure 4 This is the Coomassie Brilliant Blue staining image after the inclusion body protein was purified; where: M. marker; 1. IN (inclusion body protein mixture) stock solution; 2. FT (through solution); 3. W1 after washing; 4. E after elution. Specific implementation method:

[0024] The technical scheme in the embodiment of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiment of the present invention. Obviously, the described embodiment is only a part of the embodiment of the present invention, rather than all the embodiments. All the technical means such as culture medium and molecular biology involved in the embodiment are well known to those skilled in the art. The reagents used in the embodiment are all commercially available analytical pure reagents. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work, all belong to the scope of protection of the present invention.

[0025] Example 1

[0026] A method for preparing recombinant epidermal growth factor (EGF) comprises steps S10 to S50.

[0027] S10, artificially synthesize the gene shown in the sequence table SEQ ID NO.1; specifically: design the restriction site and the full gene sequence of HS-EGF and artificially synthesize the following sequence in vitro: NdeI endonuclease recognition sequence (CATATG) + RGD sequence + 6*His + SUMO (S) + EGF polypeptide gene + termination codon TAA + EcoRI endonuclease recognition sequence (GAATTC), the gene sequence after optimization and synthesis is shown in SEQ ID NO:1, the synthetic sequence is directly cloned into the T vector provided by Dalian Takara Company, and transformed into Escherichia coli JM109 bacteria, the positive clone strain is determined by PCR identification, and the positive clone strain is expanded and cultured, and the sequences of the primers used are shown in Table 1.

[0028] Table 1 Primer sequences involved in the present invention

[0029] name Sequence 5'→3' Upstream primer AAGACAGGGTAAGGAAATG SEQ ID No.2 Downstream primer AAGACAGGGTAAGGAAATG SEQ ID No.3

[0030] S20, construction of expression vector; comprising: S21, using conventional molecular cloning technology to extract plasmid DNA of S10 positive clone strain, using NdeI and EcoRI double enzyme digestion of this plasmid and PET28a plasmid; S22, recovering the target fragment and the sticky end fragment of PET28a plasmid vector, inserting the target fragment into the PET28a plasmid vector digested with the same enzyme in the presence of T4 ligase (Promega) with the correct reading frame, constructing a double-stranded expression gene of fusion protein, obtaining a recombinant plasmid, sequencing the recombinant plasmid, and the sequencing results show that the artificially synthesized sequence remains unchanged in the process of vector construction; S23, transforming the recombinant plasmid into Escherichia coli DH5α competent cells, culturing and sequencing to obtain an Escherichia coli strain containing the correct recombinant plasmid;

[0031] Among them, S23 includes: S231, taking 1-2 μL of the recombinant plasmid and adding it to 30 μL of the Escherichia coli DH5α competent cells prepared in advance, placing it on ice for 30 minutes, heat-shocking it in a 42°C water bath for 90 seconds, and then quickly placing it on ice to recover for 3-5 minutes, and then adding an appropriate amount of 200 μL of antibiotic-free LB liquid culture medium, incubating it at 37°C and 150 rpm / min for 40 minutes to obtain a competent bacterial solution; S232, applying the competent bacterial solution to an LB solid culture dish containing kanamycin (50 μg / mL), placing it in a 37°C constant temperature incubator and culturing it overnight (14-16 hours); S233, picking a monoclonal colony from the plate and inoculating it in an LB liquid culture medium containing kanamycin (50 μg / mL), and culturing it at 37°C and 200 rpm / min for 3-4 hours; S234, after culturing, taking the bacterial solution and centrifuging it for sequencing analysis, the Escherichia coli strain containing the recombinant plasmid with correct sequencing is the required recombinant bacteria DH5α, Figure 1 The construction of the recombinant plasmid pET28a-HS-EGF is shown.

[0032] S30, fusion protein induction expression; including: S31, culturing the recombinant bacteria DH5α with a special culture medium for Escherichia coli fermentation (including the following components: 0.08 g / L magnesium sulfate, 4 g / L potassium dihydrogen phosphate, 3 g / L ammonium chloride, 4 g / L ammonium sulfate, 1.5 g / L glycerol, 5.5 g / L soy peptone, 3 g / L yeast extract, 0.01 g / L calcium chloride, 3.5 g / L ginkgo polysaccharide, 0.01 g / L ferric chloride, 1.5 g / L sodium glutamate) to obtain seed solution; S32, adding IPTG with a final concentration of 0.5 mM to the seed solution of S31, culturing at 37°C, 200 rpm / min shaking table for 4 hours to obtain an induced bacterial solution, centrifuging the induced bacterial solution at 4°C, 5000 rpm / min for 10 minutes, discarding the supernatant, and collecting the bacteria; S33, weighing the wet weight of the bacteria and adding 1×PBS at a ratio of 1:10 Resuspend the bacteria in buffer lysis solution (PBS pH 7.5 + 10% Glyerol + 1% PMSF), place in ice and ultrasonically disrupt (2s of disruption, 4s of rest, 500W for 30min); S34, centrifuge at 12000rpm / min for 1h after disruption, retain the supernatant and bacteria respectively after centrifugation, and the supernatant is the crude extract of the fusion protein.

[0033] S40, protein purification; including: S41, filtering the crude fusion protein extract collected in S34 through a 0.22 μm pore filter and setting aside for use; S42, before loading, using 10 times column volume of buffer at a flow rate of 5 mL / min to balance the nickel column, and loading the filtered crude fusion protein extract onto the balanced Ni column at a flow rate of 1 mL / min through a constant flow pump, collecting the penetration liquid, and repeatedly loading the sample to improve the column hanging efficiency of the sample; selecting a suitable chromatography column, inserting a gasket and closing the outlet at the lower end of the chromatography column, and adding about 2 mL of W1, mix the Ni-NTA resin evenly, slowly add it to the chromatography column with a pipette, add an appropriate amount of Ni-NTA resin (about 1mL) as needed, and after the resin no longer settles, insert the gasket again and open the outlet at the lower end of the chromatography column, add 10 times the volume of the resin W1 to balance the column, and prepare for loading; when W1 is about to flow out, add 5mL of crude extract to the chromatography column, the flow rate is 15mL / h, collect the penetration part, and detect the binding of the sample to the Ni-NTA resin by electrophoresis; use 5 times the volume of Ni-NTA resin W2, W3 and E1-E9 to elute the crude extract bound to the Ni-NTA resin in turn, the flow rate is 30mL / h, and the elution components of each eluent are collected respectively. The purification steps and the solutions used are shown in Table 2:

[0034] Table 2 Fusion protein crude extract purification steps and solutions used

[0035] Serial number Column solution Buffer 1 Washing liquid 1 (W1) PBS pH 7.5 2 Washing liquid 2 (W2) PBS pH 7.5, 10 mM Imidazole 3 Washing liquid 3 (W3) PBS pH 7.5, 30 mM Imidazole 4 Eluent (E1-E9) PBS pH 7.5, 300 mM Imidazole

[0036] Samples (IN, FT, W1, W2, W3, E1-E9) were taken for SDS-PAGE detection, and the results were as follows Figure 2 As shown; according to the purification results, the target protein was collected and dialyzed with 6 mol / L urea solution to detect the protein concentration. The results are as follows Figure 3 shown.

[0037] S50, inclusion body protein purification; including: S51, resuspend the bacteria retained after centrifugation in S34 with 1×PBS (pH7.5) containing 8M urea, and lyse with an ultrasonic disruptor for 20 minutes; S52, centrifuge at 12000rpm for 10 minutes after lysis, retain the supernatant after centrifugation, discard the bacteria, and the supernatant is the inclusion body protein mixture to be purified; S53, add a certain amount of Ni resin to the inclusion body protein mixture, place it in a shaker for incubation for 30 minutes, collect the resin, temporarily retain the penetration solution (FT), and then purify it with W1 and E in turn. The purification steps and solutions used are shown in Table 3:

[0038] Table 3 Inclusion body protein mixture purification steps and solutions used

[0039] Serial number Column solution Buffer 1 Washing liquid 1 (W1) PBS pH 7.5, 8 M urea 2 Washing liquid 2 (E) PBS pH 7.5, 300mM Imidazole, 8M urea

[0040] Samples (IN, FT, W1, E) were taken for SDS-PAGE detection, and the results were as follows Figure 4 shown.

[0041] The present invention adopts a special culture medium for Escherichia coli fermentation to culture the recombinant bacteria DH5α, which can realize high-density fermentation of Escherichia coli, and can produce about 30g wet bacteria per liter of bacterial liquid; if LB culture medium is used for culture according to conventional technology, only about 10g wet bacteria can be produced per liter of bacterial liquid; in addition, RGD sequence and SUMO (S) gene sequence are added to the artificial in vitro synthetic EGF sequence, which is conducive to increasing the expression amount; at the same time, the product obtained by the present invention includes both purified protein and purified inclusion body protein, and the yield of the product is large, and by optimizing the purification process, the material loss is reduced, and the yield of the EGF product is further improved. In addition, in the production process, the introduction of affinity purification tags is conducive to shortening the purification time, reducing the purification cost, and improving the purity of the target product, so that the EGF produced in the embodiment has a higher purity (> 90%).

[0042] The above are only preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for preparing recombinant epidermal growth factor (EGF), characterized in that: It includes the following steps: S10, the gene shown in the artificially synthesized sequence table SEQ ID NO.1; S20, expression vector construction; S30, fusion protein induction expression; S40, protein purification; comprising: S41, filtering the crude extract of the fusion protein collected in S30 and setting it aside for use; S42, purifying the filtered crude extract of the fusion protein through a Ni-NTA affinity chromatography column, adding W1, W2, W3 and E1-E9 in sequence to elute the crude extract bound to the Ni-NTA resin, and collecting the target protein; S50, inclusion body protein purification; comprising: S51, resuspending the bacteria retained after centrifugation of S34 with 1×PBS buffer lysis solution containing 8M urea, and placing it in ice for ultrasonic lysis for 20 minutes; S52, centrifuging after lysis, retaining the supernatant after centrifugation, discarding the bacteria, and the supernatant is the inclusion body protein mixture to be purified; S53, adding Ni resin to the inclusion body protein mixture, placing it in a shaker for incubation for 30 minutes, then collecting the resin, purifying and eluting with W1 and E in turn, and collecting the target inclusion body protein.

2. The method for preparing a recombinant epidermal growth factor (EGF) according to claim 1, characterized in that: The S20 comprises: inserting into the expression vector pET28a, and transfecting into Escherichia coli DH5α competent cells for expression.

3. The method for preparing a recombinant epidermal growth factor (EGF) according to claim 1, characterized in that: The S30 specifically includes: S31, culturing the Escherichia coli strain containing the correctly sequenced recombinant plasmid obtained in S20 to obtain a seed solution; S32, adding IPTG to the seed solution of S31 for culturing, centrifuging the obtained induced bacterial solution, discarding the supernatant, and collecting the bacterial cells; S33, resuspending the bacterial cells obtained in S32 with 1×PBS buffer lysis solution, placing them in ice for ultrasonic disruption for 30 minutes; S34, centrifuging after disruption, and retaining the supernatant and bacterial cells respectively after centrifugation, wherein the supernatant is the crude extract of the fusion protein.

4. The method for preparing a recombinant epidermal growth factor (EGF) according to claim 3, characterized in that: In the S31, the Escherichia coli strain is cultured using a special culture medium for Escherichia coli fermentation; the special culture medium for Escherichia coli fermentation includes the following components: 0.02-0.08 g / L magnesium sulfate, 5.5-7.2 g / L potassium dihydrogen phosphate, 2.2-3.4 g / L ammonium chloride, 2-4 g / L ammonium sulfate, 1.2-1.8 g / L glycerol, 4-6 g / L soy peptone, 1.5-3 g / L yeast extract, 0.008-0.012 g / L calcium chloride, 1.5-3.5 g / L ginkgo polysaccharide, 0.01-0.03 g / L ferric chloride, and 0.8-1.6 g / L sodium glutamate.

Images