Anti-cancer composition containing tumor-specific oncolytic adenovirus and immune checkpoint inhibitor

Abstract

The present invention relates to an anti-cancer composition comprising a tumor-specific oncolytic adenovirus and an immune checkpoint inhibitor. According to the present invention, the recombinant adenovirus in which IL-12 and shVEGF are inserted or IL-12 and GM-CSF-relaxin are inserted exhibits an excellent anti-cancer effect by enhancing an immune function, which has been proven to be significantly enhanced by administration in conjunction with an immune checkpoint inhibitor, and thus the present invention can be used as a key technology in the field of cancer treatment.

Description

Technical Field

[0001] The present invention relates to an anticancer composition comprising a tumor-specific oncolytic adenovirus and an immune checkpoint inhibitor. Background Art

[0002] Although the development speed of cancer therapeutic agents is very fast, cancer remains one of the diseases with high mortality rates worldwide. The main cancer treatment methods used in clinical routine are surgery, radiotherapy, and anticancer agent treatment methods, or, as a treatment in parallel with it, the method of removing cancer cells from patients to the greatest extent. However, these treatments only show therapeutic effects when cancer cells are completely removed under the state that relatively early stage cancer has not metastasized, and they also kill other normal cells that are rapidly dividing, so there is a shortcoming that may cause various side effects. Accordingly, recently someone has utilized the tumor-specific immune activity of the body as an immunotherapy method to study the treatment of cancer.

[0003] However, it is difficult to perform immunotherapy because cancer not only has the ability to cleverly evade and destroy various host immune responses, resulting in the continuous maintenance of tumor survival by inducing an immunosuppressive tumor microenvironment, but also is able to evade activated anti-tumor immune responses even when the immune system is activated. Therefore, in order to enhance the immune response against cancer cells by improving the immunosuppressive tumor microenvironment, research has been conducted in various directions using the following substances: cytokine genes such as IL-12, IL-18, interferon-γ (IFN-γ), granulocyte-macrophage colony-stimulating factor (GM-CSF) and tumor necrosis factor-α (TNF-α), costimulatory factors such as B7 molecules, dendritic cells (DCs) directly acting as antigen presenting cells (APCs), T cells activated by tumor antigens, natural killer cells (NKCs), etc. Specifically, IL-12 is usually secreted by APCs such as monocytes, macrophages, and DCs. It is known that it directly acts on cytotoxic T lymphocytes (CTLs) and NK cells that can effectively remove cancer cells to activate those cells, induce the secretion of IFN-γ, and enhance the ability to kill cancer cells. In addition, IL-12 plays an important role in promoting differentiation into T helper 1 (TH1) cells by acting on naive CD4+ lymphocytes, and thus activates anti-cancer immune responses by inducing and enhancing cell-mediated immune responses, which is a key factor in anti-cancer immune responses. VEGF is a signaling protein produced by cells that promote angiogenesis and angiogenesis. It affects T cell precursors in the bone marrow, thereby not only inhibiting the proliferation and maturation of T cells and dendritic cells, but also playing an important role in angiogenesis, thereby showing a side effect known as cancer metastasis. Therefore, VEGF is not only a promoter of tumor growth, but also acts as an inhibitor in anti-cancer immunity. It is expected that downregulating VEGF by VEGF shRNA can restore immune responses and increase anti-cancer effects. GM-CSF enhances the immune response of CD4+ and CD8+ T cells by stimulating DCs to promote their differentiation into APCs. It also participates in the expression regulation of molecules constituting class II major histocompatibility complex (MHC) in primary monocytes. It is reported that due to the expression of GM-CSF in tumors, many APCs are induced to gather around the tumor to effectively process tumor antigens, thereby inducing a strong anti-cancer immune response.

[0004] Based on this, our laboratory also reported the antitumor effect of IL-12, using YKL-1 (Ad-E1B-55) as a tumor-selective oncolytic adenovirus with E1B-55kDa gene deletion, and the antitumor effect of GM-CSF, using RdB adenovirus, which has a stronger tumor-selective killing ability than YKL-1, which is attributed to the deletion of E1B gene and the modification of Rb binding site of E1A. Although the immunosuppressive tumor microenvironment is improved, there are still many limitations in the complete treatment of cancer due to the low immunogenicity of tumors when using immunotherapy methods. Summary of the invention

[0005] Technical issues

[0006] In the course of in-depth research on developing immunotherapy aimed at overcoming tumor immune surveillance escape, the present inventors not only confirmed the excellent in vivo anticancer effect of IL-12 plus short hairpin RNA (shVEGF) targeting vascular endothelial growth factor (VEGF), or IL-12 plus GM-CSF-relaxin by preparing recombinant adenoviruses that can simultaneously express them, but also confirmed that the anticancer effect of the recombinant adenovirus was improved by co-administration with immune checkpoint inhibitors, thereby completing the present invention.

[0007] Therefore, one object of the present invention is to provide a recombinant adenovirus capable of simultaneously expressing IL-12 and shVEGF, or IL-12 and GM-CSF-Relaxin.

[0008] Another object of the present invention is to provide use of the recombinant adenovirus in preventing or treating cancer.

[0009] Another object of the present invention is to provide the pharmaceutical use of the recombinant adenovirus as a combination preparation with an immune checkpoint inhibitor in the prevention or treatment of cancer.

[0010] However, the technical problems to be achieved by the present invention are not limited to the above problems, and those skilled in the art can clearly understand other problems not mentioned from the following description.

[0011] Technical Solution

[0012] In order to achieve the above-mentioned purpose of the present invention, the present invention provides a recombinant adenovirus, which includes: a gene encoding interleukin 12 (IL-12); a gene encoding granulocyte-macrophage colony stimulating factor (GM-CSF); and a gene encoding relaxin, or the recombinant adenovirus includes: a gene encoding interleukin 12 (IL-12); and a gene encoding shRNA capable of inhibiting VEGF expression.

[0013] As one embodiment of the present invention, the recombinant adenovirus may be deleted from one or more regions selected from the E1 and E3 regions.

[0014] As another embodiment of the present invention, the gene encoding IL-12 may include an IL-12A (p35) gene sequence, an IRES sequence, and an IL-12B (p40) gene sequence, and may be inserted into the E1 or E3 region of a recombinant adenovirus.

[0015] As another embodiment of the present invention, the gene encoding GM-CSF and relaxin may include a GM-CSF gene sequence, an IRES sequence, and a relaxin gene sequence, and may be inserted into the E1 or E3 region of the recombinant adenovirus.

[0016] As another embodiment of the present invention, the gene encoding shRNA that inhibits VEGF expression can complementarily bind to VEGF mRNA and can be inserted into the E1 or E3 region of the recombinant adenovirus.

[0017] In addition, the present invention provides a pharmaceutical composition for preventing or treating cancer, which comprises: the recombinant adenovirus; and a pharmaceutically acceptable carrier.

[0018] As one embodiment of the present invention, the composition can be co-administered with any one of the following immune checkpoint inhibitors: PD-1 antagonists, PD-L1 antagonists, PD-L2 antagonists, CD27 antagonists, a CD28 antagonists, CD70 antagonists, CD80 antagonists, CD86 antagonists, CD137 antagonists, CD276 antagonists, KIRs antagonists, LAG3 antagonists, TNFRSF4 antagonists, GITR antagonists, GITRL antagonists, 4-1BBL antagonists, CTLA-4 antagonists, A2AR antagonists, VTCN1 antagonists, BTLA antagonists, IDO antagonists, TIM-3 antagonists, VISTA antagonists, KLRA antagonists, and combinations thereof.

[0019] As another embodiment of the present invention, the composition can enhance anti-tumor immunity.

[0020] As another embodiment of the present invention, the cancer can be selected from gastric cancer, lung cancer, non-small cell lung cancer, breast cancer, ovarian cancer, liver cancer, bronchial cancer, nasopharyngeal cancer, laryngeal cancer, pancreatic cancer, bladder cancer, colon cancer, cervical cancer, bone cancer, non-small cell bone cancer, hematological malignancies, skin cancer, head and neck cancer, uterine cancer, colorectal cancer, anal cancer, colon cancer, fallopian tube cancer, endometrial cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, esophageal cancer, small intestine cancer, endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, lymphocytic Lymphoma, cancer of the kidney or ureter, renal cell carcinoma, renal pelvic cancer, salivary gland cancer, sarcoma cancer, pseudomyxoma peritonei, hepatoblastoma, testicular cancer, glioblastoma, cheilocarcinoma, ovarian germ cell tumor, basal cell carcinoma, multiple myeloma, gallbladder cancer, choroidal melanoma, ampulla of Vater cancer, peritoneal cancer, tongue cancer, small cell carcinoma, pediatric lymphoma, neuroblastoma, duodenal cancer, ureteral cancer, astrocytoma, meningioma, renal pelvic cancer, pudendum cancer, thymic cancer, central nervous system tumors, primary central nervous system lymphoma, spinal cord tumors, brain stem glioma, and pituitary adenoma. The cancer can also be a recurrent cancer.

[0021] Beneficial Effects

[0022] The recombinant adenovirus of the present invention into which IL-12 and shVEGF, or IL-12 and GM-CSF-Relaxin are inserted, exhibits excellent anti-cancer effects by improving immune function, and it has been confirmed that this anti-cancer effect is significantly enhanced by co-administration with immune checkpoint inhibitors. Therefore, the present invention can be used as a key technology in the field of cancer treatment.

[0023] Description of the drawings

[0024] Figure 1 The characteristics of an oncolytic adenovirus capable of simultaneously expressing IL-12 and VEGF shRNA are illustrated, and the genetic structure of RdB / IL12 / shVEGF Ad is also illustrated. RdB includes a modified E1A (mutation of the star-Rb protein binding site), and both E1B-19kDa and E1B-55kDa (E1B), as well as the E3 region (E3) are deleted; mouse IL-12 and mouse shVEGF are inserted into the E1 or E3 region of the adenoviral genome, respectively.

[0025] Figure 2The characteristics of an oncolytic adenovirus capable of simultaneously expressing IL-12 and GM-CSF and relaxin (GMCSF-Relaxin) are illustrated, and the genetic structure of the RdB / IL12 / GMCSF-RLX Ad is also illustrated. IL-12 and GMCSF-Relaxin are inserted into the E1 or E3 region of the adenoviral genome, respectively. GMCSF and relaxin can also be expressed through an internal ribosome entry site (IRES)-linked expression system, in the present invention, IRES is a regulatory sequence found in several viral and cellular RNAs.

[0026] Figure 3 confirms that administration of RdB / IL12 / shVEGF Ad, as well as co-administration of RdB / IL12 / shVEGFAd and immune checkpoint inhibitor (anti-PD-L1 antibody) have anti-cancer effects in melanoma mice. Figure 3a Shows changes in tumor volume. Figure 3b The survival rate of melanoma mice is shown. For C57BL / 6 mice with tumors, adenovirus Ad 5x10 was administered on days 1, 3, and 5. 9 Virus particles (VP) Figure 3a ; Initial tumor volume: 80-100 mm 3 ), and 200 μg of anti-PD-L1 antibody was intraperitoneally administered. Tumor volume was monitored and recorded every day until the end of the experiment. The red arrow indicates the time of adenovirus injection, and the black arrow indicates the time of antibody injection.

[0027] Figure 4 confirms that administration of RdB / IL12 / GMCSF-RLX Ad and co-administration of RdB / IL12 / GMCSF-RLX Ad and immune checkpoint inhibitor (anti-PD-L1 antibody) have anti-cancer effects in melanoma mice. Figure 4a Shows changes in tumor volume. Figure 4b Shows changes in survival rate of melanoma mice.

[0028] Figure 5 It was confirmed that in melanoma mice, administration of RdB / IL12 / shVEGF Ad and co-administration of RdB / IL12 / shVEGFAd and immune checkpoint inhibitor (anti-PD-L1 antibody) had anti-cancer effects. It was also confirmed that when RdB / IL12 / shVEGFAd was administered at 1x 10 9 Changes in tumor volume when a relatively low dose of VP was administered.

[0029] Figure 6It was confirmed that in melanoma mice, administration of RdB / IL12 / GMCSF-RLX Ad and co-administration of RdB / IL12 / GMCSF-RLX Ad and immune checkpoint inhibitor (anti-PD-L1 antibody) had anti-cancer effects. It was also confirmed that when RdB / IL12 / GMCSF-RLX Ad was administered at 1x 10 9 Changes in tumor volume when a relatively low dose of VP was administered.

[0030] Figure 7 The anticancer effects of co-administration of HmT-Rd19-K35 / IL21 Ad, RdB / GMCSF / shVEGF Ad, and YKL-1 / GMCSF / B7.1 Ad with immune checkpoint inhibitors (anti-PD-L1 antibodies) into melanoma mice were confirmed.

[0031] FIG8 confirms that administration of RdB / IL12 / GMCSF-RLX Ad and co-administration of RdB / IL12 / GMCSF-RLX Ad and immune checkpoint inhibitor (anti-PD-L1 antibody) have anti-cancer effects in melanoma mice. Figure 8a Shows changes in tumor volume. Figure 8b Shows changes in survival rate of melanoma mice.

[0032] FIG9 confirms that administration of RdB / IL12 / GMCSF-RLX Ad and co-administration of RdB / IL12 / GMCSF-RLX Ad and immune checkpoint inhibitors (anti-CTLA-4 antibodies) have anticancer effects in melanoma mice. Figure 9a Shows changes in tumor volume. Figure 9b Shows changes in survival rate of melanoma mice.

[0033] FIG10 confirms that administration of RdB / IL12 / shVEGF and co-administration of RdB / IL12 / shVEGF Ad and immune checkpoint inhibitors (anti-PD-L1 antibodies) in melanoma mice have anti-tumor immune memory effects. Fig.10a The volume changes of secondary tumors after administration of RdB / IL12 / shVEGF Ad are shown. Fig.10b Shown are the changes in the volume of secondary tumors when RdB / IL12 / shVEGF Ad and immune checkpoint inhibitor (anti-PD-L1 antibody) were co-administered.

[0034] Fig.11 The results of enzyme-linked immunosorbent assay (ELISA) showed the changes in IL-12 and GMCSF expression expressed as multiplicity of infection (MOI) after the Syrian hamster pancreatic cancer cell line (Hap-T1) was infected with RdB / IL12 / GMCSF-RLX Ad.

[0035] Fig.12 Reverse transcription polymerase chain reaction (RT-PCR) results showing changes in relaxin expression at different MOIs after Syrian hamster pancreatic cancer cell line (Hap-T1) was infected with RdB / IL12 / GMCSF-RLX Ad.

[0036] Fig.13 It was confirmed that in the Syrian hamster tumor animal model, co-administration of RdB / IL12 / GMCSF-RLX Ad and immune checkpoint inhibitors (anti-PD-1 antibodies) resulted in changes in tumor volume.

[0037] Fig.14 The immunohistochemistry results showed that in the Syrian hamster tumor animal model, co-administration of RdB / IL12 / GMCSF-RLX Ad and immune checkpoint inhibitors (anti-PD-1 antibodies) resulted in changes in tumor tissue.

[0038] Fig.15 The results showed that co-administration of RdB / IL12 / GMCSF-RLX Ad and immune checkpoint inhibitor (anti-PD-1 antibody) significantly reduced the expression of interferon (IFN)-γ in CD4 T cells in the draining lymph nodes (DLN). + or CD8 + The number of T cells changes.

[0039] Fig.16 The results showed that co-administration of RdB / IL12 / GMCSF-RLX Ad and immune checkpoint inhibitor (anti-PD-1 antibody) could upregulate the expression of interferon (IFN)-γ in tumor-infiltrating lymphocytes. + or CD8 + The number of T cells changes.

[0040] Fig.17 It was shown that co-administration of RdB / IL12 / GMCSF-RLX Ad and immune checkpoint inhibitor (anti-PD-1 antibody) resulted in changes in IFN-γ expression in tumor tissues.

[0041] Fig.18 It was shown that in the case of resistance to immune checkpoint inhibitors (anti-PD-1 antibodies), co-administration of RdB / IL12 / GMCSF-RLX Ad and the immune checkpoint inhibitors also resulted in changes in tumor volume.

[0042] Fig.19 Shown is the change in tumor volume on day 23 after co-administration of RdB / IL12 / GMCSF-RLX Ad and the immune checkpoint inhibitor in the setting of resistance to the immune checkpoint inhibitor (anti-PD-1 antibody).

[0043] Fig. 20 To confirm the changes in the infiltration of immune checkpoint inhibitors (anti-PD-1 antibody) in tumor tissues after administration of RdB / IL12 / GMCSF-RLX Ad, the accumulation of Alexa 488-αPD-1 in tumor tissues was quantified by immunofluorescence analysis.

[0044] Fig.21 To confirm the changes in the infiltration of immune checkpoint inhibitors (anti-PD-1 antibodies) in tumor tissues after administration of RdB / IL12 / GMCSF-RLX Ad, we also confirmed by immunofluorescence whether Alexa 488-αPD-1 was localized to the expression sites of CD4+ or CD8+ T cells.

[0045] Fig. 22 To confirm the changes in immune checkpoint inhibitor (anti-PD-1 antibody) infiltration after systemic administration of RdB / IL12 / GMCSF-RLX Ad, the results of the analysis of the changes over time in immunopositron emission tomography (PET) images are also shown.

[0046] Fig.23 The changes in infiltration of immune checkpoint inhibitors (anti-PD-1 antibodies) after systemic administration of RdB / IL12 / GMCSF-RLX Ad were confirmed, and the changes in infiltration of immune checkpoint inhibitors (anti-PD-1 antibodies) in various tissues including tumor tissues were also shown. 64 Evaluation and comparison of CU-αPD-1 distribution or absorption results, expressed as %ID / g. Specific implementation plan

[0047] Hereinafter, the present invention will be described in detail.

[0048] The present invention provides a recombinant adenovirus, comprising: a gene encoding interleukin 12 (IL-12); a gene encoding granulocyte-macrophage colony stimulating factor (GM-CSF); and a gene encoding relaxin, or the recombinant adenovirus comprises: a gene encoding IL-12; and a gene encoding shRNA capable of inhibiting VEGF expression.

[0049] Although immunogene therapy for cancer has developed into a more promising approach, tumors have also created many strategies to avoid the immune surveillance system. To overcome these obstacles and enhance anticancer immunity, oncolytic adenovirus (RdB / IL12 / shVEGF Ad, RdB / IL12 / GMCSF-RLX Ad) systems were constructed that can simultaneously express IL-12 and vascular endothelial growth factor (VEGF) short hairpin RNA (shRNA), or IL-12 and GM-CSF-relaxin, as adjuvant therapy suitable for restoring immunosuppression and increasing anticancer immunity. IL-12 increases antitumor immunity by inducing T helper 1 cell differentiation and activating the cytotoxicity of cytotoxic T lymphocytes and natural killer cells. It is known that shVEGF and GM-CSF play a role in enhancing the immune response of CD4+ and CD8+ T cells, respectively, by promoting the proliferation and maturation of T cells and dendritic cells, and by stimulating DCs to promote DC differentiation into APCs, and these effects are expected to further amplify the function of IL-12. Therefore, the present inventors first attempted to use the technical features of adenoviruses that simultaneously express IL-2 and shVEGF, or IL-12 and GM-CSF-Relaxin in tumors for immunogene therapy. In one embodiment of the present invention, as a result of administering recombinant adenoviruses (RdB / IL12 / shVEGF Ad, RdB / IL12 / GMCSF-RLX Ad) to a melanoma animal model, the experiment confirmed that the tumor growth inhibition rate, complete remission rate, and mouse survival rate were all increased.

[0050] In addition, IL-12 has attracted much attention as a core cytokine for anti-cancer immunotherapy, especially for anti-cancer immunotherapy methods for patients with impaired immunity in vivo, and repeated administration of IL-12 is often considered to obtain effective therapeutic effects. However, it is clinically known that IL-12 has cytokine-related toxicity throughout the body, especially in the kidneys, and therefore has technical limitations, that is, IL-12 must be used as a cancer therapeutic agent within a limited dose range. Based on this technical background, the recombinant adenovirus of the present invention that simultaneously expresses the IL-12 gene and another gene has another technical feature, which induces a high oncolytic effect even at low viral titers, thereby solving the problem of normal cell toxicity caused by high doses and repeated administration of IL-12 (it has been pointed out that this is a limitation of anti-cancer immunotherapy in the related field).

[0051] Therefore, the recombinant adenovirus of the present invention is characterized by comprising a gene encoding IL-12, and further comprising any one of the following genes: a gene encoding GM-CSF, a gene encoding relaxin, and a gene encoding shRNA that inhibits VEGF expression.

[0052] The "gene encoding IL-12" used in the present invention includes the IL-12A (p35) gene sequence and the IL-12B (p40) gene sequence, and may include an IRES sequence located between the IL-12A (p35) gene sequence and the IL-12B (p40) gene sequence for efficient translation of viral proteins. Preferably, the IL-12A (p35) gene sequence, the IL-12B (p40) gene sequence and the IRES sequence may be composed of SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 3, respectively, but are not limited thereto.

[0053] The "gene encoding GM-CSF" and "gene encoding relaxin" used in the present invention include the GM-CSF gene sequence and the relaxin gene sequence, respectively, and may further include an IRES sequence between the GM-CSF gene sequence and the relaxin gene sequence. Preferably, the GM-CSF gene sequence, the relaxin gene sequence and the IRES sequence may consist of SEQ ID No. 4, SEQ ID No. 5 and SEQ ID No. 3, respectively, but are not limited thereto.

[0054] The "gene encoding shRNA that inhibits VEGF expression" used in the present invention has a hairpin structure and refers to a gene that can mediate RNA interference or gene silencing. The gene includes a sequence complementary to VEGF mRNA, and the term "complementary" means not only 100% complementarity, but also incomplete complementarity sufficient to inhibit VEGF gene expression through RNA interference mechanism, and preferably 90% complementarity, more preferably 98% complementarity, and most preferably 100% complementarity. In this specification, 100% complementarity specifically refers to complete complementarity. In the present invention, although the gene is also described as shVEGF, it is not limited to this, and the gene can complementarily bind to VEGF mRNA (represented by SEQ ID No. 6 or 7) to inhibit the expression of VEGF.

[0055] It is explained that gene sequences also include gene sequences that show substantial identity or substantial similarity. The above-mentioned substantial identity refers to a random sequence that is different from the sequence of the present invention, but has at least 80% homology, more preferably 90% homology, and most preferably 95% homology when aligned with the sequence of the present invention to correspond as much as possible and the aligned sequence is analyzed using an algorithm commonly used in the art. The above-mentioned substantial similarity generally refers to all changes in the gene sequence, such as the deletion or insertion of one or more bases, which do not affect the purpose of the present invention of minimizing homologous recombination of the recombinant adenovirus vector. Therefore, the gene sequence of the present invention is not limited to the sequences exemplified by SEQ ID NOS.1-6, and is interpreted as being included in the scope of the rights of the present invention as long as the sequence does not substantially affect the activity of the final product required by the present invention.

[0056] At the same time, as the recombinant adenovirus of the present invention, oncolytic adenoviruses known in the art can be used. In one example of the present invention, the recombinant adenovirus comprises an activated E1A gene and an inactivated E1B-19 gene, an inactivated E1B-55 gene, or an inactivated E1B-19 / E1B-55 gene. In this specification, the term inactivation is used together with a gene to mean that the transcription and / or translation of the gene is usually not performed, and the function of the normal protein encoded by the gene is not displayed. For example, the inactivated E1B-19 gene is a gene that cannot produce an activated E1B-19kDa protein by genetic modification (replacement, addition, partial or complete deletion). The deletion of EIB-19 can increase the ability to kill cells, and the deletion of the E1B-55 gene makes the recombinant adenovirus tumor-specific (see Korean Patent Application No. 2002-23760). The term "deletion" used in conjunction with the viral genome sequence in this specification has the meaning of including complete deletion and partial deletion of the corresponding sequence.

[0057] According to one embodiment of the present invention, the recombinant adenovirus includes an E1A region, has an E1B region, namely, E1B-19kDa and E1B-55kDa (E1B) deletion, and an E3 region (E3) deletion. The recombinant adenovirus containing the E1A gene has replicable characteristics. The gene encoding IL-12 is inserted into the E1B deletion region of the recombinant adenovirus, and the gene encoding GM-CSF and relaxin or the gene encoding shRNA that inhibits VEGF expression is inserted into the E3 region. At the same time, in the nucleotide sequence encoding the Rb binding site in the E1A gene sequence, the E1A site has two modifications, one is that the Glu 45 residue is replaced by Gly, and the other hand amino acid 121 to 127 sequence is completely replaced by Gly.

[0058] Viruses other than adenovirus can also be used in the present invention. The virus that can be used in the present invention may preferably be vaccinia virus (Puhlmann M. et al., Human Gene Therapy 10:649-657 (1999)), lentivirus (Wang G. et al., J. Clin. Invest. 104 (11): R55-62 (1999)), or herpes simplex virus (Chamber R., et al., Proc. Natl. Acad. Sci USA 92: 1411-1415 (1995)), but is not limited thereto.

[0059] The recombinant adenovirus used in the present invention includes a promoter operable in an animal cell (preferably a mammalian cell). Promoters suitable for the present invention include promoters derived from mammalian viruses and promoters derived from mammalian cell genomes, including, for example, cytomegalovirus (CMV) promoter, U6 promoter and H1 promoter, murine leukemia virus (MLV) long terminal repeat sequence (LTR) promoter, adenovirus early promoter, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, HSV Tk promoter, RSV promoter, EF1α promoter, metallothionein promoter, β-actin promoter, human IL-2 gene promoter, human IFN gene promoter, human IL-4 gene promoter, human lymphotoxin gene promoter, human GM-CSF gene promoter, inducible promoter, cancer cell specific promoter (e.g., TERT promoter, modified TERT promoter, PSA promoter, PSMA promoter, CEA promoter, survivin promoter, E2F promoter, modified E2F promoter, AFP promoter, modified AFP promoter, E2F-AFP hybrid promoter, and E2F-TERT hybrid promoter), tissue specific promoter (e.g., albumin promoter), human phosphoglycerate kinase (PGK) promoter, and mouse phosphoglycerate kinase (PGK) promoter, but are not limited thereto. Most preferably, the promoter is a CMV promoter. Preferably, in an expression construct for expressing a trans gene, a polyadenylation sequence is bound downstream of said trans gene. Polyadenylation sequences include the bovine growth hormone terminator (Gimmi, ER, et al., Nucleic Acids Res. 17:6983-6998 (1989)), SV40 derived polyadenylation sequence (Schek, N, et al., Mol. Cell Biol. 12:5386-5393 (1992)), HIV-1 polyA (Klasens, BIF, et al., Nucleic Acids Res. 26:1870-1876 (1998)), β-globin polyA (Gil, A., et al, Cell 49:399-406 (1987)), HSV TK polyA (Cole, CN and TPStacy, Mol. Cell. Biol. 5:2104-2113 (1985)), or polyoma virus polyA (Batt, DB and GGBiol. 15:4783-4790 (1995)), but not limited thereto.

[0060] In the recombinant adenovirus used in the present invention, the IL-12 gene sequence, GM-CSF-Relaxin gene sequence, or shVEGF gene sequence is operably linked to a promoter. As used herein, the term "operably linked" refers to a functional combination between a nucleic acid expression regulatory sequence (e.g., a promoter, a signal sequence, and an array formed by a transcriptional regulatory factor binding site) and another nucleic acid sequence, and thus, the regulatory sequence regulates the transcription and / or translation of the other nucleic acid sequence.

[0061] The recombinant adenovirus of the present invention may also include antibiotic resistance genes and reporter genes (e.g., green fluorescent protein (GFP), luciferase and β-glucuronidase) as selection markers. Antibiotic resistance genes include antibiotic resistance genes commonly used in the art, such as genes that confer resistance to ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin and tetracycline, preferably a neomycin resistance gene. The above-mentioned selection markers can even be expressed in expression systems connected by separate promoters or internal ribosome entry sites (IRES), which can be used in the present invention. IRES is a regulatory sequence found in the RNA of certain viruses and cells.

[0062] Another aspect of the present invention provides: a pharmaceutical composition for preventing or treating cancer, the composition comprising a recombinant adenovirus; and a pharmaceutically acceptable carrier; the medical use of the recombinant adenovirus for preventing or treating cancer; and a method for treating cancer, the method comprising the step of administering a therapeutically effective amount of the recombinant adenovirus to an individual.

[0063] Since the pharmaceutical composition of the present invention uses the above-mentioned recombinant adenovirus, in order to avoid excessive complexity of this specification, the description of the common contents between the two will be omitted.

[0064] As used herein, the term "prevention" refers to all effects of inhibiting cancer (tumor) or delaying the onset of cancer (tumor) by administering the pharmaceutical composition of the present invention.

[0065] As used herein, the term "treatment" refers to all actions that improve or beneficially change the symptoms of cancer (tumor) by administering the pharmaceutical composition of the present invention.

[0066] In the present invention, "individual" refers to a subject in need of disease treatment, more specifically, a mammal, such as a human or non-human primate, a rodent (rats, mice, guinea pigs, etc.), a mouse, a dog, a cat, a horse, a cow, a sheep, a pig, a goat, a camel, and an antelope.

[0067] "Cancer", as a disease prevented or treated by the pharmaceutical composition of the present invention, generally refers to a disease caused by cells having aggressive characteristics, invasive characteristics, and metastatic characteristics, wherein the aggressive characteristics refer to the division and growth of cells regardless of normal growth restrictions, the invasive characteristics refer to the infiltration of surrounding tissues, and the metastatic characteristics refer to the spread to other parts of the body. In the present invention, cancer has the same meaning as a malignant tumor, which may include solid tumors and blood-borne tumors. For example, the cancer can be any one selected from the group consisting of gastric cancer, lung cancer, non-small cell lung cancer, breast cancer, ovarian cancer, liver cancer, bronchial cancer, nasopharyngeal cancer, laryngeal cancer, pancreatic cancer, bladder cancer, colon cancer, cervical cancer, bone cancer, non-small cell bone cancer, hematological malignancies, skin cancer, head and neck cancer, uterine cancer, colorectal cancer, anal cancer, colon cancer, fallopian tube cancer, endometrial cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, esophageal cancer, small intestine cancer, endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, lymphocytic lymphoma, kidney or fallopian tube cancer, renal cell carcinoma, renal pelvis cancer, salivary gland cancer, sarcoma cancer, pseudomyxoma peritonei peritonei), hepatoblastoma, testicular cancer, glioblastoma, cheilocarcinoma, ovarian germ cell tumor, basal cell carcinoma, multiple myeloma, gallbladder cancer, choroidal melanoma, ampulla of Vater cancer, peritoneal cancer, tongue cancer, small cell carcinoma, pediatric lymphoma, neuroblastoma, duodenal cancer, ureteral cancer, astrocytoma, meningioma, renal pelvic cancer, pudendum cancer, thymic cancer, central nervous system (CNS) tumors, primary CNS lymphoma, spinal cord tumors, brain stem gliomas, and pituitary adenomas, and may also be recurrent cancers, but are not limited thereto.

[0068] Meanwhile, the pharmaceutical composition of the present invention may further comprise an immune checkpoint inhibitor.

[0069] As used herein, the term "immune checkpoint" generally refers to proteins involved in stimulating or inhibiting immune responses on the surface of immune cells, and cancer cells evade the surveillance network of the immune system by being manipulated, so that the stimulation of immune responses and the inhibition of cancer cells cannot be properly performed through the immune checkpoint. Preferably, the immune checkpoint protein can be a PD-1 antagonist, a PD-L1 antagonist, a PD-L2 antagonist, a CD27 antagonist, a CD28 antagonist, a CD70 antagonist, a CD80 antagonist, a CD86 antagonist, a CD137 antagonist, a CD276 antagonist, a KIRs antagonist, a LAG3 antagonist, a TNFRSF4 antagonist, a GITR antagonist, a GITRL antagonist, a 4-1BBL antagonist, a CTLA-4 antagonist, an A2AR antagonist, a VTCN1 antagonist, a BTLA antagonist, an IDO antagonist, a TIM-3 antagonist, a VISTA antagonist, a KLRA antagonist and a combination thereof, but are not limited thereto.

[0070] An immune checkpoint inhibitor is an antagonist or antibody that targets immune checkpoint proteins and exhibits an anti-cancer effect caused by an immune response by enhancing proteins that stimulate immune responses or blocking proteins that inhibit immune responses. Because immune checkpoint inhibitors use an immune response system with excellent memory ability, in addition to having fewer side effects (such as vomiting or hair loss) and obvious therapeutic effects than general cytotoxic anticancer agents, even after drug withdrawal, the therapeutic effect can also be continued for a long time, but it is not known to enhance the anti-cancer effect by co-administration with recombinant adenovirus. Therefore, the inventors attempt to co-administer with immune checkpoint inhibitors to enhance the anti-cancer effect of recombinant adenovirus, and there is another technical feature, that is, to provide a medical use of recombinant adenovirus in the form of co-administration with immune checkpoint inhibitors to prevent or treat cancer.

[0071] In addition to active ingredients, the pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. In this case, a pharmaceutically acceptable carrier is usually used during preparation, including lactose, glucose, sucrose, sorbitol, mannitol, starch, gum arabic, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinyl pyrrolidone, cellulose, water, syrup, methylcellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, mineral oil, etc., but is not limited thereto. In addition, in addition to the above-mentioned components, a pharmaceutically acceptable carrier may also include a lubricant, a wetting agent, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, etc. Suitable pharmaceutically acceptable carriers and preparations are described in Remington's Pharmaceutical Sciences (19th edition, 1995).

[0072] The pharmaceutical composition of the present invention can be administered orally or parenterally (e.g., intravenously, subcutaneously, intraperitoneally or topically), and according to an embodiment of the present invention, the anti-tumor immune enhancement composition of the present invention can preferably be directly administered into the tumor. The dosage varies according to the patient's condition and body weight, the severity of the disease, the drug form, the route of administration and the duration, but can be appropriately selected by those skilled in the art.

[0073] The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" refers to an amount sufficient to treat a disease with a reasonable benefit / risk ratio suitable for medical treatment, and the effective dose level can be determined according to a variety of factors, including the patient's disease type, the severity of the disease, drug activity, drug sensitivity, administration time, administration route, excretion rate, treatment period, and drugs used simultaneously, and other factors well-known in the medical field. Another pharmaceutical composition according to the present invention can be used as a separate therapeutic agent or in combination with other therapeutic agents, can be used sequentially or simultaneously with therapeutic agents in related fields, and can be used in single doses or multiple doses. Taking all of the above factors into account, it is important to administer the composition in the minimum amount to obtain the maximum effect without any side effects, which can be easily determined by those skilled in the art.

[0074] Hereinafter, preferred embodiments for helping to understand the present invention will be presented. However, the following embodiments are provided only to make it easier to understand the present invention, and the content of the present invention is not limited by the following embodiments.

[0075] Example

[0076] Experimental Materials and Methods

[0077] 1. Animal Experiments

[0078] Male C57BL / 6 mice aged 6 to 8 weeks were purchased from Charles River Laboratories International, Inc. (Wilmington, MA) and bred under pathogen-free conditions in a laminar airflow chamber. All animal experiments were performed with the approval of the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC) and in accordance with the guidelines established by the Hanyang University Animal Care and Use Committee.

[0079] 2. Production of Oncolytic Adenovirus

[0080] Adenovirus (Ad) was prepared, wherein IL-12 and GM-CSF-relaxin or shVEGF were introduced into the E1 region and the E3 region, respectively. Figure 1 and 2 .

[0081] Specifically, to construct an Ad E1 shuttle vector expressing IL-12, the pXC1RdB / IL12 E1 shuttle vector was prepared by excising the mouse IL-12 gene from pCA14 / IL12 and subcloning the gene into the pXC1RdB E1 shuttle vector. In addition, to construct an E3 shuttle vector expressing shVEGF, the full-length mouse shVEGF complementary DNA was cloned by RT-PCR using total RNA obtained from bone marrow-derived activated dendritic cells. The shVEGF complementary DNA (nucleotides 53-982, National Center for Biotechnology Information L15435) was prepared using the following primer pair: sense (5'-gatcccggaaggagagcagaagtcccatgttcaagagacatgggacttctgctctcctt tttttttggaaa-3'), antisense (5'-tttccaaaaaaa aaggagagcagaagtcccatgtctcttgaacatgggacttctgctctccttccgggatc-3'). The PCR product was digested with BamHI / Hind III and then cloned into the pSP72 E3 / CMV-polAAd E3 shuttle vector treated with BamHI / Hind III to make the pSP72 E3 / shVEGF E3 shuttle vector. In addition, pSP72 E3 / GMCSF-RLX E3 shuttle vector was made by cloning the GMCSF-IRES-Relaxin gene in the pSP72 E3 / CMV-polA Ad E3 shuttle vector.

[0082] For homologous recombination, E. coli BJ5183 was transformed with pXC1RdB / IL12 E1 shuttle vector and pdE1 / shVEGF or pdE1 / GMCSF-RLX to produce pRdB / IL12 / shVEGF Ad and pRdB / IL12 / GMCSF-RLX Ad. All viruses were produced using 293 cells, and adenovirus purification, titration and quality analysis were performed according to the prior art.

[0083] 3. Evaluating anticancer effects using animal models

[0084] B16-F10 cells (5 x 10 5 ) was injected subcutaneously into the right flank of 6- to 7-week-old male C57BL / 6 immunocompetent mice. When the tumor volume reached approximately 100 mm 3 At 4 dpi, mice were divided into groups with similar tumor sizes and treated with 5 × 10 9Oncolytic adenovirus (RdB / IL12 / shVEGF Ad; RdB / IL12 / GMCSF-RLXAd) was administered intraperitoneally to the tumor at a concentration of 200 μg of VP on days 1, 3, and 5. In addition, to confirm the anticancer effect of co-administration with immune checkpoint inhibitors, anti-PD-L1 antibody, anti-PD-1 antibody, and anti-CTLA-4 antibody were used as immune checkpoint inhibitors and intraperitoneally administered to mice at a concentration of 200 μg of oncolytic adenovirus on days 3, 6, and 9, and to further evaluate the synergistic effect of co-administration with immune checkpoint inhibitors, 1x10 9 The VP oncolytic adenovirus was used again in the same experiment as above, but the dose was 5x 10 9 VP was 5 times lower. Meanwhile, in this experiment, the PBS-treated group (PBS) and the immune checkpoint inhibitor-treated groups alone (anti-PD-L1 antibody, anti-PD-1 antibody, and anti-CTLA-4 antibody) were used as controls.

[0085] After that, the anticancer effect was evaluated using an animal model, and the growth of the tumor was monitored by measuring the vertical tumor diameter with a caliper every day, and the change in survival rate over time was also confirmed. At the same time, the tumor volume was calculated using the following formula: Volume = 0.523L (W) 2 , where L represents length and W represents width.

[0086] 4. Using immune memory to evaluate anti-cancer effects

[0087] The primary tumor was injected into 3 animal models induced with melanoma, and then on day 50, the secondary tumor was re-injected (re-challenged) into the successfully treated mice (day 25 from the time point when the primary tumor could not be promoted). Thereafter, the anti-tumor immune memory effect was evaluated in the same manner as above, by measuring the vertical tumor diameter every other day to monitor the growth of the tumor and calculate the average tumor volume. In this experiment, a group in which melanoma was induced in normal mice (normal) was used as a control.

[0088] 5. Statistical Analysis

[0089] All data are expressed as mean ± standard error. Stat View software (Abacus Concepts, Inc., Berkeley, CA) and Mann-Whitney test (nonparametric rank sum test) were used for comparison. P values ​​equal to or less than 0.05 indicated statistical significance (*, P < 0.05; **, P < 0.01).

[0090] Experimental Results

[0091] 1. Confirmation of anticancer effect in melanoma mice

[0092] The present inventors aimed to confirm the anticancer effects of recombinant adenovirus and / or immune checkpoint inhibitors by comparing the volume of tumors injected into melanoma mice, the presence of complete remission, and the survival rate of mice.

[0093] The results confirmed that in the controls treated with PBS or anti-PD-L1 antibody, tumors proliferated rapidly, with tumor volumes reaching 3,000 mm on day 11 or 15, respectively. 3or more, thereby showing strong tumor growth, while in the group treated with RdB / IL12 / shVEGF Ad or RdB / IL12 / GMCSF-RLX Ad, as a result of comparison with the PBS-treated group on day 22, tumor growth was inhibited by 99.3% or 99.5%, respectively (see Figures 3A and 4A, respectively). In addition, when adenovirus and anti-PD-L1 antibody were co-administered (RdB / IL12 / shVEGF Ad+PD-L1, RdB / IL12 / GMCSF-RLX Ad+PD-L1), the tumor volume was significantly reduced compared with the group treated with adenovirus alone or anti-PD-L1 antibody alone in the same manner as above. In the anti-PD-L1 antibody co-administration group, although the anticancer effect similar to that of the adenovirus alone treatment group (RdB / IL12 / shVEGF Ad, RdB / IL12 / GMCSF-RLX Ad) did not appear until the 27th day, tumor growth was continuously inhibited from the end of one month, while in the adenovirus alone treatment group, tumor growth increased over time, and it can be seen that there was a significant difference in tumor volume between the adenovirus alone treatment group and the adenovirus and antibody co-administration group (Figures 3A and 4A). In addition, it can be seen that on day 50, complete remission could not be confirmed in the control treated with PBS or anti-PD-L1 antibody, while in the RdB / IL12 / shVEGF Ad or RdB / IL12 / GMCSF-RLX Ad group, the survival rates were 66% (4 / 6) and 50% (3 / 6), respectively, and when adenovirus and anti-PD-L1 antibody were co-administered, the survival rates were 66% (4 / 6) and 100% (6 / 6), the latter being complete remission. In addition, it was confirmed that all mice in the RdB / IL12 / shVEGF Ad+PD-L1 or RdB / IL12 / GMCSF-RLX Ad+PD-L1 groups survived until day 44 or day 50, respectively, while at the same time point, the survival rate of the RdB / IL12 / shVEGF Ad or RdB / IL12 / GMCSF-RLX Ad group was 66% (4 / 6), and all mice in the control group were killed by tumors (Figures 3B and 4B). These results mean that the anti-cancer effect of immune checkpoint inhibitor anti-PD-L1 antibody alone is relatively insignificant, but RdB / IL12 / shVEGF Ad or RdB / IL12 / GMCSF-RLX Ad exhibits excellent anti-cancer effects, and when co-administered with anti-PD-L1 antibodies, the anti-cancer effect of recombinant adenovirus is further enhanced.

[0094] 2. Anticancer effect of co-administration with immune checkpoint inhibitors

[0095] The present inventors compared the anticancer effects of recombinant adenovirus alone and recombinant adenovirus co-administered with immune checkpoint inhibitors, using (1 x 10 9VP) dose of oncolytic adenovirus, which is higher than the 5x 10 9 VP was 5-fold lower to evaluate the synergistic effect of co-administration with immune checkpoint inhibitors in more detail. In addition, based on these results, when anti-PD-L1 antibody, anti-PD-1 antibody, or anti-CTLA-4 antibody was used as an immune checkpoint inhibitor, the anticancer effects of these antibodies were compared. In this experiment, RdB / IL12 / GMCSF-RLX Ad was used as a recombinant adenovirus.

[0096] As a result, on day 18, as a result of comparison of tumor volume with that of the PBS-treated group, the tumor growth inhibition rate of the RdB / IL12 / shVEGF Ad group was 92.9%, but co-administration with anti-PD-1 antibody increased the tumor growth inhibition rate to 99.7%, and the tumor growth inhibition rate of the RdB / IL12 / GMCSF-RLX Ad group (90.1%) was also greatly increased to 98.9% by co-administration with anti-PD-1 antibody ( Figure 5 and 6 ). In addition, only 17% (1 / 6) of the RdB / IL12 / shVEGF Ad group had complete remission, while in the RdB / IL12 / shVEGF Ad+PD-1 group, the complete remission rate was 83% (5 / 6), which was greatly increased.

[0097] Meanwhile, to confirm whether other types of recombinant adenovirus also show synergistic effects by co-administration with immune checkpoint inhibitors, HmT-Rd19-K35 / IL21 Ad, RdB / GMCSF / shVEGF Ad, or YKL-1 / GMCSF / B7.1Ad were co-administered with anti-PD-1 antibodies, and then their anticancer effects were confirmed. Figure 7 As shown, most recombinant adenoviruses can reduce tumor volume to a certain extent by co-administering with anti-PD-1 antibodies, but most recombinant adenoviruses fail to show the same significant effect as the recombinant adenovirus of the present invention (RdB / IL12 / shVEGF Ad, RdB / IL12 / GMCSF-RLX Ad), especially YKL-1 / GMCSF / B7.1 Ad, which has an overall effect not excellent compared with the group treated with anti-PD-1 antibodies alone. From these results, it can be seen that the synergistic effect of co-administration with immune checkpoint inhibitors is not applicable to all recombinant adenoviruses and is a unique effect of the recombinant adenovirus of the present invention.

[0098] In addition, when confirming the anti-cancer effects of different types of immune checkpoint inhibitors, it was found that the tumor volume of control mice treated with PBS, anti-PD-L1 antibody, anti-PD-1 antibody, or anti-CTLA-4 antibody increased rapidly, reaching 3,000 mm on days 11, 15, 18, or 11, respectively. 3or higher, showing strong tumor growth, while in the RdB / IL12 / GMCS-RLX Ad+anti-PD-L1 antibody treatment group, the RdB / IL12 / GMCSF-RLX Ad+anti-PD-1 antibody treatment group, and the RdB / IL12 / GMCSF-RLX Ad+anti-CTLA-4 antibody treatment group, tumor growth was greatly inhibited, and on day 21, it was inhibited by 99.9%, 99.9% or 99.2% compared with the PBS treatment group, respectively (Figures 4A, 8A and 9A). In addition, in the RdB / IL12 / GMCSF-RLX Ad group, the complete remission rate on day 50 was 50% (3 / 6), while when anti-PD-L1 antibody, anti-PD-1 antibody, or anti-CTLA-4 antibody was co-administered, the complete remission rates were 100% (6 / 6), 83% (5 / 6), and 83% (5 / 6), respectively, all of which were improved. In addition, mice treated with RdB / IL12 / GMCSF-RLX Ad+anti-PD-L1 antibody, RdB / IL12 / GMCSF-RLX Ad+anti-PD-1 antibody, and RdB / IL12 / GMCSF-RLX Ad+anti-CTLA-4 antibody survived until day 50, day 50, or day 30, respectively, while at these same time points, the survival rates of the RdB / IL12 / GMCSF-RLX Ad group were 66% (4 / 6), 66 (4 / 6), 83% (5 / 6), and 83% (5 / 6), respectively ( Figures 4B , 8B , and 9B ). These results indicate that although the anticancer effect of recombinant adenovirus can be enhanced by the use of anti-PD-L1 antibody, anti-PD-1 antibody, or anti-CTLA-4 antibody, the synergistic effect associated with the anticancer effect of RdB / IL12 / GMCSF-RLX Ad is more significant when anti-PD-L1 antibody or anti-PD-1 antibody is co-administered than when anti-CTLA-4 antibody is co-administered.

[0099] 3. Confirmation of immune memory effect on recurrent cancer

[0100] The present inventors intend to confirm the immune memory effect and anti-cancer effect on recurrent cancer of the recombinant adenovirus of the present invention, or the co-administration of the recombinant adenovirus and immune checkpoint inhibitors, by comparing the volume of secondary tumors injected into melanoma mice or similar animals.

[0101] The results showed that in the RdB / IL12 / shVEGF Ad group, the growth of secondary tumors was significantly inhibited (Figure 10A), and in particular, the growth of secondary tumors was more significantly inhibited by co-administration with the immune checkpoint inhibitor anti-PD-1 antibody (Figure 10B). These results mean that the recombinant adenovirus of the present invention can enhance the effect of anti-tumor immune response through immune memory, thereby preventing tumor recurrence in advance, and also suggest that this effect is enhanced by co-administration with immune checkpoint inhibitors, just like the effect on the above-mentioned anti-cancer effect.

[0102] 4. Verify the anticancer effect of RdB / IL12 / GMCSF-RLX Ad

[0103] (1) Confirm the expression pattern of IL-12, GM-CSF, and relaxin

[0104] In order to verify the anticancer effect of co-expression of IL-12, GM-CSF and relaxin (RLX) genes, RdB / IL12 / GMCSF-RLX Ad was prepared as described above, in which the IL-12 gene was inserted into the E1 region, and the GM-CSF and relaxin genes were inserted into the E3 region. RdB / IL12 / GMCSF-RLX Ad is a cancer cell-specific oncolytic adenovirus, in which the E1B gene as the starting gene of the adenovirus is deleted, the E1A gene is modified, and the expression levels of IL-12, GM-CSF, and RLX of the resulting adenovirus are confirmed. Specifically, the Syrian hamster pancreatic cancer cell line (Hap-T1) was infected with RdB / IL12 / GMCSF-RLX at a multiplicity of infection (MOI) of 0.2, 0.5, 1, 2, and 5, and the culture medium was collected after 48 hours. Thereafter, the expression levels of IL-12 and GM-CSF were confirmed by enzyme-linked immunosorbent assay (ELISA), and the expression level of relaxin was confirmed by reverse transcription polymerase chain reaction (RT-PCR).

[0105] The results are as follows Fig.11 and 12 As shown, the expression levels of IL-12, GM-CSF, or relaxin increased with the adenovirus MOI, so the co-expression of these genes could be confirmed experimentally.

[0106] (2) In the Syrian hamster tumor animal model, co-administration with αPD-1 resulted in enhanced anti-cancer effects

[0107] To verify the enhanced anti-cancer effect of co-administration of RdB / IL12 / GMCSF-RLX Ad and αPD-1, 7x 10 7The RdB / IL12 / GMCSF-RLX Ad was intraperitoneally administered with 10 mg / kg of αPD-1, and the changes in tumor volume were observed. At the same time, the RdB / IL12 / GMCSF-RLX Ad alone group was used as a comparison group.

[0108] The results are as follows Fig.13 As shown, in tumor tissues that were administered RdB / IL12 / GMCSF-RLX Ad alone, the tumor continued to grow, so that on day 30 after the first administration of the virus, the tumor volume reached 1.982 ± 126 mm 3 , while in the RdB / IL12 / GMCSF-RLX Ad and αPD-1 co-administration group, tumor growth was inhibited until the 30th day after the first administration of the virus, bringing the inhibition of tumor growth to about 79% of the single-administration group. In addition, in the RdB / IL12 / GMCSF-RLX Ad and αPD-1 co-administration group, the complete remission rate of the tumor was about 50%, while in the RdB / IL12 / GMCSF-RLX Ad single-administration group, complete remission was not observed at all (not shown). That is, these results suggest that the anti-cancer efficacy of RdB / IL12 / GMCSF-RLX Ad is significantly improved by co-administration with αPD-1.

[0109] (3) Changes in tumor tissue caused by co-administration of αPD-1 in the Syrian hamster tumor animal model

[0110] In order to specifically confirm the changes in tumor tissue caused by co-administration of RdB / IL12 / GMCSF-RLX Ad and αPD-1, 7× 10 7 After co-administration of RdB / IL12 / GMCSF-RLX Ad and 10 mg / kg αPD-1 of VP, tumor tissues were collected for immunohistological evaluation. Meanwhile, the αPD-1 alone administration group or RdB / IL12 / GMCSF-RLX Ad alone administration group and PBS administration group were used as comparison and control groups, respectively.

[0111] The results showed that Fig.14 As shown, in the tumor tissues administered with PBS, the necrotic sites were almost unrecognizable, while most of the tumor tissues in the RdB / IL12 / GMCSF-RLX Ad and αPD-1 co-administration groups became necrotic. In addition, the co-administration significantly reduced tumor cell proliferation (PCNA) and significantly increased cell necrosis (TUNEL) compared with αPD-1 administration alone or RdB / IL12 / GMCSF-RLX Ad administration alone.

[0112] (4) Changes in cell populations and IFN-γ expression in tumor tissues due to co-administration with αPD-1

[0113] To evaluate whether RdB / IL12 / GMCSF-RLX Ad can induce the infiltration and activation of T cells in tumor tissues when αPD-1 is increased infiltrated into tumor tissues, the expression of interferon (IFN)-γ in CD4 T cells in draining lymph nodes (DLNs) and tumor tissues was evaluated. + or CD8 + Changes in the number of T cells. Fig.15 and 16 As shown, in the RdB / IL12 / GMCSF-RLX Ad or αPD-1 alone administration group and the RdB / IL12 / GMCSF-RLX Ad and αPD-1 co-administration group, the IFN-γ-expressing CD4 + and CD8 + The number of T cell populations was higher than that of the PBS or αPD-1 alone administration group (P<0.001 or P<0.01). In particular, it was confirmed that the CD4+ and CD8+ T cell populations expressing IFN-γ in the RdB / IL12 / GMCSF-RLX Ad and αPD-1 co-administration group were also significantly increased compared with the RdB / IL12 / GMCSF-RLX Ad or αPD-1 alone administration group (P<0.001). This result indicates that the co-administration of RdB / IL12 / GMCSF-RLX Ad and αPD-1 induced the infiltration and activation of CD4+ or CD8+ T cells expressing interferon (IFN)-γ in the tumor.

[0114] In addition, in order to evaluate the expression level of IFN-γ in tumor tissues administered with adenovirus, tumor tissues were extracted from mice administered with adenovirus, etc., finely ground, and then subjected to IFN-γ ELISA analysis. Fig.17 As shown, IFN-γ was not detected at all when PBS or αPD-1 was administered intratumorally alone, only 8.3 pg / mg IFN-γ was detected per 1 g tumor tissue in the RdB / IL12 / GMCSF-RLX Ad alone administration group, and 18.7 pg / mg IFN-γ was detected per 1 g tumor tissue in the RdB / IL12 / GMCSF-RLX Ad and αPD-1 co-administration group. This suggests that the above co-administration enhances the activity of immune cells by increasing the expression of IFN-γ in tumors, and ultimately helps to enhance the anti-cancer effect.

[0115] (5) Confirmation of anticancer effects in cases of resistance to immune checkpoint inhibitors

[0116] In order to evaluate whether the co-administration of RdB / IL12 / GMCSF-RLX Ad and αPD-1 can show an effective therapeutic effect under the condition of tolerance to immune checkpoint inhibitors, the growth inhibitory effect of the co-administration on tumors previously treated with αPD-1 was evaluated. Specifically, when αPD-1 alone failed to effectively inhibit tumor growth (9 days after the first treatment with the antibody), RdB / IL12 / GMCSF-RLX Ad was administered a total of four times at intervals of 2 days. At the same time, the group administered with αPD-1 alone was used as a comparison group.

[0117] The results are as follows Fig.18 As shown, when the tumor volume reached 915±78mm 3 RdB / IL12 / GMCSF-RLXAd was started at 1:10 pm and effectively inhibited tumor growth from the first day of administration, which lasted for 10 days. Interestingly, the αPD-1 monotherapy group showed a rapid increase in tumor growth rate and therefore could not inhibit tumor growth, while the co-administration group continued to inhibit tumor growth even during the above period. In addition, as a result of comparing tumor volume changes (on the 23rd day after administration), the growth inhibition effect in the co-administration group was the most significant. This means that the above co-administration shows an effective anti-cancer therapeutic effect even under conditions of tolerance to immune checkpoint inhibitors. Therefore, it is suggested that the above co-administration can be a therapy that is beneficial to patients who are tolerant to immune checkpoint inhibitor monotherapy.

[0118] (6) Changes in the infiltration of αPD-1 into tumor tissues due to administration of RdB / IL12 / GMCSF-RLX Ad

[0119] It is predicted that the expression of RLX in tumor tissues will exhibit synergistic anticancer efficacy by promoting the intratumoral infiltration of αPD-1. Therefore, it was intended to evaluate whether RdB / IL12 / GMCSF-RLX Ad increases the intratumoral infiltration of αPD-1 into desmoplastic pancreatic tumor tissues. RdB / IL12 / GMCSF-RLX Ad was directly administered to tumor tissues on day 0 or day 2, and αPD-1 was administered intraperitoneally on day 2 (c: RdB / IL12 / GMCSF-RLX+Alexa 488-anti-PD-1), the Alexa 488-conjugated αPD-1 alone administration group (b; Alexa 488-anti-PD-1) and the PBS alone administration group (a; PBS) were used as comparison groups and controls, respectively. Tumor tissues treated as described above were collected on day 7, and the accumulation of Alexa488-αPD-1 in tumor tissues was quantified by immunofluorescence analysis. As a result of quantifying the accumulation of Alexa 488-αPD-1 per unit tissue area, as shown in FIG. Fig. 20As shown, the PBS alone administration group or the αPD-1 alone administration group showed 14±2 A.U. / μm 2 or 21±1A.U. / μm 2 , while the co-administration group showed 32±6A.U. / μm 2 . From the results, it can be seen that RdB / IL12 / GMCSF-RLX Ad significantly improved the infiltration of αPD-1 into tumor tissues and helped to improve the localization of αPD-1 in tumor tissues. In addition, in order to confirm whether Alexa488-αPD-1 is located at the expression site of CD4+ or CD8+ T cells, CD4+CD8+ immunostaining was performed on tumor tissues of the PBS alone administration group (a: PBS), or Alexa 488-conjugated αPD-1 alone administration group (b: Alexa 488-anti-PD-1), or RdB / IL12 / GMCSF-RLX Ad and Alexa 488-conjugated αPD-1 co-administration group (c: RdB / IL12 / GMCSF-RLX+Alexa 488-anti-PD-1). The results, as shown Fig.21 As shown, in the co-administration group, a higher level of co-localization of αPD-1 and CD4 or CD8 was observed than in the Alexa 488-αPD-1 single administration group.

[0120] To assess the systemic infiltration of αPD-1 into tumors, 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid was used as described above. 64 Cu-αPD-1 (αPD-1 and 64 Cu-coupled) was administered together with RdB / IL12 / GMCSF-RLXAd to HaP-Ti transplanted hamsters to obtain immuno-PET images. 64 PET scans were performed at 2, 12, 36, and 60 hours after Cu-αPD-1 administration, and primary PET imaging was performed together with CT for anatomical description. 64 The Cu-αPD-1 alone group was used as a comparison group. Fig. 22 As shown, the SUV of the co-administration group and the single-administration group 64 Cu-αPD-1 intratumoral uptake was as follows: 0.26±0.06 and 0.36±0.05 at 2 hours (P=0.072); 0.90±0.22 and 1.68±0.45 at 12 hours (P=0.018); 2.14±0.19 and 2.97±0.67 at 36 hours (P=0.062); 3.37±0.57 and 4.50±1.02 at 60 hours (P=0.043). In other words, it was observed that at all the above time points, the co-administered group 64The intratumoral uptake of Cu-αPD-1 was significantly higher than 64 Cu-αPD-1 alone group intratumoral absorption. 64 At 60 hours after Cu-αPD-1 administration, 64 The distribution or absorption of Cu-αPD-1 in various tissues including tumor tissues is expressed as %ID / g. Fig.23 As shown, the absorption of the single-administration group and the co-administration group was: 1.80±0.13%ID / g, 2.80±0.41%ID / g (P<0.05), respectively, in tumor tissue; 1.10±0.11%ID / g, 1.94±0.23%ID / g (P<0.05), respectively, in spleen, while in the co-administration group, 64 Cu-αPD-1 absorption was improved in both tumor tissue and spleen. Spleen. In addition to these tissues, draining lymph nodes (DLNs), as T cell enrichment sites, were swollen due to infection with RdB / IL12 / GMCSF-RLX Ad (results not shown). That is, when the above experimental results are combined, it can be seen that infection with RdB / IL12 / GMCSF-RLX Ad remodels or decomposes the extracellular matrix in tumor tissue, improves the absorption of αPD-1 in tumor tissue by enhancing the immune response of IL-12 and GM-CSF, and results in a synergistic effect of co-administration.

[0121] The above description of the present invention is provided for the purpose of illustration, and those skilled in the art to which the present invention belongs will understand that the present invention can be easily modified into other specific forms without changing the technical spirit or basic characteristics. Therefore, it should be understood that the above embodiments are merely illustrative and non-restrictive in all aspects.

Claims

1. Use of a recombinant adenovirus in the preparation of a drug for assisting an immune checkpoint inhibitor, the recombinant adenovirus comprising: a gene encoding interleukin 12 (IL-12); and a gene encoding shRNA that inhibits VEGF (vascular endothelial growth factor) expression, The recombinant adenovirus comprises a deletion of the E1B-19k gene in the E1 region and a deletion of the E3 region, and The gene encoding IL-12 is inserted into the E1 region, and the gene encoding shRNA that inhibits VEGF (vascular endothelial growth factor) expression is inserted into the deleted E3 region.

2. Use of a recombinant adenovirus in the preparation of a drug for treating cancer in combination with an immune checkpoint inhibitor, the recombinant adenovirus comprising: a gene encoding interleukin 12 (IL-12); and a gene encoding shRNA that inhibits the expression of VEGF (vascular endothelial growth factor), The recombinant adenovirus comprises a deletion of the E1B-19k gene in the E1 region and a deletion of the E3 region, and The gene encoding IL-12 is inserted into the E1 region, and the gene encoding shRNA that inhibits VEGF (vascular endothelial growth factor) expression is inserted into the deleted E3 region.

3. The use according to claim 2, wherein the cancer is a solid tumor.

4. The use according to claim 2, wherein the cancer is a hematological malignancy.

5. The use according to claim 2, wherein the cancer is a recurrent cancer.

6. The use according to any one of claims 1 to 5, wherein the recombinant adenovirus further comprises a deletion of the E1B-55k gene.

7. The use according to any one of claims 1 to 6, wherein the recombinant adenovirus is administered in combination with an immune checkpoint inhibitor simultaneously, separately, or sequentially.

8. The use of any one of claims 1 to 7, wherein the immune checkpoint inhibitor is selected from one of the following: programmed cell death-1 (PD-1) antagonists, programmed cell death-ligand 1 (PD-L1) antagonists, programmed cell death-ligand 2 (PD-L2) antagonists, cluster of differentiation 27 (CD27) antagonists, cluster of differentiation 28 (CD28) antagonists, cluster of differentiation 70 (CD70) antagonists, cluster of differentiation 80 (CD80, also known as B7-1) antagonists, cluster of differentiation 86 (CD86, also known as B7-2) antagonists, cluster of differentiation 137 (CD137) antagonists, cluster of differentiation 276 (CD276) antagonists, killer cell immunoglobulin-like receptors (KIRs) antagonists, lymphocyte activation gene 3 (LAG3) antagonists, tumor necrosis factor receptor superfamily member 4 (TNFRS F4, also known as CD134) antagonists, glucocorticoid-induced TNFR-related protein (GITR) antagonists, glucocorticoid-induced TNFR-related protein ligand (GITRL) antagonists, 4-1BB ligand (4-1BBL) antagonists, cytotoxic T lymphocyte-associated antigen-4 (CTLA-4) antagonists, adenosine A2A receptor (A2AR) antagonists, V-set domain-containing T cell activation inhibitor 1 (VTCN1) antagonists, B- and T-lymphocyte attenuator (BTLA) antagonists, indoleamine 2,3-dioxygenase (IDO) antagonists, T cell immunoglobulin domain and mucin domain 3 (TIM-3) antagonists, V-domain Ig inhibitor of T cell activation (VISTA) antagonists, killer cell lectin-like receptor subfamily A (KLRA) antagonists, and combinations thereof.

9. The use according to any one of claims 1 to 8, wherein the recombinant adenovirus enhances anti-tumor immunity.

Images