Medicago sativa MsDHN11 gene and application thereof in plant drought resistance

Abstract

The invention discloses a medicago sativa MsDHN11 gene and application thereof in plant drought resistance, and relates to the field of transgenic plants, the amino acid sequence of the MsDHN11 protein is as shown in SEQ ID NO: 1 or has at least 80% identity with the sequence as shown in SEQ ID NO: 1, the expression quantity of the MsDHN11 protein or the MsDHN11 gene is increased under the induction of drought stress, and after the MsDHN11 gene is transferred into a target plant, the expression quantity of the MsDHN11 protein or the MsDHN11 gene is increased. The stress resistance of target plants can be effectively improved, and varieties with higher stress resistance can be cultivated.

Description

Technical Field

[0001] The invention relates to the field of transgenic plants, in particular to an alfalfa MsDHN11 gene and an application thereof in plant drought resistance. Background Art

[0002] Alfalfa (Medicago sativa, English name Alfalfa) is famous for its high crude protein content, good palatability, rich nutrition and other characteristics. It is a high-quality feed for livestock and is known as the "first workshop for high-quality milk production." In addition, alfalfa has a well-developed root system and strong nitrogen fixation ability. It can be rotated with other crops, which helps to optimize the structure and function of the farmland ecosystem, thus having certain ecological value.

[0003] Under drought conditions, soil water deficit causes alfalfa to be unable to maintain its normal growth and metabolic activities. Long-term water deficit causes a significant increase in cell membrane permeability and electrolyte exudation, affecting the stability of the membrane system. In addition, water shortage can cause plant dehydration, thereby affecting photosynthesis, reducing the absorption and transportation of nutrients and water, and limiting plant growth. The water and nutrient restrictions brought about by drought lead to a significant reduction in alfalfa yield. Plants that cannot grow and develop normally will show a decrease in the number and volume of inflorescences, which in turn affects seed yield and quality. Research on the molecular response mechanism of alfalfa under adverse stress can provide an important theoretical basis and technical support for ensuring the normal growth and development of alfalfa and stable production. Discovering new drought-resistant genes is of great significance to expanding the scale of alfalfa production and accelerating the development of the livestock industry.

[0004] In view of this, the present invention is proposed. Summary of the invention

[0005] The purpose of the present invention is to provide an alfalfa MsDHN11 gene and its application in plant drought resistance.

[0006] The present invention is achieved in that:

[0007] In a first aspect, an embodiment of the present invention provides a MsDHN11 protein, whose amino acid sequence is as shown in SEQ ID NO: 1 or has at least 80% identity with the sequence as shown in SEQ ID NO: 1.

[0008] In a second aspect, an embodiment of the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding the MsDHN11 protein described in the preceding embodiment.

[0009] In a third aspect, an embodiment of the present invention provides a vector comprising the nucleic acid molecule described in the preceding embodiment.

[0010] In a fourth aspect, an embodiment of the present invention provides a recombinant bacterium or a recombinant cell, which contains the isolated nucleic acid molecule described in the preceding embodiments or the vector described in the preceding embodiments.

[0011] In a fifth aspect, an embodiment of the present invention provides a method for preparing the MsDHN11 protein as described in the preceding embodiments, comprising: culturing the recombinant bacteria or recombinant cells described in the preceding embodiments, or artificially synthesizing the MsDHN11 protein described in the preceding embodiments.

[0012] In a sixth aspect, the embodiments of the present invention provide the use of the MsDHN11 protein described in the preceding embodiments, or the isolated nucleic acid molecule described in the preceding embodiments, or the vector described in the preceding embodiments, or the recombinant bacteria or recombinant cells described in the preceding embodiments in improving plant stress resistance or improving microbial stress resistance.

[0013] In a seventh aspect, an embodiment of the present invention provides a method for improving plant stress resistance, comprising: increasing the activity and / or expression level of MsDHN11 protein in a target plant; the amino acid sequence of the MsDHN11 protein has at least 80% identity with the sequence shown in SEQ ID NO:1.

[0014] The present invention has the following beneficial effects:

[0015] The MsDHN11 gene and its encoded protein cloned from the legume plant alfalfa in this application have increased expression levels under the induction of drought stress. After the MsDHN11 gene is transferred into the target plant, the stress resistance (including drought tolerance) of the target plant can be effectively improved, which is conducive to the cultivation of varieties with stronger stress resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0017] Figure 1 Characteristic analysis of MsDHN11 gene; (a): gene structure and predicted conserved domains of MsDHN11 protein; (b): evolutionary analysis; (c): predicted tertiary protein structure; (d): multiple sequence alignment;

[0018] Figure 2The expression levels of 1-month-old alfalfa under different stresses and at different times; A: 500 mM mannitol; B: 250 mM NaCl; C: 80 μM ABA; each treatment was measured at 0, 3, 6, 12 and 24 h after hydroponic treatment; *P<0.05, **P<0.01;

[0019] Figure 3 Identification and relative expression level of positive seedlings of MsDHN11 overexpressing Arabidopsis; A: Identification of positive seedlings of MsDHN11 overexpressing Arabidopsis; B: Relative expression level of positive seedlings of MsDHN11 overexpressing Arabidopsis; OE5, OE7 and OE11 lines were used for subsequent experiments;

[0020] Figure 4 Analysis of drought tolerance of MsDHN11-overexpressing Arabidopsis during germination; A: seed germination phenotype of WT and OE strains under 400mM and 500mM mannitol stress; B: seed germination rate of WT and OE strains under 400mM and 500mM mannitol stress;

[0021] Figure 5 Analysis of drought tolerance of MsDHN11-overexpressing Arabidopsis thaliana seedlings; A: vertical growth phenotype of WT and OE strains on control and 300 mM mannitol plates; B: number of lateral roots of WT and OE strains on control and 300 mM mannitol plates; C: leaf fresh weight of WT and OE strains on control and 300 mM mannitol plates, scale bar: 1 cm, *P<0.05, **P<0.01;

[0022] Figure 6 Survival rates of MsDHN11-overexpressing Arabidopsis and wild type plants after 30 days of soil drought; *P<0.05, **P<0.01;

[0023] Figure 7 Identification and relative expression level of positive seedlings of alfalfa overexpressing MsDHN11; A: Identification of positive seedlings of alfalfa overexpressing MsDHN11; B: Relative expression level of positive seedlings of alfalfa overexpressing MsDHN11; OE6, OE9 and OE10 lines were used for subsequent experiments;

[0024] Figure 8 The phenotypes of 40-day-old MsDHN11 overexpressing and wild-type alfalfa in the same pot after soil drought and rewatering; scale bar: 5 cm;

[0025] Fig. 9 The phenotype and partial magnification of 2-month-old MsDHN11-overexpressing alfalfa after 20 days of soil drought and 7 days after rewatering. DETAILED DESCRIPTION

[0026] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0027] The inventors of the present application cloned the MsDHN11 gene and its protein from the legume plant alfalfa. The study found that the expression of the MsDHN11 gene increased under the induction of drought stress. After the coding gene was transferred into the plant, the stress resistance (especially drought tolerance) of the target plant or microorganism could be improved, which has important reference and reference significance for cultivating and obtaining drought-tolerant legumes. The enhancement of drought tolerance of the target plant is mainly manifested in the well-developed root system and longer root length of the transgenic plant seedlings under drought stress.

[0028] The MsDHN11 gene and its protein provide new genetic resources for molecular design breeding of alfalfa drought resistance, and will play an important role in breeding new drought-resistant alfalfa materials. It also provides a new solution for improving the drought resistance traits of other non-food economic crops.

[0029] In one aspect, an embodiment of the present invention provides a MsDHN11 protein, whose amino acid sequence is as shown in SEQ ID NO: 1 or has at least 80% identity with the sequence as shown in SEQ ID NO: 1.

[0030] On the other hand, an embodiment of the present invention further provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding the MsDHN11 protein described in any of the aforementioned embodiments.

[0031] In some embodiments, the nucleic acid molecule can be a gene encoding MsDHN11 protein or its CDS region.

[0032] In some embodiments, the sequence of the nucleic acid molecule is at least 80% identical to the sequence shown in SEQ ID NO:2 or SEQ ID NO:3.

[0033] In some embodiments, the at least 80% identity refers to 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 100% or any two of the identity. Alternatively, one or more amino acids may be substituted, deleted or added to form an amino acid sequence with non-100% identity.

[0034] In some embodiments, the sequence of the nucleic acid molecule is shown as SEQ ID NO:2 or SEQ ID NO:3.

[0035] On the other hand, an embodiment of the present invention further provides a vector, which comprises the nucleic acid molecule described in any of the above embodiments.

[0036] In some embodiments, the vector includes a cloning vector and an expression vector. A plant expression vector can be used to construct a recombinant vector containing the isolated nucleic acid molecule encoding the MsDHN11 protein. The plant expression vector can be a Gateway system vector or a binary Agrobacterium vector, such as pGWB411, pGWB412, pGWB405, pBin438, pCAMBIA1300, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, pCAMBIA1301, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb.

[0037] On the other hand, an embodiment of the present invention further provides a recombinant bacterium or a recombinant cell, which contains the isolated nucleic acid molecule described in any of the foregoing embodiments or the vector described in any of the foregoing embodiments.

[0038] In some embodiments, the recombinant bacteria may be bacteria or fungi. The bacteria may be Agrobacterium and Escherichia coli; the fungi may be yeast.

[0039] In some embodiments, the recombinant cell comprises a transgenic cell line.

[0040] In some embodiments, the recombinant cell can be a mammalian cell and a cell line. "Mammalian cell" includes cells from any member of a mammal, such as a human cell, a mouse cell, a rat cell, a monkey cell, a hamster cell, etc. In some embodiments, the cell is a mouse cell, a human cell, a Chinese hamster ovary (CHO) cell, a CHOK1 cell, a CHO-DXB11 cell, a CHO-DG44 cell, a CHOK1SV cell (including all variants (e.g., Lonza, Slough, UK)) or a CHOK1SV GS-KO (glutamine synthetase knockout) cell (including all variants (e.g., XCEEDTM, Lonza, Slough, UK).

[0041] On the other hand, an embodiment of the present invention provides a method for preparing the MsDHN11 protein as described in any of the foregoing embodiments, comprising: culturing the recombinant bacteria or recombinant cells described in any of the foregoing embodiments, or artificially synthesizing the MsDHN11 protein described in any of the foregoing embodiments.

[0042] Based on the amino acid sequence of the protein disclosed in the present invention, it is easy for those skilled in the art to conceive of using genetic engineering technology or other technologies (chemical synthesis, recombinant expression) to prepare the protein, for example, separating and purifying the protein from the culture product of a recombinant cell or recombinant bacteria that can recombinantly express the protein as described in any of the above items. This is easy to achieve for those skilled in the art. Based on this, no matter what technology is used to prepare the MsDHN11 protein of the present invention, it belongs to the protection scope of the present invention.

[0043] On the other hand, the embodiments of the present invention also provide the use of the MsDHN11 protein as described in any of the preceding embodiments, or the isolated nucleic acid molecule as described in any of the preceding embodiments, or the vector as described in any of the preceding embodiments, or the recombinant bacteria or recombinant cells as described in any of the preceding embodiments in improving plant stress resistance or improving microbial stress resistance.

[0044] In some embodiments, the stress resistance includes drought resistance. "Drought resistance" refers to the ability to resist water loss stress. Optionally, the water loss stress can be a natural stress that is the same or equivalent to the simulated stress with a final mannitol concentration of 400-500 mM.

[0045] In some embodiments, the plant comprises: a dicot.

[0046] In some embodiments, the plant includes any one of Arabidopsis thaliana and Medicago truncatula.

[0047] In some embodiments, the microorganism comprises bacteria.

[0048] In some embodiments, the microorganism comprises Escherichia coli or Agrobacterium.

[0049] In some embodiments, the improving plant stress resistance comprises cultivating plants with enhanced stress resistance. The improving microbial stress resistance comprises cultivating microorganisms with enhanced stress resistance.

[0050] In some embodiments, the cultivation of microorganisms with enhanced stress resistance includes: increasing the activity and / or expression level of MsDHN11 protein in the target microorganism; the amino acid sequence of the MsDHN11 protein has at least 80% identity with the sequence shown in SEQ ID NO: 1. The at least 80% identity can specifically be any one of 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 100% or any two of the identities.

[0051] In addition, an embodiment of the present invention also provides a method for improving plant stress resistance, which comprises: increasing the activity and / or expression level of MsDHN11 protein in a target plant; the amino acid sequence of the MsDHN11 protein is as shown in SEQ ID NO:1 or has at least 80% identity with the sequence shown in SEQ ID NO:1.

[0052] In some embodiments, the stress resistance and the plant are the same as those described in any of the above embodiments and will not be repeated herein.

[0053] In some embodiments, the expression level includes protein expression level and / or gene expression level.

[0054] In some embodiments, the step of increasing the protein activity and / or expression level of the MsDHN11 protein in the target plant comprises: inserting a nucleic acid molecule encoding the MsDHN11 protein into the genome of the target plant.

[0055] In some embodiments, the method further comprises: artificially cultivating transgenic plant seeds obtained by inserting the nucleic acid molecule encoding the MsDHN11 protein into the genome of the target plant or allowing the transgenic plant seeds to grow naturally.

[0056] In some embodiments, the sequence of the nucleic acid molecule encoding the MsDHN11 protein has at least 80% identity with the sequence shown in SEQ ID NO: 2 or SEQ ID NO: 3. The at least 80% identity can specifically be any one of 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 100%, or any two of the identities.

[0057] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0058] Example 1

[0059] This example clones and sequences the MsDHN11 coding gene, including the following steps:

[0060] Plant material: Alfalfa Zhongmu No. 1.

[0061] Under normal conditions, healthy and plump seeds were germinated in a culture dish covered with double-layer filter paper for 5 days. When the cotyledons of the seedlings unfolded, they were moved to the prepared 1 / 2MS nutrient solution (pH = 5.8). After 7 days of cultivation, mannitol was added to the 1 / 2MS nutrient solution to a final concentration of 400mM and treated for 24 hours. The above-ground and underground parts of the plants were quickly taken, frozen in liquid nitrogen, and stored at -80°C for later use.

[0062] The RNA of the sample was extracted by Trizol method, and the RNA was reverse transcribed into cDNA using cDNA synthesis reverse transcription kit; at the same time, the DNA was extracted by CTAB method. The total volume of PCR amplification system was 50 μL, including 5×Phusion HFBuffer 10 μL, 2.5 mM dNTP 4 μL, primers MsDHN11-F (5'-3'): CGCGGATCCATGCCTGATAACATGAGTAT (SEQ ID No: 4) 1 μL, MsDHN11-R (5'-3'): CGAGCTCTCACACTGACGTATTCGACA (SEQ ID No: 5) 1 μL, ddH 2 O32.5μL, Phusion DNA Polymerase 0.5μL and cDNA / DNA 1μL; amplification conditions are: (1) pre-denaturation at 98℃ for 30s; (2) denaturation at 98℃ for 10s; (3) annealing at 60℃ for 60s; (4) extension at 72℃ for 15s; (5) 2-4 steps for 35 cycles; (6) extension at 72℃ for 5min; (7) termination at 16℃.

[0063] The results of electrophoresis in 1% agarose gel electrophoresis showed that the length of the target gene was 432 bp. The DNA fragment of the gene was recovered and double-digested with the expression vector pBI121-35S-GUS. The restriction sites were BamH I and Sac I. The restriction results were confirmed by gel electrophoresis, and then the DiaSpin column DNA gel recovery kit (B110092, Shanghai Sangon Biotechnology Co., Ltd.) was used to recover the product. Finally, the target fragment after restriction digestion was connected to the expression vector using T4 DNA ligase (MO202, New England Biolabs Beijing Co., Ltd.), and transferred into Escherichia coli DH5a competent cells, evenly spread on LB resistance plates containing Kan, and cultured in a 37°C incubator overnight. The appropriate positive clone plaques were detected and selected, and picked into a liquid culture medium containing Kan resistance, and cultured overnight in a 37°C shaker at 200 rpm.

[0064] After the bacterial solution was tested to be suitable, it was sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the colony had the nucleotide sequence in SEQ ID No:2, which was named MsDHN11 gene, and the protein encoded by the gene was named MsDHN11 protein, and the protein sequence was shown in SEQ ID No:1.

[0065] MsDHN11 was compared with the homologs of 14 other species. Figure 1 As shown, the highest homology is with Medicago truncatula protein AES80901.1 (Medtr7g086340). Figure 1In the figure, (a) shows the gene structure of MsDHN11; (b) shows the homologous comparison results of MsDHN11 with other 11 species.

[0066] Example 2

[0067] This example analyzes the expression characteristics of the MsDHN11 gene under drought stress induction based on real-time fluorescence quantitative PCR, including the following steps:

[0068] The germination and hydroponic culture of alfalfa seeds were the same as in Example 1, and the stress treatment was performed on 12-day-old alfalfa seedlings:

[0069] Drought treatment: 500mM mannitol, 250mM NaCl and 80μM ABA were added to 1 / 2MS hydroponic nutrient solution for 1, 3, 6, 12, 24h, and rehydration for 1, 3h. The aboveground and underground parts of the plants were quickly taken, and the samples were frozen in liquid nitrogen and stored at -80℃ for later use.

[0070] The steps and reagents for sample RNA extraction and reverse transcription were the same as those in Example 1. The cDNA was diluted to 50 ng / μL, and the expression of the target gene was detected using qRTMsDHN11-F (5'-3'): GGTGATGCCCTTCACATAGGA (SEQ ID No: 6) and qRTMsDHN11-R (5'-3'): TCCTCCTACGCCTCCTACAA (SEQ ID No: 7), and MsACTIN-F (5'-3'): ACTGGAATGGTGAAGGCTGG (SEQ ID No: 8) and MsACTIN-R (5'-3'): TGACAATACCGTGCTCAATGG (SEQ ID No: 9) were used as internal references. The total volume of the PCR detection system was 20 μL, including 2×SG Fast qPCR Master Mix 10 μL, primer qRTMsDHN11-F 0.5 μL, primer qRTMsDHN11-R 0.5 μL, DNF buffer 2 μL, ddHO 2 O 5μL and cDNA 2μL; amplification conditions were: (1) 95℃ pre-denaturation for 10min; (2) 95℃ denaturation for 15s; (3) 60℃ annealing for 1min; (4) 2-3 steps cycled 40 times. qRT-PCR reactions were performed on a Bio-Rad CFX96 real-time fluorescence quantitative PCR instrument, with 3 technical replicates for each sample.

[0071] Exploit 2 -ΔΔCtMethods Relative expression was calculated. ΔΔCt = (Ct. target gene - Ct. internal reference gene) Time x - (Ct. target gene - Ct. internal reference gene) Time 0; Time x represents any five time points of adversity treatment, specifically 1h, 3h, 6h, 12h or 24h. Time 0 represents 0 hours of adversity treatment (control group). Origin 9 software was used for drawing.

[0072] Results Figure 2 In the roots of alfalfa, the MsDHN11 gene was induced by mannitol, NaCl and ABA stresses.

[0073] Example 3

[0074] This example verifies the application of MsDHN11 in improving the stress resistance of Arabidopsis thaliana.

[0075] It should be noted that Arabidopsis thaliana is used as a model plant in the present invention to perform functional analysis and verification of the MsDHN11 gene, and the conclusions thereof can be considered equivalent to the molecular mechanism by which MsDHN11 in alfalfa regulates plant response to drought.

[0076] The experimental operation of this embodiment includes the following steps:

[0077] 1. Prepare transgenic MsDHN11 Arabidopsis.

[0078] 1. Construction of recombinant vector.

[0079] (1) Cloning of MsDHN11 gene

[0080] Primers MsDHN11-GF and MsDHN11-GR were designed according to the sequence of the MsDHN11 gene, and BamHI and SacI restriction sites were introduced into the 5' end of the primers respectively: MsDHN11-F (5'-3'): CGCGGATCCATGGCAGGAATCATGAACAAGAT (SEQID No: 4), MsDHN11-R (5'-3'): CGAGCTCTCTCACATATGACTCCATACACTGTCACTG (SEQ ID No: 5); the cDNA of alfalfa in Example 1 was used as a template, and PCR amplification was performed using MsDHN11-F and MsDHN11-R. The total volume of the PCR amplification system was 50 μL, including 10 μL of 5×Phusion HF Buffer, 4 μL of 2.5 mM dNTP, 1 μL of primers MsDHN11-F, 1 μL of MsDHN11-R, 1 μL of ddH 2O 32.5μL, Phusion DNA Polymerase 0.5μL and cDNA 1μL; amplification conditions are: (1) 98℃ pre-denaturation for 60s; (2) 98℃ denaturation for 10s; (3) 57℃ annealing for 30s; (4) 72℃ extension for 15s; (5) 2-4 steps for 32 cycles; (6) 72℃ extension for 5min; (7) 16℃ termination. The PCR amplification product was obtained and detected on 1.5% agarose gel, and the product size was determined to be about 432bp.

[0081] (2) Enzyme digestion and ligation.

[0082] The PCR amplification product was recovered and purified, digested with restriction endonucleases BamHI and SacI, and the digested PCR product was recovered to obtain a digestion product with a size of 432 bp; at the same time, the pBI121-35S-GUS expression vector was digested with restriction endonucleases BamHI and SacI; and a vector backbone with a size of about 12946 bp was recovered.

[0083] Use DNA ligase (TaKaRa, catalog number: 6022) to connect the digested product of the target gene and the vector backbone of the pBI121-35S-GUS expression vector overnight at 4°C. Heat-shock the ligated product to transform E. coli DH5α, culture it at 37°C overnight, detect the positive clones by PCR and send them for sequencing.

[0084] (3) Obtaining recombinant Agrobacterium.

[0085] The positive clone whose sequencing sequence was completely consistent with the CDS sequence of MsDHN11 (SEQ ID NO: 3) was selected to extract the plasmid, and the vector was used to transform Agrobacterium EHA105 to obtain the recombinant Agrobacterium EHA105 / pBI121-MsDHN11, which was mixed with 50% glycerol in a 1:1 ratio, quickly frozen in liquid nitrogen, and stored at -80°C for later use.

[0086] 2. Transfection of MsDHN11 Arabidopsis

[0087] Take out the recombinant Agrobacterium EHA105 / pBI121-MsDHN11 from -80℃ and place it on ice. Pick out some frozen bacteria and add them to 3mL LB liquid. Shake them in a shaker at 28℃ and 200rpm for 24h. Take 2mL of small shaking bacteria liquid and add it to 200mL LB liquid. Shake them in a shaker at 28℃ and 200rpm for 20h-24h until OD reaches 0. 600 =1.2-2.0.

[0088] Take part of the bacterial suspension and centrifuge at 4500g for 15 min. Pour away the LB liquid, resuspend and dilute with 5% sucrose to OD 600= 0.8 flower soaking buffer. Soak the inflorescence of Arabidopsis thaliana (Columbia ecotype Col-0) (the fruit pods can be cut off two days before to improve transfection efficiency) in the invasion dye solution for 3-5 seconds;

[0089] After soaking, take out the flowerpot, keep it in the dark for 24 hours, and continue to cultivate it in the greenhouse. Infect it for the second time after 1 week.

[0090] After soaking, take out the flowerpot, keep it in the dark for 24 hours, and continue to culture in the greenhouse. Infect it for the second time after 1 week. Harvest the T1 generation seeds, select the positive plants and select them with kanamycin (KAN, 10 mg / mL), and pass them until the T3 generation obtains homozygous strains.

[0091] The T2 generation refers to the seeds produced by self-pollination of the T1 generation and the plants grown from the seeds, and the T3 generation refers to the seeds produced by self-pollination of the T2 generation and the plants grown from the seeds.

[0092] Using the whole plant DNA of the T3 generation regenerated plants as a template, PCR amplification was performed with the target gene primer pair 35S-F (5'-3'): GCACAATCCCCACTATCCTTC (SEQ ID No. 10) and MsDHN11-R (5'-3'): CGAGCTCTCTCACATATGACTCCATACACTGTCACTG (SEQ ID No. 5), and the Npt primer pair NptII-F (5'-3'): GAGCGGCGATACCGTAAAGC (SEQ ID No: 11) and NptII-R (5'-3'): TGGGTGGAGAGGCTATTCGG (SEQ ID No: 12).

[0093] The PCR detection system and amplification conditions of MsDHN11 and NptII genes were the same. The PCR detection system was as follows: the total volume of PCR was 20 μL, including 10 μL of 2×Eco Taq PCR SuperMix, 1 μL of upstream primer, 1 μL of downstream primer, ddH 2 O 6μL and DNA template (50ng / μL), 2μL; amplification conditions were: (1) 94℃ pre-denaturation for 4min; (2) 94℃ denaturation for 30s; (3) 56℃ annealing for 30s; (4) 72℃ extension for 30s; (5) 2-4 steps for 35 cycles; (6) 72℃ extension for 7min.

[0094] The results are as follows Figure 3 As shown in A, 11 homozygous strains in the T3 generation amplified a single band at 432 bp. Figure 3 B in the figure shows the detection result of NptII resistance.

[0095] 2. Evaluation of stress resistance of transgenic plants

[0096] Evaluation of water loss resistance of transgenic plants

[0097] (1) Effect of drought stress on germination rate:

[0098] After disinfection, 50 seeds of each of the three representative strains of T3 transgenic MsDHN11 Arabidopsis, OE5, OE7, OE11 and wild type Co1-0, were evenly spotted on MS medium and MS medium containing 400 mM mannitol using a 10 μL pipette tip, sealed with a sealing film, and treated at 4°C for 3 days. They were then moved into an incubator at 22°C, 16 h light, 8 h dark, and 60% relative humidity for 8 days. The germination rate was counted every day, and three biological replicates were set for each treatment. The results were averaged and the standard deviation was calculated.

[0099] The results are as follows Figure 4 As shown: This figure compares the germination of wild-type and transgenic lines in MS medium and MS medium containing 400mM mannitol. The results show that on MS plates, the germination rate and germination speed of wild-type and transgenic lines are basically the same; while on 400mM mannitol plates, the germination rate and germination speed of MsDHN11-transgenic Arabidopsis lines are significantly greater than those of wild-type.

[0100] (2) Effect of water loss stress on root length

[0101] The plant materials were three representative lines of T3 transgenic MsDHN11 Arabidopsis thaliana, OE5, OE7, OE11 and the wild type Col-0.

[0102] After the seeds of each strain were disinfected, healthy and full seeds were selected and evenly dotted on the culture medium with a 10μL pipette tip. The culture medium was divided into: MS culture medium and MS culture medium containing 400mM mannitol. The culture medium was sealed with a sealing film. After 3 days of vernalization, the seeds were moved into an incubator with a temperature of 22°C, a light duration of 16h, and a relative humidity of 60% and cultured for 9 days. Three transgenic strains with consistent root lengths and wild-type Co1-0 seedlings were selected and moved to MS culture medium and MS culture medium containing 400mM mannitol, respectively. After 9 days of culture, the root length of each strain was counted. Three biological replicates were set for each treatment. The results were averaged and the standard deviation was calculated.

[0103] The results are as follows Figure 5As shown: This figure is a comparison of the roots of T3 strains OE5, OE7, OE11 and wild-type strain Col-0 grown on MS medium and MS medium containing 400mM mannitol. The results show that on MS plates, the root lengths of wild-type and MsDHN11-transformed Arabidopsis strains are basically the same; while on MS medium containing 400mM mannitol, the number of lateral roots and the fresh weight of the aboveground part of the wild-type strains are lower than those of the MsDHN11-transformed Arabidopsis strains.

[0104] (3) Effect of soil dehydration on resistance of transgenic plants

[0105] The plant materials were three representative lines of T3 transgenic MsDHN11 Arabidopsis thaliana, OE5, OE7, OE11 and the wild type Col-0.

[0106] After the seeds of each strain were disinfected, healthy and full seeds were selected and evenly dotted on the culture medium with a 10μL pipette tip and sealed with a sealing film. After 3 days of vernalization, they were moved into an incubator with a temperature of 22℃, a light time of 16h, and a relative humidity of 60% for 14 days. The seedlings were moved to small square pots with the same soil weight in each pot and 6 seedlings in each pot. After 14 days of normal cultivation, the soil in each pot was allowed to absorb water to saturation, and then the water was cut off. The water dehydration treatment was carried out for 30 days until the wild-type plants wilted, and then rehydration was started. The plant phenotype was observed and photographed ( Figure 6 During this period, take photos and record them every 5-10 days, and calculate the soil weight and relative soil water content.

[0107] Figure 6 The results are a comparison of the growth conditions of T3 generation strains OE5, OE7, OE11 and wild-type strains under normal water supply (Before drought treatment), dehydration treatment (After drought treatment for 30 days) and rehydration treatment (After rewatering for 4 days). The results show that before dehydration, the growth conditions of both the MsDHN11 transgenic Arabidopsis strain and the wild type are basically the same; after dehydration, the growth of the wild type is significantly weaker than that of the transgenic strain; after rehydration, the survival rate of the wild type is lower than that of the transgenic strain. Therefore, the method provided in this application can enhance the drought tolerance of Arabidopsis, which can also be extended to the method being able to enhance the drought tolerance of alfalfa.

[0108] Example 4

[0109] This example verifies the application of MsDHN11 in improving the stress resistance of alfalfa.

[0110] 1. Construction of recombinant vector (same as Example 3)

[0111] 2. Transformation of MsDHN11 alfalfa:

[0112] (1) Turn on the UV light (burn the tweezers) and the spectrophotometer (wait for 30 minutes);

[0113] Preparation: filter paper, cuvette, 5mL centrifuge tube × 2, wash bottle, about 4.5L of distilled water, clean culture dish, glass rod, 1L beaker, colander, 1000μL pipette, blue pipette tip, LB liquid;

[0114] (2) Measure the OD of the bacterial suspension 600 Is it 0.6-0.8? According to formula C 1 V 1 =C 2 V 2 Calculate the volume of SM4 liquid;

[0115] (3) Open the 4°C centrifuge and wait for the temperature to drop (close the centrifuge door, otherwise the temperature will not drop);

[0116] (4) Add 600 mL of distilled water and 600 μL of Tween (Tween is viscous, so lift the gun slowly when aspirating) to a 1 L beaker, stir with a glass rod (rinsed with distilled water) until bubbles appear, add the leaves, and stir for 3-5 min;

[0117] (5) Pour off the Tween, collect the leaves with a colander, and wash the leaves three times with distilled water, stirring for 2 min each time;

[0118] (6) Place the washed leaves in a clean culture dish, cover it with a lid, and place it in a clean bench;

[0119] (7) Use tweezers (not sterilized) to place the leaf into the tissue culture bottle ①, pour in 75% alcohol, shake the bottle, and pour out the alcohol after 15 seconds (start counting from the moment the alcohol is poured into the bottle, count for 3-5 seconds, pour out the alcohol, and stop counting when the last drop of alcohol is poured out);

[0120] (8) Add ddH 2 O, wash twice, pour out ddHO 2 O;

[0121] (9) Prepare 30% bleach (ddH 2 O:bleach = 7:3). Use 50mL centrifuge tube A to measure 30mL bleach + 70mL ddHO. 2 O (or 60mL bleach + 140mL ddH 2 O) Pour into tissue culture bottle②;

[0122] (10) Pour the 30% bleach mixed in tissue culture bottle ② into the tissue culture bottle ① containing the leaves, wrap the sealing film tightly, and shake at 28℃ and 100 rpm for 10 min (the tissue culture bottle can be placed flat);

[0123] (11) Take the tissue culture bottle① into the clean bench and wash with ddH 2 O Wash 4 times;

[0124] (12) In a clean bench, dispense 70 mL of the shaken culture into two 50 mL centrifuge tubes B (35 mL in each tube) and centrifuge at 6500 rpm / 4000 g at 4 °C for 10 min.

[0125] (13) (Quickly continue from the previous step) In a clean bench, discard the supernatant and use a 50 mL centrifuge tube C to measure V SM4 Pour into two centrifuge tubes B, blow with a gun, rinse with SM4 solution, and pour into tissue culture bottle ③ (remember the volume measured each time);

[0126] (14) Use sterilized and cooled tweezers to clip the leaf from tissue culture bottle ① into the infection solution in tissue culture bottle ③;

[0127] (15) Place tissue culture bottle ③ into a vacuum pump (without sealing film) and use a vacuum pump (air pressure > 0.7) to extract for 10 minutes (if the air pressure is lower, it can be extracted for 12 minutes);

[0128] Preparation: sealing film, ice pack, distilled water, sonicator, ultra-clean bench UV (to burn tweezers), filter paper, SM4 co-culture medium;

[0129] (16) Add distilled water and ice packs to the ultrasonic instrument, seal the tissue culture bottle ③ with a sealing film, and use the ultrasonic instrument to beat the leaves for 3-5 minutes, shaking the bottle in time (the infection solution can be slightly lower than the water surface to prevent water from entering the tissue culture bottle);

[0130] (17) Remove the sealing film and apply vacuum for 10-12 minutes;

[0131] (18) Lay the leaves on filter paper and let them dry (two layers of filter paper). The filter paper should be close to the air outlet until there is no reflection on the surface of the leaves.

[0132] (19) Spread the leaves flat on SM4 co-culture medium and wrap with Parafilm;

[0133] (20) Wrap in tin foil and keep in the dark for 3 days (to avoid excessive growth of Agrobacterium);

[0134] (21) After 3 days of dark treatment, the leaves grown on SM4 co-culture medium were spread on filter paper, the petioles were cut off with a scalpel, and then the leaves were cut in half;

[0135] (22) Spread the leaves flat on SM4 selective medium, with 7 leaves per dish to avoid overcrowding, wrap with Parafilm, and place in a walk-in incubator for 2 months; change the callus to MSBK medium and grow for 2 months, then change to SH9 medium until seedlings form.

[0136] 3. Identification of Overexpressed Medicago sativa

[0137] The method was the same as that of positive seedling identification of overexpressed Arabidopsis in Example 3. The positive identification of MsDHN11 overexpressed alfalfa seedlings was performed, and the expression level of positive plants was determined by qRT-PCR experiment. Figure 7 , a total of 11 positive strains of alfalfa were obtained.

[0138] 4. Soil drought test

[0139] Evaluation of stress resistance of alfalfa overexpression lines.

[0140] (1) Cutting and propagation of transgenic plants:

[0141] Two-month-old alfalfa plants were grown in a greenhouse. Before flowering, healthy branches (about 10 nodes) were cut from the 4th to 5th nodes from top to bottom, with a length of about 6-8 cm, and the top of the branch must contain a leaf bud; they were soaked in 2% sodium hypochlorite solution for 5 minutes and rinsed with distilled water for more than 3 times; the upper end of the branch was cut flat and the bottom end was cut obliquely with sharp scissors, leaving a leaf at the leaf bud; the bottom end of the branch was inserted into a sterilized vermiculite plug tray with a depth of about 3 cm and placed on a bottom tray; 0.05% potassium permanganate solution was poured into the bottom tray and replenished weekly until rooting; after 2 weeks, the cutting seedlings grew some short roots, and the potassium permanganate solution in the bottom tray was replaced with 1 / 2MS nutrient solution, which was poured every 3 days, and no nutrient solution could remain in the bottom tray to avoid the growth of green algae; after 1 month, the cutting seedlings grew a strong root system and were moved to a large pot for other experiments.

[0142] (2) Drought stress treatment;

[0143] Two-month-old WT and OE cuttings were divided into two types of soil drought in the same pot and different pots to evaluate the drought resistance of alfalfa. In the soil drought test in the same pot, the pots were watered for 40 days and obvious phenotypes appeared. Photos were taken on the 21st and 40th days, and the phenotypes of different strains in different treatments were observed after rehydration for 10 days.

[0144] Results Figure 8 After 40 days of drought stress, the three overexpression lines showed a significant drought-tolerant phenotype. After rehydration, the phenotypes of the overexpression lines recovered, while the wild type basically died.

[0145] In the soil drought test in different pots, obvious phenotypes appeared after the pots were watered for 20 days. Photos were taken on the 7th and 20th days, and the phenotypes of different strains in different treatments were observed after rehydration for 7 days.

[0146] Results Fig. 9After 40 days of drought stress, the three overexpression lines showed a significant drought-tolerant phenotype. After rehydration, the phenotypes of the overexpression lines recovered, while the wild type basically died.

[0147] In summary, the coding gene cloned from the legume plant alfalfa in this application increases expression under the induction of drought, sodium chloride and plant hormone abscisic acid, and the encoded protein is localized to the cell nucleus, endoplasmic reticulum and cell membrane; after the coding gene is transferred into the plant, the drought resistance of the target plant can be improved. The protein with drought resistance obtained after encoding is conducive to the cultivation of plant varieties with stronger stress resistance or the transformation of stress resistance of other plants.

[0148] The stress resistance genes and drought-tolerant proteins provided in this application provide ideas and methods for studying related drought-tolerant regulatory genes, and have important reference and reference significance for cultivating and obtaining drought-tolerant plants. They are conducive to cultivating alfalfa with or enhancing drought tolerance, expanding the scale of alfalfa production and planting, and accelerating the development of animal husbandry industry.

[0149] Some of the sequence information involved in this application is as follows.

[0150]

[0151]

[0152] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A MsDHN11 protein, characterized in that Its amino acid sequence is as shown in SEQ ID NO:1 or has at least 80% identity with the sequence as shown in SEQ ID NO:

1.

2. An isolated nucleic acid molecule, characterized in that It comprises a nucleotide sequence encoding the MsDHN11 protein according to claim 1; Optionally, the sequence of the nucleic acid molecule is at least 80% identical to the sequence shown in SEQ ID NO: 2 or SEQ ID NO: 3; Optionally, the sequence of the nucleic acid molecule is shown in SEQ ID NO:2 or SEQ ID NO:

3.

3. A carrier, characterized in that It comprises the nucleic acid molecule according to claim 2.

4. A recombinant bacterium or a recombinant cell, characterized in that: It contains the isolated nucleic acid molecule according to claim 2 or the vector according to claim 3.

5. The method for preparing the MsDHN11 protein according to claim 1, characterized in that: It includes: Cultivate the recombinant bacteria or recombinant cells described in claim 4, or artificially synthesize the MsDHN11 protein described in claim 1.

6. Use of the MsDHN11 protein according to claim 1, the isolated nucleic acid molecule according to claim 2, the vector according to claim 3, or the recombinant bacterium or recombinant cell according to claim 4 in improving plant stress resistance or improving microbial stress resistance.

7. The use according to claim 6, characterized in that: The stress resistance includes drought resistance; Optionally, the plants include: dicotyledonous plants; Optionally, the plant includes any one of Arabidopsis thaliana and alfalfa; Optionally, the microorganism comprises bacteria; Optionally, the microorganism comprises Escherichia coli or Agrobacterium.

8. A method for improving plant stress resistance, characterized in that: It includes: The activity and / or expression level of the MsDHN11 protein in the target plant is increased; the amino acid sequence of the MsDHN11 protein has at least 80% identity with the sequence shown in SEQ ID NO:

1.

9. The method according to claim 8, characterized in that The stress resistance includes drought resistance; Optionally, the plants include: dicotyledonous plants; Optionally, the plant includes any one of Arabidopsis thaliana and alfalfa.

10. The method according to claim 8 or 9, characterized in that: The expression level includes protein expression level and / or gene expression level; Optionally, the step of increasing the protein activity and / or expression level of the MsDHN11 protein in the target plant comprises: inserting a nucleic acid molecule encoding the MsDHN11 protein into the genome of the target plant; Optionally, the method further comprises: artificially cultivating transgenic plant seeds obtained by inserting the nucleic acid molecule encoding the MsDHN11 protein into the genome of the target plant or allowing the transgenic plant seeds to grow naturally; Optionally, the sequence of the nucleic acid molecule encoding the MsDHN11 protein has at least 80% identity with the sequence shown in SEQ ID NO:2 or SEQ ID NO:3.

Images