Rapid screening model for simulating co-culture of colon organoid and flora

Abstract

The invention discloses a rapid screening model for simulating co-culture of colon-like organs and flora, and belongs to the technical field of in-vitro digestion simulation. The invention provides a rapid screening model for co-culture of colon organoid and intestinal flora, and solves the problem that oxygen demands are difficult to coordinate due to different organoid and intestinal flora. By introducing an oxygen gradient control technology, coexistence of organoids in an aerobic environment and intestinal flora in an anaerobic environment is realized in the same system. The rapid screening model disclosed by the invention can efficiently simulate the intestinal microenvironment, is particularly suitable for researching the influence of flora metabolites on the intestinal microecology, and is widely applied to the fields of intestinal health, drug screening, functional food development and the like.

Description

Technical Field

[0001] The invention relates to a rapid screening model for simulating the co-culture of colon organoids and bacterial flora, and belongs to the technical field of in vitro digestion simulation. Background Art

[0002] In recent years, colon organoids have become an important tool for studying intestinal development, disease, drug screening and other fields. Organoids have a three-dimensional structure, can simulate the physical and biological environment of the intestine in vitro, and show broad application prospects in drug screening and disease model construction. However, the organoid culture system needs to provide an appropriate oxygen environment because colon epithelial cells rely on oxygen for metabolism and to maintain their functions. On the other hand, intestinal flora, especially most anaerobic bacteria in the intestine (such as Bacteroidetes and Clostridium), can only maintain normal growth and metabolism in an anaerobic or hypoxic environment. Therefore, the co-culture of organoids and intestinal flora faces a key challenge, that is, how to meet the different oxygen requirements of organoids and flora in the same system.

[0003] In the existing co-culture technology of organoids and intestinal flora, organoids and flora are often cultured separately, and it is impossible to accurately control the oxygen gradient in the same system. This not only increases the complexity of the operation, but also limits the study of the true interaction between organoids and flora. Due to the lack of coordination and regulation of the different oxygen demands of organoids and flora when they coexist, the flora in the existing system is prone to over-proliferation or impaired organoid function, which leads to deviation or failure of experimental results.

[0004] Therefore, how to achieve the organic combination of the aerobic environment of organoids and the anaerobic environment of intestinal flora in the same culture system has become an unresolved technical gap in this field. Summary of the invention

[0005] To solve the above problems, the present invention provides a rapid screening model that can quickly screen the co-culture of colon organoids and intestinal flora, solving the coordination problem of different oxygen requirements of organoids and intestinal flora. Based on this model, the aerobic environment requirements of organoids and the anaerobic growth conditions of intestinal flora can be met in the same culture system, achieving a more accurate and stable in vitro co-culture environment.

[0006] The first object of the present invention is to provide a model of co-culture of colon organoids and bacterial flora having a three-layer structure, wherein the preparation method of the model is:

[0007] (1) Resuspend organoids in Matrigel, plate them in the upper chamber of Transwell, and culture them;

[0008] (2) mixing methylcellulose, polyethylene glycol diacrylate, mucin, methacrylated gelatin, methacrylated hyaluronic acid, diphenyl (2,4,6-trimethylbenzoyl) phosphine oxide and an intestinal culture medium containing artificial intestinal flora, spreading the mixture on the matrix gel of step (1), and solidifying the mixture to obtain a hydrogel layer;

[0009] (3) In the upper chamber of the Transwell, a colon fermentation solution is added to the surface of the hydrogel layer of step (2); and in the lower chamber of the Transwell, an organoid culture medium is added to obtain a model of co-culture of colon organoids and bacterial flora having a three-layer structure;

[0010] The artificial intestinal flora consisted of Prevotella copri ATCC-33547, Faecalibacterium prausnitzii ATCC-27768, Roseburia faecis Mingzhoubio-B84313, Bifidobacterium longum ATCC-15707, Ruminococcus bromii ATCC-27255, Bifidobacterium adolescentisATCC-15707, Bacteroides uniformis ATCC-25285, Collinsella aerofaciens ATCC-25986, Ruminococcus gnavus ATCC-29149 and Akkermansia muciniphila ATCC-baa-835 according to the number of viable bacteria (10 8 CFU / mL) ratio 0.10~0.30:0.10~0.30:0.05~0.20:0.05~0.20:0.05~0.20:0.005~0.1:0.005~0.1:0.01~0.03:0.01~0.03:0.01~0.03;

[0011] The intestinal culture medium containing artificial intestinal flora is obtained by inoculating the artificial intestinal flora into the intestinal culture medium;

[0012] The colonic fermentation fluid is obtained by inoculating artificial intestinal flora into an intestinal culture medium containing small intestinal digesta and fermenting it.

[0013] In one embodiment, the inoculation amount of the artificial intestinal flora in the intestinal culture medium and colon fermentation solution containing the artificial intestinal flora is 8-15% v / v.

[0014] In one embodiment, the Transwell chamber can be purchased commercially, and the specifications include but are not limited to 6-well plate Transwell, 12-well plate Transwell, 34-well plate Transwell, 96-well plate Transwell; or a container with a Transwell structure; the artificial intestinal flora can be purchased commercially;

[0015] Optionally, the Transwell chamber is a 12-well Transwell plate.

[0016] In one embodiment, the number of organoids in the upper chamber of the Transwell chamber in step (1) is 30 to 40.

[0017] In one embodiment, the culturing in step (1) is carried out in a cell culture incubator for 3 to 5 days.

[0018] In one embodiment, in step (2), the mass ratio of methylcellulose, polyethylene glycol diacrylate, mucin, methacrylated gelatin, methacrylated hyaluronic acid, and diphenyl (2,4,6-trimethylbenzoyl) phosphine oxide is 0.5-1: 8-12: 0.5-1: 0.3-0.8: 0.3-0.8: 0.3-0.8.

[0019] In one embodiment, the thickness of the hydrogel layer in step (2) is 1.5 to 2.5 mm.

[0020] In one embodiment, the number of viable bacteria in the hydrogel layer of step (2) is 0.1 to 10×10 8 CFU.

[0021] In one embodiment, the number of viable bacteria in the colon fermentation solution of step (3) is 0.1 to 10×10 9 CFU.

[0022] In one embodiment, when the experiment is performed in a 12-well plate Transwell chamber, the number of viable bacteria in the hydrogel layer is 1 to 10×10 8 CFU; the number of viable bacteria in colonic fermentation fluid is 1 to 10×10 9 CFU.

[0023] In one embodiment, the method for preparing an intestinal culture medium containing small intestinal digesta is:

[0024] The sample was mixed with simulated oral fluid and CaCl 2 The solution and water were mixed to obtain oral digestive matter; the oral digestive matter was mixed with simulated gastric fluid and CaCl 2solution, gastric lipase, pepsin and water, and stirred to obtain gastric digesta; the gastric digesta and simulated small intestinal fluid were mixed, and CaCl 2 solution, trypsin, pancreatic lipase, bile salts and water, stirring to obtain small intestinal digesta; centrifuging the small intestinal digesta to obtain undigested solid residues and small intestinal digestive fluid, transferring 8-12% v / v of the small intestinal digestive fluid and the undigested solid residues into an intestinal culture medium to obtain an intestinal culture medium containing the small intestinal digesta;

[0025] Among them, samples included starch, whey protein, and fatty acids;

[0026] The simulated oral fluid was composed of KCl, NaHCO 3 , KH 2 PO 4 MgCl 2 6H 2 O、(NH 4 ) 2 CO 3 Prepared with water;

[0027] Simulated gastric fluid is composed of NaCl, KCl, NaHCO 3 , KH 2 PO 4 MgCl 2 6H 2 O、(NH 4 ) 2 CO 3 Prepared with water;

[0028] The simulated small intestinal fluid was composed of NaCl, KCl, NaHCO 3 , KH 2 PO 4 MgCl 2 6H 2 O and water.

[0029] The second object of the present invention is to provide the use of any of the above models in detecting the digestion of polysaccharide-based foods, drug screening or constructing disease models.

[0030] In one embodiment, the polysaccharide-based food includes cereal foods, starch, and resistant starch; optionally, the starch includes but is not limited to corn starch, acetylated starch, propionylated starch, and butyrylated starch.

[0031] In one embodiment, drug screening involves intestinal absorption of drugs.

[0032] In one embodiment, the disease model is an intestinal disease model, including but not limited to inflammatory bowel disease, intestinal infectious diseases, colorectal cancer, intestinal fibrosis model, and diarrhea model.

[0033] The third object of the present invention is to provide any method for simulating colon digestion, wherein a sample is prepared into a model of co-culture of colon organoids and bacterial flora having a three-layer structure, and the simulation lasts for 3 to 24 hours;

[0034] The preparation method of the colon organoid and bacterial flora co-culture model with a three-layer structure comprises:

[0035] (1) Preparation of colonic fermentation solution and intestinal culture medium containing artificial intestinal flora

[0036] The sample was mixed with simulated oral fluid and CaCl 2 The solution and water were mixed to obtain oral digestive matter; the oral digestive matter was mixed with simulated gastric fluid and CaCl 2 solution, gastric lipase, pepsin and water, and stirred to obtain gastric digesta; the gastric digesta and simulated small intestinal fluid were mixed, and CaCl 2 solution, trypsin, pancreatic lipase, bile salts and water, stirring to obtain small intestinal digesta; centrifuging the small intestinal digesta to obtain undigested solid residues and small intestinal digestive fluid, transferring 8-12% v / v of the small intestinal digestive fluid and the undigested solid residues into an intestinal culture medium to obtain an intestinal culture medium containing the small intestinal digesta;

[0037] Among them, samples included starch, whey protein, and fatty acids;

[0038] The simulated oral fluid was composed of KCl, NaHCO 3 , KH 2 PO 4 MgCl 2 6H 2 O、(NH 4 ) 2 CO 3 Prepared with water;

[0039] Simulated gastric fluid is composed of NaCl, KCl, NaHCO 3 , KH 2 PO 4 MgCl 2 6H 2 O、(NH 4 ) 2 CO 3 Prepared with water;

[0040] The simulated small intestinal fluid was composed of NaCl, KCl, NaHCO 3 , KH 2 PO 4 MgCl 2 6H 2 O and water to prepare;

[0041] The artificial intestinal flora is inoculated into an intestinal culture medium containing small intestinal digesta, and the colon fermentation liquid is obtained by fermentation;

[0042] inoculating the artificial intestinal flora into the intestinal culture medium to obtain an intestinal culture medium containing the artificial intestinal flora;

[0043] The artificial intestinal flora consisted of Prevotella copri ATCC-33547, Faecalibacterium prausnitzii ATCC-27768, Roseburia faecis Mingzhoubio-B84313, Bifidobacterium longum ATCC-15707, Ruminococcus bromii ATCC-27255, Bifidobacterium adolescentisATCC-15707, Bacteroides uniformis ATCC-25285, Collinsella aerofaciens ATCC-25986, Ruminococcus gnavus ATCC-29149 and Akkermansia muciniphila ATCC-baa-835 according to the number of viable bacteria (10 8 CFU / mL) ratio 0.10~0.30:0.10~0.30:0.05~0.20:0.05~0.20:0.05~0.20:0.005~0.1:0.005~0.1:0.01~0.03:0.01~0.03:0.01~0.03;

[0044] (2) Preparation of a three-layered colon organoid and bacterial co-culture model

[0045] Organoids are resuspended in matrix gel, spread on the upper chamber of Transwell, and cultured; methylcellulose, polyethylene glycol diacrylate, mucin, methacrylated gelatin, methacrylated hyaluronic acid, diphenyl (2,4,6-trimethylbenzoyl) phosphine oxide and intestinal culture medium containing artificial intestinal flora are mixed, spread on the matrix gel of step (1), and solidified to obtain a hydrogel layer; in the upper chamber of Transwell, colon lysate is added to the surface of the hydrogel layer of step (2); in the lower chamber of Transwell, organoid culture medium is added to obtain a model of co-culture of colon organoids and flora with a three-layer structure.

[0046] Beneficial effects of the present invention:

[0047] The invention effectively coordinates oxygen demand: Through oxygen gradient control, the invention solves the problem of coordinating the different oxygen demands of organoids and intestinal flora, enabling them to be co-cultured for a long time in the same system. This innovative design greatly improves the reliability and accuracy of organoid and flora co-culture experiments.

[0048] The present invention is easy to operate and takes less time: the blue light curing technology is used to complete the curing of the hydrogel layer and model construction in a short time, which greatly shortens the experimental preparation time and simplifies the complex process of co-culturing organoids and bacterial flora.

[0049] The present invention efficiently simulates the in vivo environment: the multi-layer hydrogel structure and oxygen gradient regulation enable organoids and flora to interact more accurately in a simulated in vitro environment, providing an intestinal microenvironment that is closer to physiological conditions, which is suitable for long-term co-culture experiments, and is particularly efficient in intestinal metabolism research.

[0050] The invention has wide applicability, repeatability and accuracy: the rapid screening model is reasonably designed and the experimental structure is stable, which ensures the repeatability and accuracy of the experimental results and reduces the variability between experiments, thereby greatly improving the reliability of the research. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 It is a system concept flow chart of the present invention, showing the culture and differentiation of organoids, the rapid screening model of co-culture of colon organoids and flora, and a schematic diagram of the intestinal mucosal barrier.

[0052] Figure 2 It is a PCA analysis chart of intestinal bacteria of initial bacteria, Example 1, Comparative Example 1, Comparative Example 2, Comparative Example 3, Comparative Example 4(1) and Comparative Example 4(2), showing the changes in the flora under different culture conditions.

[0053] Figure 3 It is a graph showing the relative abundance changes of intestinal bacteria in the initial bacteria, Example 1, Comparative Example 1, Comparative Example 2, Comparative Example 3, Comparative Example 4(1) and Comparative Example 4(2), showing the differences in the abundance of the flora.

[0054] Figure 4 It is a comparison chart of the growth status and bud number of the organoids of Example 1, Comparative Example 3 and Comparative Example 4 after 24 hours of reaction.

[0055] Figure 5 It is a comparison chart of the relative expression levels of Lgr5 in the organoids of Example 1, Comparative Example 3, Comparative Example 4(1), Comparative Example 4(2), Comparative Example 5 and Comparative Example 6 after 24 hours of reaction.

[0056] Figure 6It is a comparison of the Edu staining images and average fluorescence intensity of the organoids of Example 1, Comparative Example 3, Comparative Example 4(1), Comparative Example 4(2), Comparative Example 5 and Comparative Example 6 after 24 hours of reaction.

[0057] Figure 7 It is a comparison of ZO-1 staining images and average fluorescence intensity of the organoids of Example 1, Comparative Example 3, Comparative Example 5 and Comparative Example 6 after 24 hours of reaction.

[0058] Figure 8 It is a comparison of the short-chain fatty acid content of the intestinal flora and organoid rapid screening system of Example 1, Example 2, Example 3 and Example 4 under different starch culture.

[0059] Fig. 9 This is the result of an in vivo verification experiment in mice, comparing the short-chain fatty acid content in feces under different starch culture conditions.

[0060] Fig.10 The intestinal flora and organoid rapid screening system of Example 1, Example 2, Example 3 and Example 4 are compared in terms of the relative abundance of high-acetic acid bacteria (Bifidobacterium longum), propionic acid bacteria (Bacteroides uniformis) and butyric acid (Faecalibacterium prausnitzii) under different starch cultures.

[0061] Fig.11 The results of the in vivo validation experiment in mice show the relative abundance of high-acetic acid-producing bacteria (Bifidobacterium longum), propionic acid bacteria (Bacteroides uniformis) and butyric acid bacteria (Faecalibacterium prausnitzii) in feces under different starch culture conditions. DETAILED DESCRIPTION

[0062] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.

[0063] raw material:

[0064] Intestinal culture medium preparation

[0065] Medium ingredients: 8g corn starch, 4.50g yeast extract, 3g tryptone, 0.43g bile salt No. 3, 4.50g NaCl, 2.50g KCl, 0.40g KH 2 PO 4 、4.50g MgCl 2 6H 2 O, 0.20 g CaCl 2 ·2H2 O, 1.0 mL Tween 80 and 1 L deionized water. After autoclaving at 121 °C for 15 min, 0.5 g mucin, 0.8 g L-cysteine ​​hydrochloride, 0.05 g heme and 2 mL trace element stock solution were added;

[0066] Preparation of trace element stock solution: Formula: 3.0g MgSO 4 7H 2 O, 0.10 g FeSO 4 7H 2 O, 0.10 g CaCl 2 ·2H 2 O, 0.32 g MnCl 2 ·4H 2 O, 0.18 g CoSO 4 7H 2 O, 0.01 g CuSO 4 ·5H 2 O, 0.18g ZnSO 4 7H 2 O, 0.092gNiSO 4 6H 2 O and 1 L of deionized water.

[0067] Methylcellulose, polyethylene glycol diacrylate, mucin, methacrylated gelatin, methacrylated hyaluronic acid, and diphenyl (2,4,6-trimethylbenzoyl) phosphine oxide were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.

[0068] Corn starch can be purchased commercially; acetylated corn starch (prepared from corn starch and acetic anhydride), propionylated corn starch (prepared from corn starch and propionic anhydride), butyrylated corn starch (prepared from corn starch and butyric anhydride).

[0069] Experimental methods:

[0070] 1. Construction of colon organoids

[0071] (1) Culture and proliferation of pluripotent stem cells:

[0072] Human induced pluripotent stem cells (hiPSCs) were cultured using a standard feeder-free culture system, mTeSR1 medium. hiPSCs were cultured in a culture dish coated with Matrigel at 37°C and 5% CO 2 Culture in a controlled environment, and change the culture medium every day; when the confluence of hiPSCs cells reaches 70-80%, dissociate the cells with EDTA solution, gently blow to form a single cell suspension, and re-plated in a culture dish newly coated with Matrigel and continue to culture;

[0073] (2) Directed differentiation into mesoderm:

[0074] When the confluence of hiPSCs cells reaches about 70%, directed differentiation is started; RPMI culture medium containing 10 μM CHIR99021 (Wnt signal agonist) is used to induce cells to differentiate into mesoderm. After culturing for 2 to 3 days, cell morphological changes are observed every day, and the cells will gradually develop mesoderm characteristics.

[0075] (3) Formation of colon-specific precursor cells:

[0076] Continue to culture the mesoderm cells in the basal medium to promote their differentiation into intestinal precursor cells for 3 to 4 days. During this period, replace the medium to ensure that the cells maintain growth.

[0077] (4) Formation of three-dimensional colon organoids:

[0078] After the cells differentiated into colonic progenitor cells, the cells were resuspended in ice-cold Matrigel matrix at an appropriate density (1000-5000 cells / 10 μL) and spotted in the center of a 24-well plate, 55 μL per well; the 24-well plate was inverted and placed in a 37°C incubator for 20 minutes to allow Matrigel to solidify. Using growth medium, continue to incubate at 37°C, 5% CO 2 Culture in an environment. Change the culture medium every 3 days and continue to observe the formation of organoids. After about 10 to 14 days, the organoids begin to form visible structures.

[0079] After 5-7 days of organoid culture, the growth medium was replaced with differentiation medium to promote the differentiation of organoids into mature colon cells.

[0080] The basal culture medium used is one or more of DMEM / F12 or Advanced DMEM / F12 supplemented with 10 mM HEPEs, 2 mM Glutamax, and 100 units / mL Penicillin-streptomycin.

[0081] The growth medium was basal medium supplemented with 0.5nM Wnt3a, B27, N2, 500μM N-acetyl cysteine, 500nM A83-01, 10nM Human-Gastrin, 5nM Prostaglandin E2, 10μM SB 202190, 10mM Nicotinamide, 10μM Y027632 dihydrochloride, 50ng / mL EGF, 500ng / mL R-spondin1, and 100ng / mL Noggin.

[0082] The differentiation medium is a basal medium supplemented with 500 ng / mL R-spondin1, 100 ng / mL Noggin, B27, N2, 500 μM N-acetyl cysteine, 500 μM N-acetyl cysteine, 500 nM A83-01, 50 ng / mL EGF, and 10 nM Human-Gastrin.

[0083] Detection method:

[0084] 1. Detection of intestinal flora abundance

[0085] DNA of intestinal flora was extracted using a DNA purification kit, and the V3-V4 region of the bacterial 16S rRNA gene was PCR amplified using primers 341F (5'-CCTAYGGGRBGCASCAG-3'SEQ ID NO.1) and 806R (5'-GGACTACHVGGGTWTCTAAT-3'SEQ ID NO.2). After the PCR product was detected and purified by 2% agarose gel electrophoresis, it was sequenced using the Novasek6000PE250 platform, and at least 50,000 Raw Data were provided for each sample. The sequencing data was quality controlled using the DADA2 plug-in in QIIME 2.0, including denoising, splicing, and chimera removal, to form amplicon sequencing variants (ASVs). Subsequently, the ASVs were annotated with species using the RDP classifier (http: / / rdp.cme.msu.edu / ), and the Greengenes2 database was used for reference comparison, and the bacterial classification was accurate to the species level to analyze the composition and diversity of the intestinal flora.

[0086] 2. Organoid proliferation detection

[0087] Using BeyoClick TMThe EdU cell proliferation kit (Biyuntian Biotech, Nantong, China) was used to detect the proliferation of colon organoids. Intestinal organoids were incubated with medium containing 10 μmol / L EdU for 12 h, and then the organoids were dissolved and fixed in 4% paraformaldehyde for 30 min. After permeabilization (0.5% Triton X-100 / PBS) for 10 min, the cells were reacted with the reagents in the kit for 30 min. The nuclei were counterstained with DAPI, and the cells were scanned layer by layer using a laser confocal microscope, and the 3D images were reconstructed.

[0088] 3. Organoid dead cell detection

[0089] PI (propidium iodide) staining is used to detect dead cells in colon organoids. First, the organoids after culture are gently washed with PBS to remove the residual culture medium. The organoids are then fixed in 4% paraformaldehyde for 30 minutes. After fixation, 0.5% Triton X-100 / PBS solution is used for cell permeabilization for 10 minutes. Next, the organoids are reacted with 50μg / mL of PI dye for 30 minutes. PI can enter the damaged cell membrane and bind to DNA, thereby marking dead cells. After staining, the sample is washed again with PBS and observed by laser confocal microscopy. Cells positive for PI staining show red fluorescence, representing dead cells or cells with damaged cell membranes.

[0090] 4. Determination of short-chain fatty acids

[0091] Take 100 mg of the sample to be tested (metabolism solution) and place it in a 2 mL EP tube, add an appropriate amount of pure water and vortex to mix. Centrifuge at 5000 r / min for 20 minutes at 4°C, take 0.8 mL of the supernatant and place it in another 2 mL EP tube, add 0.1 mL of 50% H 2 SO 4The solution and 0.8mL of the extract were centrifuged again at 10000r / min for 15 minutes at 4°C. After centrifugation, the sample was allowed to stand at -20°C for 30 minutes. Finally, the supernatant was transferred to an injection bottle and analyzed by gas chromatography-mass spectrometry (GC-MS). The chromatographic conditions were: using an Agilent HP-FFAP capillary column (30m×250μm×0.25μm), the temperature program was 80°C for 1 minute, increased to 200°C at 10°C / min and maintained for 5 minutes, and then increased to 240°C at 40°C / min and maintained for 1 minute; the carrier gas was helium (He), the flow rate was 3mL / min, the injection volume was 1μL, and the split ratio was 5:1. The mass spectrometry conditions were: ionization voltage -70eV, transmission line temperature 240°C, ion source temperature 200°C, quadrupole temperature 150°C, and the mass scanning range was m / z 33-150. The GC-MS method can accurately detect the content of short-chain fatty acids in samples. Prepare a series of short-chain fatty acid standard solutions with known concentrations (for example, 0.01, 0.05, 0.1, 0.5, 1 mM and other concentration gradients. Use GC-MS to detect each standard solution and record the peak area at each concentration. Draw a standard curve based on the linear relationship between concentration and peak area. By comparing the peak area in the sample with the standard curve, calculate the actual concentration of short-chain fatty acids in the sample.

[0092] 5. Real-time fluorescence quantitative polymerase chain reaction experiment

[0093] Colon organoid samples were collected using organoid dissociation solution, and total RNA was extracted from the cells using an RNA extraction kit. The purity of the RNA in the sample was determined using a spectrophotometer to ensure that the absorbance ratio at 260 / 280nm was between 1.8 and 2.0. After the RNA sample was qualified, it was diluted to the same concentration. The extracted RNA was reverse transcribed into cDNA using a cDNA reverse transcription kit. qRT-PCR experiments were performed using a SYBR qPCR Master Mix kit and a real-time fluorescence quantitative PCR instrument. In each sample, β-actin was used as a reference gene to detect the expression of target genes (such as Muc2 and Lgr5). The following primers were used in the qRT-PCR reaction:

[0094] β-actin: front primer: CCACAGCTGAGAGGGAAA (SEQ ID NO.3), back primer: AAGGAAGGCTGGAAAAGAGC (SEQ ID NO.4);

[0095] Muc2: front primer: AGGGCTCGGAACTCCAGAAA (SEQ ID NO.5), back primer: CCAGGGAATCGGTAGACATCG (SEQ ID NO.6);

[0096] Lgr5: front primer: CCTACTCGAAGACTTACCCAGT (SEQ ID NO.7), back primer: GCATTGGGGTGAATGATAGCA (SEQ ID NO.8);

[0097] Pass 2 -ΔΔCt The relative expression of target genes relative to reference genes was calculated by this method, and the expression levels of genes such as Muc2 and Lgr5 in organoids were quantitatively analyzed.

[0098] 6. Data processing

[0099] In all experiments, data were repeated at least 3 times and expressed as mean ± standard deviation (SD). Data analysis was performed using GraphPad Prism 7.0 (GraphPad Prism Software Inc., San Diego, California) software. The comparison between two groups was performed using the bilateral Student's t-test method. For more than two groups, the p value was calculated using the Dunnett's post-hoc testing method in One-way ANOVA. *p<0.05, **p<0.01, ***p<0.001, all compared with the examples.

[0100] Example 1: Colon organoid and bacterial co-culture model

[0101] Schematic diagram as Figure 1 As shown, the culture and differentiation of organoids are shown, and the rapid screening model of colon organoids and co-culture with bacterial flora is developed.

[0102] 1. Preparation of intestinal flora

[0103] The strains were cultured and mixed according to the proportions shown in Table 1. The mixing method was as follows: culture the strains separately until the logarithmic growth phase, collect the cells, resuspend them in sterile PBS, and adjust the number of each cell to 10. 8 CFU / mL, and the artificial intestinal flora was obtained by compounding according to the ratio in Table 1.

[0104] Table 1 Artificial intestinal flora

[0105]

[0106] 2. Preparation of Colonic Digestives

[0107] (1) Oral digestion stage:

[0108] Simulated oral fluid preparation: 1.408g KCl, 1.428g NaHCO 3 , 0.629g KH2 PO 4 、0.038g MgCl 2 6H 2 O, 0.007 g (NH 4 ) 2 CO 3 and 1L of deionized water.

[0109] Sample preparation: Mix 25 mL of sample (0.2 g / mL corn starch solution) with 20 mL of simulated oral fluid and add 125 μL of 0.3 mol / L CaCl 2 The solution was mixed with 4.875 mL of deionized water in a 37°C water bath for 2 min to simulate the mechanical digestion process in the mouth.

[0110] (2) Stomach digestion stage:

[0111] Gastric buffer preparation: 2.808 g NaCl, 0.643 g KCl, 2.625 g NaHCO 3 , 0.153g KH 2 PO 4 、0.031gMgCl 2 6H 2 O, 0.06 g (NH 4 ) 2 CO 3 and 1L of deionized water.

[0112] Gastric digestion reaction: 40 mL of the sample solution after oral digestion was mixed with 40 mL of simulated gastric buffer and 20 μL of 0.3 mol / L CaCl 2 , 20 mg gastric lipase (final concentration 60 U / mL), 2000 mg pepsin (final concentration 2000 U / mL) and 9.475 mL deionized water were mixed.

[0113] The sample was placed in an in vitro digestion system, stirred at 150 r / min, the pH was controlled at 3.0, and digestion was continued at a constant temperature of 37°C for 1 hour.

[0114] (3) Small Intestinal Digestion Stage

[0115] Simulated small intestinal fluid preparation: 3.452g NaCl, 0.634g KCl, 8.952g NaHCO 3 , 0.136g KH 2 PO 4 、0.084gMgCl 2 6H 2 O and 1 L of deionized water.

[0116] Small intestinal digestion reaction: 40 mL of the sample solution after gastric digestion was mixed with 40 mL of simulated small intestinal buffer and 200 μL of 0.3 mol / L CaCl 2 , 90 mg trypsin (final concentration 100 U / mL), 13.35 mg pancreatic lipase (final concentration 2000 U / mL), 1361.90 mg bile salt (final concentration 10 mmol / L) and 56.3 mL deionized water were mixed.

[0117] The sample was placed in an in vitro digestion system, stirred at 150 r / min, the pH was controlled at 7.0, and digested continuously for 2 hours at a constant temperature of 37°C to obtain small intestinal digesta.

[0118] (4) Colonic metabolism simulation

[0119] About 10% of the chyme in the small intestinal digesta is not absorbed. 10% (v / v) of the small intestinal soluble part and the undigested solid residue are used as fermentation substrates. The small intestinal digesta are centrifuged at 4000×g for 10 minutes at 4°C to collect the small intestinal undigested solid residue and 50 mL of the small intestinal digestive fluid (supernatant). 5 mL of the small intestinal digestive fluid and the small intestinal undigested solid residue are added to 300 mL of intestinal culture medium, inoculated with artificial intestinal flora (inoculation amount is 10% v / v), and fermented until the colony forming unit reaches 10 9 CFU / mL.

[0120] The reaction temperature in the fermentation system was maintained at 37°C, and the pH was adjusted to 6.8 using an automatic pH control system, and 1 mol / L NaOH and 0.5 mol / L HCl were used for automatic adjustment. Before fermentation, anaerobic gases (nitrogen, carbon dioxide, and hydrogen) were introduced into the intestinal culture medium to exhaust the air to ensure a strict anaerobic environment, and the bacterial liquid was circulated. At the same time, after 24 hours of fermentation every day, 100 mL of waste liquid was discharged and 100 mL of new intestinal flora culture medium was introduced to maintain normal growth of the flora, and a usable colon fermentation liquid (10 9 CFU / mL).

[0121] 3. Co-culture of colon organoids and microbiota

[0122] Co-culture colon organoids with the bacterial community as follows:

[0123] (1) The differentiated organoids were resuspended in ice-cold Matrigel and seeded in a 12-well Transwell chamber. The chamber was leveled with 30 to 40 organoids per well (100 μL of Matrigel) and incubated at 37°C and 5% CO. 2 Continue to culture for 3 to 5 days under the same environment, changing the culture medium every day;

[0124] (2) By mass fraction (w / w), 0.8% methylcellulose, 10% PEGDA (Poly (ethyleneglycol) diacrylate), 0.8% mucin, 0.5% Gelatin methacryloyl (methacryloyl gelatin), 0.5% Hyaluronic acid methacrylate (methacrylated hyaluronic acid), 0.5% TPO (Diphenyl (2,4,6-trimethylbenzoyl) phosphine oxide)) and 40% intestinal culture medium containing artificial intestinal flora (the inoculation amount of artificial intestinal flora is 10% v / v) were added, and the rest was made up with water to a total volume of 200 μL to form a uniform solution, which was evenly spread on the matrix gel containing mature organoids. Under 405 nm blue light, TPO was used to initiate the cross-linking reaction of PEGDA, GelMA and HAMA. The photocuring time was 4 min to ensure that the hydrogel layer was completely cured on the surface of the organoid matrix to form a stable support layer (where the number of viable bacteria in the hydrogel layer was 10 8 CFU), thickness is about 2mm;

[0125] (3) After the hydrogel solidified, 100 μL of colon lysate was added to the surface of the hydrogel (where the number of viable bacteria in the colon lysate layer was 10 9 CFU) to simulate the intestinal microbial environment and co-culture with the hydrogel and organoids; then, 1000 μL of colon organoid differentiation medium was added to the outermost layer (lower chamber) of the Transwell chamber, so that the lower layer medium supported the growth of the organoids and provided nutrients through the membrane, while the artificial intestinal bacteria in the upper layer were co-cultured with the organoids on the hydrogel surface; the culture medium was kept at 37°C and 5% CO 2 Continue to culture for 24 hours.

[0126] Comparative Example 1: No organ was inoculated into the matrix gel

[0127] On the basis of Example 1, no organ was inoculated into the matrix gel, and the remaining steps were the same as those in Example 1.

[0128] Comparative Example 2: No organoids were placed in the matrix gel and no gel layer was set

[0129] On the basis of Example 1, no organoids were placed in the matrix gel, and no gel layer was provided (ie, the matrix gel was in direct contact with the colon lysate), and the remaining steps were the same as in Example 1.

[0130] Comparative Example 3: No gel layer is provided

[0131] Based on Example 1, no gel layer was provided (ie, the colon lysate was in direct contact with the matrix gel containing the organoids), and the remaining steps were consistent with Example 1.

[0132] Comparative Example 4: Changing the Gel Layer Thickness

[0133] (1) Based on Example 1, the thickness of the gel layer is 1 mm (too thin), and the remaining steps are consistent with Example 1.

[0134] (2) Based on Example 1, the thickness of the gel layer is 3 mm (too thick), and the remaining steps are consistent with Example 1.

[0135] Comparative Example 5: No artificial intestinal flora inoculation

[0136] On the basis of Example 1, no artificial intestinal flora was added to the gel layer and the intestinal culture medium, and the remaining steps were consistent with Example 1.

[0137] Comparative Example 6: No artificial intestinal flora inoculation and no gel layer

[0138] On the basis of Example 1, artificial intestinal flora is not inoculated, and a gel layer is not provided, and the remaining steps are consistent with Example 1.

[0139] The organoid culture conditions of Example 1 and Comparative Examples 1 to 6 are shown in Table 1.

[0140] Table 1

[0141]

[0142]

[0143] Note: “√” indicates yes; “×” indicates no.

[0144] The organoids cultured in Example 1 and Comparative Examples 1 to 4 were tested, and the results were as follows:

[0145] (1) Principal component analysis of intestinal flora

[0146] The principal component analysis of the intestinal flora in Example 1 and other comparative examples is as follows Figure 2As shown, the results show that the flora structure of Example 1 is significantly different from that of Comparative Examples 1 to 4, close to the initial flora, and forms independent clusters, indicating that the presence of organoids and hydrogels significantly affects the flora structure. Although Comparative Example 1 has a hydrogel layer, it lacks organoids, and the flora structure of Example 1 is significantly close to the initial flora structure. In Comparative Example 2, there are neither organoids nor hydrogel layers, and the flora changes are minimal, close to the center. This shows that the coexistence of organoids and hydrogels plays a key role in the regulation of intestinal flora. Compared with the initial flora, the flora distribution of Example 1 did not deviate significantly, and was independent of other comparative groups, forming a more concentrated cluster distribution, indicating that it is superior to other schemes in terms of flora stability.

[0147] (2) Changes in relative abundance of intestinal bacterial species

[0148] The relative abundance changes of different intestinal bacteria species in Example 1, Comparative Example 1 and Comparative Example 2 are as follows: Figure 3 As shown, the results show that in Example 1, the relative abundance of almost all probiotics is significantly higher than that of other control groups, especially Faecalibacterium prausnitzii, Bifidobacterium longum and Roseburia faecis. This shows that the conditions for co-culturing organoids and microbiota in Example 1 promote the reproduction of beneficial bacteria and play a positive role in maintaining the balance of microbiota.

[0149] In contrast, the abundance of probiotics in Comparative Examples 1 and 2 was relatively low, especially in the control group without organoids or hydrogels (Comparative Example 2), where the abundance of multiple key probiotics was significantly reduced. This indicates that the absence of organoids and hydrogel layers weakens the support for intestinal flora, especially the proliferation of important probiotic species. In addition, in Example 1, species such as Akkermansia muciniphila and Bacteroides uniformis, which are critical to intestinal health, also showed significantly higher abundances. Further, the complete organoid-microbiota co-culture system not only helps maintain the diversity of the microbiota, but also promotes the growth and reproduction of beneficial bacteria.

[0150] Compared with the initial flora and the comparative groups, Example 1 showed a significant probiotic growth-promoting effect, and there was a significant difference in the abundance of most bacterial genera compared with the comparative groups (p<0.01). Therefore, Example 1 can not only effectively affect the flora structure, but also significantly increase the abundance of beneficial intestinal bacteria, showing its potential application value in intestinal microecological regulation and can simulate the intestinal environment more realistically.

[0151] (3) Organoid budding results

[0152] Figure 4Figures A and B show the sprouting conditions of Example 1 and Comparative Examples 1 to 6 during the culture stage and the co-culture stage. It can be seen that Example 1 exhibits more abundant sprouting structures during both the culture stage and the co-culture stage, especially compared with Comparative Example 3, Comparative Example 4(1), Comparative Example 4(2), Comparative Example 5 and Comparative Example 6, the sprouting of Example 1 is significantly increased. Figure 4 The data in B further quantified the average number of sprouts in each group, showing that the average number of sprouts in Example 1 was much higher than that in other comparative groups, and reached a statistically significant difference (p<0.01), which shows the advantage of Example 1 in promoting sprout growth.

[0153] The morphology of the organoids in Example 1 was stable and the structure was intact, indicating that the growth of the organoids was well supported under the conditions of co-culture with the hydrogel layer and the flora. In Comparative Example 5, despite the presence of organoids, the number of organoid buds was significantly reduced due to the lack of artificial intestinal bacteria. This indicates that the lack of co-culture conditions with the flora will affect the growth activity of the organoids.

[0154] The number of organoid buds in Comparative Example 6 was the least, and the organoid was relatively flat and incomplete in structure. This was because the co-culture environment of the bacterial hydrogel layer and the bacterial flora was not used, resulting in the lack of stimulation of external growth signals and poor growth of the organoids.

[0155] (4) Lgr5 gene expression

[0156] Lgr5 gene expression Figure 5 As shown, the results show that the expression level of Lgr5 gene in Example 1 is the highest, indicating that under the condition of co-culture of organoids and intestinal flora, the activity of stem cells in organoids is significantly improved. LGR5 is a stem cell marker, and its high expression is usually closely related to the self-renewal of intestinal stem cells and the maintenance of intestinal barrier function. The expression level of LGR5 in Example 1 is significantly higher than that in the control group, and the difference is statistically significant. This result is consistent with the number of buds in the organoid, further confirming the role of the combined action of flora and hydrogel in promoting the maintenance and function of organoid stem cells.

[0157] In Comparative Example 5, the expression of Lgr5 was significantly lower than that in Example 1 and Comparative Example 6, and its Lgr5 expression was the lowest, indicating that in the absence of bacterial flora, the stem cell activity of the organoid was significantly inhibited. This may be due to the lack of external stimulation of bacteria and hydrogel in the organoid, resulting in a decrease in its ability to maintain stem cells.

[0158] Example 1 effectively promoted the expression of LGR5 through the synergistic effect of the gel layer and specific intestinal bacteria, demonstrating the potential of this solution in maintaining intestinal health and promoting intestinal barrier repair.

[0159] (5) Fluorescence intensity of Edu and ZO-1

[0160] The fluorescence intensity of Edu is shown in Figure 6 As shown, the results show that in Example 1, the green fluorescence signal of Edu is relatively strong, showing a higher proliferation activity. The quantitative data of fluorescence intensity show that the average fluorescence intensity of Example 1 is significantly higher than that of Comparative Examples 5 and 6. This indicates that under the condition of co-culture with the bacterial community, the proliferation ability of the organoids is significantly enhanced, and the activity of the organoids is well maintained.

[0161] The fluorescence intensity results of ZO-1 are as follows Figure 7 As shown, the results showed that in Example 1, the green fluorescence signal of ZO-1 was relatively strong, the intestinal barrier function of the organoid was well maintained, and the expression of tight junction protein was significantly higher than that of Comparative Examples 5 and 6.

[0162] The high expression of ZO-1 and EdU in Example 1 indicates that the solution not only helps maintain tight junctions between cells and enhance the integrity of the intestinal barrier, but also significantly promotes cell proliferation, thereby accelerating the renewal of intestinal epithelial cells. These results show that Example 1 has significant advantages in improving intestinal barrier function and supporting cell renewal, further highlighting the application potential of the solution in maintaining intestinal health.

[0163] Therefore, the co-cultured intestinal bacteria in Example 1, especially probiotics, promoted the expression of tight junction proteins in organoids through their metabolites (such as acetate, propionate and butyrate), thereby enhancing the barrier function of organoids.

[0164] Example 2: Use of acetylated corn starch

[0165] On the basis of Example 1, corn starch was replaced by acetylated corn starch, and the remaining steps were consistent with Example 1.

[0166] Example 3: Use of propionylated corn starch

[0167] On the basis of Example 1, corn starch was replaced by propionylated corn starch, and the remaining steps were consistent with Example 1.

[0168] Example 4: Use of butyrylated corn starch

[0169] On the basis of Example 1, corn starch was replaced with butyrylated corn starch, and the remaining steps were consistent with Example 1.

[0170] 1. Detecting short-chain fatty acid levels

[0171] The upper culture medium of the culture chamber after the culture in Examples 1 to 4 was taken to detect the level of short-chain fatty acids.

[0172] The results are as follows Figure 8As shown, the results show that acetylated corn starch (Example 2) significantly promoted the production of acetic acid, while propionylated corn starch (Example 3) significantly increased the production of propionic acid, and butyrylated corn starch (Example 4) promoted the production of butyric acid.

[0173] 2. Verification

[0174] C57BL / 6 male 6-8 week old mice were selected as experimental subjects and randomly divided into four groups, with 6 mice in each group. First, the mice were treated with broad-spectrum antibiotics for one week, including vancomycin (0.5 g / L), ampicillin (1 g / L), neomycin (1 g / L), and metronidazole (1 g / L), and the antibiotics were prepared in drinking water. After the flora was removed, 200 μL of the intestinal flora obtained by compounding in Example 1 was gavaged every day for 7 days; on the 8th day, ordinary corn starch, acetylated corn starch, propionylated corn starch, and butyrylated corn starch were fed respectively.

[0175] The mice were fasted for 12 hours before the experiment and fed with starch solution (normal corn starch, acetylated corn starch, propionylated corn starch and butyrylated corn starch) at a dose of 300 mg / kg body weight by oral gavage according to the group. After feeding, the mice in each group resumed normal diet and were observed for 24 hours. Fecal samples were collected for determination of short-chain fatty acid content.

[0176] The levels of short-chain fatty acids in feces Fig. 9 As shown, the results showed that the content of short-chain fatty acids (acetic acid, propionic acid, butyric acid) in the feces of mice increased after feeding different starches (normal corn starch, acetylated corn starch, propionylated corn starch, butyrylated corn starch).

[0177] It can be seen that acetylated corn starch significantly increased the production of acetic acid, propionylated corn starch specifically promoted the production of propionic acid, and butyrylated corn starch significantly increased the content of butyric acid. This shows that different starch modifications have specific regulatory effects on short-chain fatty acid metabolism, which is consistent with the literature (Insights into the structural, morphological, and thermal property changes in simulated digestion and fermentability of four resistant starches from high amylose maize starch; Type III resistant starch prepared from debranched starch: structural changes under simulated saliva, gastric, and intestinal conditions and the impact on short-chain fatty acid production; Recrystallized resistant starch: structural changes in the stomach, duodenum, and ileum and the impact on blood glucose and intestinal microbiome in mice) reported, and is also consistent with the results of the present invention, which shows the reliability and scientificity of the simulation method of the present invention.

[0178] Fig.10 (Organoid colony culture system in the embodiment) and Fig.11 (mouse in vivo system) showed that the relative abundance of high-acetate-producing bacteria (Bifidobacterium longum), propionic acid bacteria (Bacteroides uniformis) and butyric acid bacteria (Faecalibacterium prausnitzii) increased significantly. Fig.10 It was shown that under organoid culture conditions, the abundance of the three bacterial genera was significantly increased after adding corn starch or different modified starches, especially the bacteria with higher production of acetic acid, propionic acid and butyric acid, which was significantly different from Example 1 (*p<0.001). Fig.11In the experiment, the in vivo mouse experiment also showed a similar trend, and the abundance of the three bacterial genera maintained a consistent upward trend among the groups, further verifying the consistency of the in vivo and in vitro results. That is, the solution of the embodiment can truly reflect the digestive results of the intestine.

[0179] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A model of co-culture of colon organoids and microbiota with a three-layer structure, characterized in that: The preparation method of the model is: (1) Resuspend the organoids in Matrigel, plate them in the upper chamber of the Transwell chamber, and culture them; (2) mixing methylcellulose, polyethylene glycol diacrylate, mucin, methacrylated gelatin, methacrylated hyaluronic acid, diphenyl (2,4,6-trimethylbenzoyl) phosphine oxide and an intestinal culture medium containing artificial intestinal flora, spreading the mixture on the matrix gel of step (1), and solidifying the mixture to obtain a hydrogel layer; (3) In the upper chamber of the Transwell, colon lysate is added to the surface of the hydrogel layer of step (2); In the lower chamber of the Transwell, organoid culture medium was added to obtain a three-layer structure model of co-culture of colon organoids and bacterial flora; The artificial intestinal flora consisted of Prevotella copri ATCC-33547, Faecalibacterium prausnitzii ATCC-27768, Roseburia faecis Mingzhoubio-B84313, Bifidobacterium longum ATCC-15707, Ruminococcus bromii ATCC-27255, Bifidobacterium adolescentis ATCC-15707, Bacteroides uniformis ATCC-25285, Collinsella aerofaciens ATCC-25986, Ruminococcus gnavus ATCC-29149, and Akkermansia muciniphila. ATCC-baa-835 is composed of 0.10-0.30:0.10-0.30:0.05-0.20:0.05-0.20:0.05-0.20:0.005-0.1:0.005-0.1:0.01-0.03:0.01-0.03:0.01-0.03; The intestinal culture medium containing artificial intestinal flora is obtained by inoculating the artificial intestinal flora into the intestinal culture medium; Colonic fermentation fluid is obtained by inoculating artificial intestinal flora into intestinal culture medium containing small intestinal digesta and fermenting it.

2. The model according to claim 1, characterized in that Step (1) The number of organoids in the upper chamber of the Transwell chamber is 30 to 40.

3. The model according to claim 1, characterized in that The step (1) of culturing is carried out in a cell culture incubator for 3 to 5 days.

4. The model according to claim 1, characterized in that In step (2), the mass ratio of methylcellulose, polyethylene glycol diacrylate, mucin, methacrylated gelatin, methacrylated hyaluronic acid, and diphenyl (2,4,6-trimethylbenzoyl) phosphine oxide is 0.5-1: 8-12: 0.5-1: 0.3-0.8: 0.3-0.8: 0.3-0.

8.

5. The model according to claim 1, characterized in that The thickness of the hydrogel layer in step (2) is 1.5 to 2.5 mm.

6. The model according to claim 1, characterized in that The number of viable bacteria in the hydrogel layer of step (2) is 0.1 to 10×10 8 CFU.

7. The model according to claim 1, characterized in that The number of viable bacteria in the colon fermentation solution of step (3) is 0.1 to 10×10 9 CFU.

8. The model according to claim 1, characterized in that The preparation method of intestinal culture medium containing small intestinal digesta is as follows: The sample is mixed with simulated oral fluid, and CaCl2 solution and water are added, and the mixture is mixed to obtain oral digesta; the oral digesta are mixed with simulated gastric fluid, and CaCl2 solution, gastric lipase, pepsin and water are added, and the mixture is stirred to obtain gastric digesta; the gastric digesta are mixed with simulated small intestinal fluid, and CaCl2 solution, trypsin, pancreatic lipase, bile salt and water are added, and the mixture is stirred to obtain small intestinal digesta; the small intestinal digesta are centrifuged to obtain undigested solid residue and small intestinal digestion fluid, and 8-12% v / v of the small intestinal digestion fluid and the undigested solid residue are transferred to an intestinal culture medium to obtain an intestinal culture medium containing the small intestinal digesta; Among them, samples included starch, whey protein, and fatty acids; The simulated oral fluid was prepared from KCl, NaHCO3, KH2PO4, MgCl2·6H2O, (NH4)2CO3 and water; Simulated gastric fluid was prepared from NaCl, KCl, NaHCO3, KH2PO4, MgCl2·6H2O, (NH4)2CO3 and water; The simulated small intestinal fluid was prepared from NaCl, KCl, NaHCO3, KH2PO4, MgCl2·6H2O and water.

9. Use of the model according to any one of claims 1 to 8 in detecting digestion of polysaccharide-based foods, drug screening or constructing disease models.

10. A method for simulating colon digestion, characterized in that: The samples were prepared into a model of co-culture of colon organoids and bacterial flora with a three-layer structure, simulating 3 to 24 hours; The preparation method of the colon organoid and bacterial flora co-culture model with a three-layer structure comprises: (1) Preparation of colonic fermentation solution and intestinal culture medium containing artificial intestinal flora The sample is mixed with simulated oral fluid, and CaCl2 solution and water are added, and the mixture is mixed to obtain oral digesta; the oral digesta are mixed with simulated gastric fluid, and CaCl2 solution, gastric lipase, pepsin and water are added, and the mixture is stirred to obtain gastric digesta; the gastric digesta are mixed with simulated small intestinal fluid, and CaCl2 solution, trypsin, pancreatic lipase, bile salt and water are added, and the mixture is stirred to obtain small intestinal digesta; the small intestinal digesta are centrifuged to obtain undigested solid residue and small intestinal digestion fluid, and 8-12% v / v of the small intestinal digestion fluid and the undigested solid residue are transferred to an intestinal culture medium to obtain an intestinal culture medium containing the small intestinal digesta; Among them, samples included starch, whey protein, and fatty acids; The simulated oral fluid was prepared from KCl, NaHCO3, KH2PO4, MgCl2·6H2O, (NH4)2CO3 and water; Simulated gastric fluid was prepared from NaCl, KCl, NaHCO3, KH2PO4, MgCl2·6H2O, (NH4)2CO3 and water; The simulated small intestinal fluid was prepared from NaCl, KCl, NaHCO3, KH2PO4, MgCl2·6H2O and water; The artificial intestinal flora is inoculated into an intestinal culture medium containing small intestinal digesta, and the colon fermentation liquid is obtained by fermentation; inoculating the artificial intestinal flora into the intestinal culture medium to obtain an intestinal culture medium containing the artificial intestinal flora; The artificial intestinal flora consists of Prevotella copri ATCC-33547, Faecalibacterium prausnitziiATCC-27768, Roseburia faecis Mingzhoubio-B84313, Bifidobacterium longum ATCC-15707, Ruminococcus bromii ATCC-27255, Bifidobacterium adolescentis ATCC-15707, Bacteroides uniformis ATCC-25285, Collinsella aerofaciens ATCC-25986, Ruminococcus gnavus ATCC-29149 and Akkermansia muciniphila ATCC-baa-835 is composed of 0.10-0.30:0.10-0.30:0.05-0.20:0.05-0.20:0.05-0.20:0.005-0.1:0.005-0.1:0.01-0.03:0.01-0.03:0.01-0.03; (2) Preparation of a three-layered colon organoid and bacterial co-culture model Organoids are resuspended in matrix gel, spread on the upper chamber of Transwell, and cultured; methylcellulose, polyethylene glycol diacrylate, mucin, methacrylated gelatin, methacrylated hyaluronic acid, diphenyl (2,4,6-trimethylbenzoyl) phosphine oxide and intestinal culture medium containing artificial intestinal flora are mixed, spread on the matrix gel of step (1), and solidified to obtain a hydrogel layer; in the upper chamber of Transwell, colon lysate is added to the surface of the hydrogel layer of step (2); in the lower chamber of Transwell, organoid culture medium is added to obtain a model of co-culture of colon organoids and flora with a three-layer structure.

Images