Exosome as well as preparation method and application thereof

Abstract

The invention relates to the field of cell biology, and particularly discloses an exosome as well as a preparation method and application thereof. The method for preparing the exosome comprises the following steps: (1) introducing nucleotide sequences for coding a signal peptide TPA and an epidermal growth factor into an AAVS1 region of a host cell, such as a sequence shown in SEQ ID No.9 and a sequence shown in SEQ ID No.10, so as to obtain a modified host cell; and (2) collecting the exosome secreted by the modified host cell. The expression level of EGF mRNA in the exosome can be remarkably improved, so that the obtained exosome has a better effect in skin wound treatment.

Description

Technical Field

[0001] The present invention relates to the technical field of cell biology, and in particular to exosomes and a preparation method and application thereof. Background Art

[0002] Skin damage is caused by mechanical, physical, chemical and biological factors. The process of repairing damage is called tissue repair. Tissue repair can be divided into three stages: the first stage is the local inflammatory response stage, the wound is filled with blood clots, and then an inflammatory response occurs. The main function of this stage is to stop bleeding and seal the wound to reduce infection. The second stage is the stage of cell proliferation and differentiation and the generation of granulation tissue. The blood vessels in the dermis form new vascular buds with the help of matrix and growth factors and extend into the wound to form a new vascular network. During the process of angiogenesis, fibroblasts proliferate rapidly and combine with the cell matrix to form granulation tissue to fill the wound. After the wound heals, it enters the third stage: wound remodeling. In this stage, various tissues, matrices, collagen, blood vessels, etc. involved in the repair are re-adjusted to make them closer to normal skin tissue. Collagen also gradually changes from the previous disordered arrangement to a regular arrangement, allowing the skin to withstand external tension and pressure.

[0003] Human epidermal growth factor (hEGF) is a single-chain small molecule acidic polypeptide composed of 53 amino acids. It has multiple biological functions, including the ability to promote cell proliferation, differentiation and migration, thus playing an important role in organ development and wound repair. hEGF mainly exerts its biological functions by binding to the EGF receptor (EGFR): after binding to EGFR, EGF induces EGFR to form homo- or hetero-dimers, activates receptor tyrosine kinase (RTK), and causes phosphorylation of specific tyrosine residues in the C-terminal structure of EGFR. The phosphorylated tyrosine residues become second messenger molecules, recruiting signaling molecules containing SH2 (Src homology 2) domains and PTB (acidified tyrosine binding) domains for assembly, activating multiple downstream signaling pathways, including Ras / Raf / MEK / MAPK, JAK / STAT, PI3K / AKT and PLCγ / PKC, and participating in cell proliferation, differentiation and migration.

[0004] EGF acts on surrounding cells through autocrine, paracrine, endocrine and other pathways, activates signal pathways, promotes cell proliferation, differentiation and migration, has strong biological activity on epidermal cells, fibroblasts and epithelial cells, and is beneficial to the formation of granulation tissue and epithelialization of skin wounds; in addition, EGF can also increase the synthesis of vascular endothelial growth factor, platelet-derived growth factor, TGF-α and collagen production, accelerating wound healing. Based on the damage repair ability of EGF, EGF has been widely studied in surgical wound repair including diabetic ulcers and burns.

[0005] However, EGF is easily degraded by proteases present in the wound at the wound repair site, resulting in a problem of reduced effective dose. Therefore, it is urgent to explore new materials or carriers to improve the bioavailability of EGF.

[0006] Exosomes are extracellular vesicles with a particle size of 60-200nm, which can be secreted by almost all cells and can contain some complex substances (such as proteins, nucleic acids, peptides, etc.), so they can be used as a medium for intercellular communication. In addition, exosomes can effectively protect the nucleic acid components in them from degradation, and have a good prospect for drug delivery. Summary of the invention

[0007] One of the purposes of the present invention is to provide a method for efficiently preparing exosomes with significantly improved EGF mRNA expression level.

[0008] The present invention provides a method for preparing exosomes, comprising: (1) introducing a nucleotide sequence encoding a signal peptide TPA and epidermal growth factor (EGF) into the AAVS1 region of a host cell, such as between the sequences shown in SEQ ID No. 9 and SEQ ID No. 10, to obtain a transformed host cell; (2) Collecting exosomes secreted by the modified host cells.

[0009] The present invention introduces nucleic acids encoding EGF and specific signal peptides into specific locations of host cells, thereby enabling host cells (monoclonal cell lines expressing epidermal growth factor) to stably express EGF and significantly increase the level of EGF mRNA in their exosomes without affecting the normal physiological activities of the host cells.

[0010] The present invention uses exosomes as carriers for carrying EGF nucleic acid, which can improve the skin permeability of EGF and increase the utilization rate of EGF at the wound site.

[0011] The exosomes prepared by the method of the present invention have the effect of promoting the proliferation and migration of fibroblasts, and are a potential preparation for promoting the proliferation of epidermal cells, providing a new direction for the treatment of chronic and new wounds of the skin and the treatment of burn wounds.

[0012] In the method of the present invention, the nucleotide sequence encoding epidermal growth factor is shown as SEQ ID No.1; the nucleotide sequence encoding signal peptide TPA is shown as SEQ ID No.11.

[0013] In the method of the present invention, the host cell is preferably a 293F cell, which is convenient for industrial production.

[0014] In the method of the present invention, a vector carrying a nucleotide sequence encoding a signal peptide TPA and epidermal growth factor and a vector carrying sgRNA are simultaneously transferred into a host cell to obtain a transformed host cell.

[0015] In the method of the present invention, the nucleotide sequence of the sgRNA is shown as SEQ ID No.8.

[0016] The present invention enables the nucleotide sequence encoding the signal peptide TPA and epidermal growth factor to be introduced into a specific position of the host cell genome through sgRNA.

[0017] As a preferred embodiment, the method for transforming a host cell of the present invention comprises: Using 293F as the mother cell, the target gene TAP-EGF was inserted into a specific site of the AAVS1 region in the 293F genome by gene editing, specifically including the following steps: Step 1: Extract TAP-EGF sequence and construct target gene knock-in plasmid and guide RNA plasmid; Step 2: Transfect cells with 293F cells and the above two plasmids; Step 3: Add antibiotics (puromycin) for screening; Step 4: After two weeks, isolate monoclonal cells by dilution method; Step 5: Extract genomic DNA, design primers on both sides of the insertion site for sequence amplification, and finally perform sequencing analysis to screen monoclonal cell lines with double knock-in on the chromosomes on both sides of the target site.

[0018] In step (2) of the method of the present invention, the transformed host cells are first cultured, and then the exosomes in the culture supernatant are collected.

[0019] As a preferred embodiment, the present invention utilizes the construction method to construct a 293F cell line that stably expresses EGF, then cultures it, collects the supernatant, and then collects the exosomes secreted by the EGF-293F cell line by centrifugation and tangential flow.

[0020] The present invention also provides an exosome, which is prepared by the above method.

[0021] The present invention also provides a pharmaceutical composition, which comprises the above-mentioned exosomes and pharmaceutically acceptable excipients.

[0022] The present invention also provides the use of the above method or exosomes or pharmaceutical composition in the preparation of a product for promoting fibroblast proliferation or inhibiting collagen production or promoting fibroblast migration.

[0023] The present invention also provides the use of the above method or exosomes or pharmaceutical composition in the preparation of a product for promoting skin wound healing.

[0024] The beneficial effects of the present invention are at least: The method for preparing exosomes of the present invention can significantly increase the level of EGF mRNA in exosomes, and theoretically can reduce the batch-to-batch differences in the exosome production process as much as possible, improve stability, and facilitate industrial scale-up.

[0025] The exosomes obtained by the method of the present invention have the effect of promoting the proliferation and migration of fibroblasts and can reduce the production of endogenous collagen, providing a "spot-type" cell-free cell therapy product with wound repair function, and providing a new treatment direction for wound healing. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The results of screening for EGF signal peptides are shown in Figure 1. A is the result of EGFP detection in cell supernatant, and B is the result of EGFP detection in cell lysate.

[0027] Figure 2 This is the TPA-EGF recombinant plasmid map.

[0028] Figure 3 The PCR identification results of TPA-EGF monoclonal cell lines. The two uppermost strips are markers, the middle strip is the identification result of each TPA-EGF monoclonal cell line, and the dotted line frame is the result of PCR identification of the correct monoclonal cell line.

[0029] Figure 4 for Figure 3 Sequencing matching results of monoclonal clone No. 6 in the TPA-EGF region.

[0030] Figure 5 For the isolation and identification of exosomes: A is a schematic diagram of the exosome extraction process; B is the analysis of the exosome particle size; C is the qPCR detection of the RNA level of EGF in the exosomes of the TPA-EGF monoclonal cell line.

[0031] Figure 6The effects of 293F-EGF exosomes on fibroblasts: A, the effect of exosomes on the proliferation of human fibroblasts; B, the effect of exosomes on the production of human collagen; C, the photo of the migration experiment of exosomes on mouse fibroblasts; D, the quantitative analysis result of 48h healing rate, the vertical axis unit is %.

[0032] In the picture (if any), represents < 0.0001, Represents <0.0002, Represents <0.0021, represents <0.0332, t test, ns represents not significant difference. DETAILED DESCRIPTION

[0033] The preferred embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that the following examples are provided only for the purpose of illustration and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0034] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are commercially available or prepared according to conventional methods in the art unless otherwise specified.

[0035] Example 1 Screening of EGF protein secretory peptides

[0036] EGF protein is secreted outside the cell and binds to the receptor EGFR to activate the signal pathway, thereby exerting its biological activity. In order to screen a signal peptide that is more suitable for EGF, this embodiment constructs EGF plasmids connected with different signal peptides: IL2-EGF-EGFP, IL12-EGF-EGFP, TPA-EGF-EGFP. Specifically, IL2 / IL12 / TPA and EGF (sequence shown in SEQ ID No. 1) and EGFP are spliced ​​together by homologous recombination and constructed into the AAVS1 expression vector (same Figure 2 The vector shown in the figure only has the protein expression part replaced accordingly). Among them, the signal peptide is directly connected to EGF with GGGG, and EGF and EGFP are directly connected. The nucleic acid sequences of each signal peptide are as follows: TPA:atggatgcaatgaagagagggctctgctgtgtgctgctgctgtgtggagcagtcttcgtttcgcccagccaggaaatccatgcccgattcagaagaggagccaga (SEQ ID No. 11); IL2:atgtacaggatgcaactcctgtcttgcattgcactaagtcttgcacttgtcacaaacagtgcacctacttcaagttctacaaagaaaacacag (SEQ ID No. 12); IL12: atgtgtcaccagcagttggtcatctcttggttttccctggtttttctggcatctcccctcgtggcc (SEQ ID No. 13).

[0037] In order to more conveniently detect the protein secretion level of EGF, in this embodiment, the EGF protein and the fluorescent protein EGFP are connected in series, and the detection of the secretion level of EGFP can represent the protein secretion level of EGF.

[0038] In this example, equal amounts of the three plasmids were transfected into Vero cells using Lipo3000 transfection reagent. After 24 hours, the cell supernatant was collected and centrifuged at 300g for 5min to remove residual cells. The supernatant after centrifugation was used to quantitatively detect the secreted protein EGFP using the GFP ELISA kit (Cat. No. ab171581). At the same time, the treated cells were added to RIPA cell lysis buffer (500 μl / well) and centrifuged at 12000g for 5min to remove cell debris. The expression level of the intracellular EGFP protein was detected by taking the cell supernatant after lysis. The results are shown in Figure 2. Figure 1 As shown. N-gene-GFP is the control group. N-gene-GFP is a plasmid expressing SARS-CoV-2 nucleocapsid protein and connected to EGFP through GSS, which is used as a positive control for EGFP expression.

[0039] The results of this example show that TPA has the best secretion effect as the signal peptide of EGF, and then TPA-EGF is used as the protein component of the epidermal growth drug of the present invention to exert its efficacy.

[0040] Example 2 Construction of TPA-EGF Stable Cell Line Expression Plasmid and Screening of Monoclonal Cell Lines

[0041] In order to construct a cell line that stably expresses EGF in exosomes, this example constructed a plasmid that stably loaded the TPA-EGF sequence into a specific site in the AAVS1 region of the 293F cell line. The plasmid map is shown in Figure 2 The specific site is located between the sequences shown in SEQ ID No.9 and SEQ ID No.10, and is an open chromosome structure, which can ensure that the transferred gene can be transcribed normally, and at the same time, inserting the exogenous target fragment at this site has no known side effects on the cell.

[0042] In order to obtain a monoclonal stable cell line of TPA-EGF, in this embodiment, the specific implementation plan is as follows: resuscitate the 293F cell line, and the culture conditions of the cell line are as follows: 5% FBS + 1% PS. The donor fragment of the SH200 plasmid in the GeneHero™ Human AAVS1 Safe Harbor Gene Knock-in Kit of Yijin Biotechnology was modified to obtain the stable plasmid AAVS1-TPA-EGF (carrying the TPA-EGF connection sequence described in Example 1) and its corresponding sgRNA plasmid (carrying the sgRNA sequence shown in SEQ ID No. 8). The two were transfected into the 293F cell line by Lipo3000 at a mass ratio of 4:1, and antibiotic selection was performed two days after transfection (puromycin concentration was 2μg / mL). After about two weeks of screening, monoclones were separated by dilution method; about two weeks later, the monoclones were transferred to six-well plates one after another, and the monoclonal genome was extracted for full-length PCR and sequencing identification of the target gene. The PCR product of the correctly inserted monoclonal clone is a single band with a size of 4099bp, as shown in Figure 3 As shown; the PCR identified the correct monoclone and its PCR product was sequenced in full length, and finally the correct sequenced monoclones No. 6 and No. 9 were screened out. The sequencing result of monoclone No. 6 is as follows Figure 4 shown.

[0043] Example 3 Obtaining exosomes from TPA-EGF monoclonal cell line and identifying EGF mRNA

[0044] In this embodiment, 293F and 293F-TPA-EGF monoclonal cell lines were 3D amplified by a 3D culture system. The culture conditions of 293F were: 1% PS, and the culture conditions of 293F-TPA-EGF monoclonal cell lines were: 5% FBS + 1% PS. After about 2 weeks of culture, the volume of the two cells reached 1L, and then the obtained cell suspension was subjected to the following operations: 300g, 10min, take the supernatant; 2000g, 10min, take the supernatant; 10000g, 30min, take the supernatant; and the exosomes were collected by tangential flow chromatographic filtration; finally, the collected exosomes were sterilized by filtration with a 0.22µm filter membrane, and were packaged and freeze-dried for subsequent detection. The separation and purification process is as follows: Figure 5 As shown in A.

[0045] The isolated and purified exosomes were subjected to nanoflow analysis and detection. The results were as follows Figure 5 As shown in B. The results showed that the purity of the isolated and purified exosomes was relatively uniform, and the particle size was mainly distributed between 45nm and 100nm.

[0046] In order to prove whether the exosomes extracted from 293F-TPA-EGF contain EGF mRNA, the total RNA in the two exosomes of 293F and 293F-TPA-EGF obtained above was extracted by TRIZO, and the relative content was detected by fluorescence quantitative PCR, wherein the qPCR primers are as follows, and the qPCR results are as follows: Figure 5 As shown in C. The experimental results show that the exosomes of the 293F-TPA-EGF monoclonal cell line contain higher levels of EGF mRNA.

[0047] p524-qpcr-F2 (SEQ ID No. 2): gcaatgaagagagggctctg; p524-qpcr-R2 (SEQ ID No. 3): atgcacacaccatcatggag.

[0048] Example 4 Effects of exosomes from TPA-EGF monoclonal cell line on fibroblasts

[0049] This example detects the effect of TPA-EGF monoclonal exosomes on fibroblasts at the cellular level. First, this example detects the effect of TPA-EGF exosomes on the proliferation of human skin fibroblasts. The specific implementation plan is as follows: On the first day, cells were plated using a 96-well plate, with 1×10 3 HSF cells were added in triplicate in each group and plated with serum-free medium. The samples were processed on the second day and divided into the following groups: Group 1 (293F-Exo) was added with 1×109 The second group (293F-EGF-Exo) was added with 1×10 9 The 293F-TPA-EGF exosome particles obtained in Example 3; the third group (hEGF), added with EGF protein (10 ng / mL); the fourth group (NC), no other treatment; after 72 hours of treatment, CCK8 detection was performed, and the experimental results are as follows Figure 6 As shown in A: 293F exosomes, 293F-TPA-EGF exosomes, and EGF protein all have the effect of promoting fibroblast proliferation.

[0050] Next, this example detected the effect of EGF exosomes on endogenous collagen production. The specific experimental scheme was as follows: On the first day, 24-well plates were used to plate HSF cells, and cell counts were performed. 6×10 4 The cells were cultured in DMEM high-glucose medium (10% FBS and 1% penicillin-streptomycin solution were added to the medium); on the second day, external stimulation was performed and the medium was replaced with serum-free medium. The specific groups were as follows: Group 1 (293F-Exo) was supplemented with 5×10 9 The second group (293F-EGF-Exo) was added with 5×10 9 The 293F-TPA-EGF exosome particles obtained in Example 3 were added to the third group (hEGF) and the fourth group (NC) without other treatments. After 48 hours of treatment, the total RNA of each sample was extracted and subjected to fluorescence quantitative PCR detection. Each group had three replicate wells and the experiment was repeated three times. The qPCR primers used are as follows: COL1A1-F (Homo): GCTTCACCTACAGCGTCACTGTCG (SEQ ID No. 4); COL1A1-R(Homo): AGAGGAGTTTACAGGAAGCAGACAG (SEQ ID No. 5); COL3A1-F(Homo):CCGATGGGTTGCCAGGATCCATG (SEQ ID No. 6); COL3A1-R(Homo):GAAGGGCATTGTGCTGAACTTGCG (SEQ ID No. 7).

[0051] The experimental results are as follows Figure 6 As shown in B, the results showed that EGF exosomes could significantly inhibit the expression of human COL1A1 and COL3A1.

[0052] This example further examined the effect of EGF exosomes on fibroblast migration. The specific protocol was as follows: On the first day, NIH3T3 cells were plated in a 24-well plate, 2.5×10 5 100 cells / well, serum-free. On the second day, scratches were made on cells, and photos were taken at specific locations to record the changes in scratches (0 h). External stimulation was immediately performed and the groups were divided into the following groups: Group 1 (NC), no treatment; Group 2 (293F-Exo), 2×10 9 / mL 293F exosome particles obtained in Example 3; the third group (293F-EGF-Exo), added 2×10 9 / mL TPA-EGF exosome particles obtained in Example 3; the fourth group (EGF-Protein), added EGF protein (10ng / mL). After 0h, 24h, 48h, and 72h, photos were taken at fixed positions to record the scratch migration. The experimental results at each time point are shown in Figure 6 As shown in C, the unhealed blank area after 0h and 48h was calculated by ImageJ, and the healing rate data after 48h was calculated by the formula: healing rate = (blank area at 0h - blank area at 48h) / blank area at 0h × 100%. The quantitative analysis results of the healing rate at 48h are shown in Figure 6 As shown in D, the results showed that TPA-EGF exosomes have the effect of promoting the migration of mouse fibroblasts and are significantly better than 293F exosomes alone.

[0053] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements may be made thereto based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A method for preparing exosomes, characterized in that: include: (1) introducing the nucleotide sequence encoding the signal peptide TPA and epidermal growth factor into the AAVS1 region of the host cell, such as between the sequences shown in SEQ ID No. 9 and SEQ ID No. 10, to obtain a transformed host cell; (2) Collecting exosomes secreted by the modified host cells.

2. The method according to claim 1, characterized in that: The nucleotide sequence encoding epidermal growth factor is shown in SEQ ID No.1; the nucleotide sequence encoding signal peptide TPA is shown in SEQ ID No.

11.

3. The method according to claim 1 or 2, characterized in that: The host cell is 293F cell.

4. The method according to any one of claims 1 to 3, characterized in that: The transformed host cells are obtained by simultaneously transferring a vector carrying a nucleotide sequence encoding a signal peptide TPA and epidermal growth factor and a vector carrying sgRNA into the host cells.

5. The method according to claim 4, characterized in that The nucleotide sequence of the sgRNA is shown in SEQ ID No.

8.

6. The method according to any one of claims 1 to 5, characterized in that: In step (2), the transformed host cells are first cultured, and then the exosomes in the culture supernatant are collected.

7. An exosome, characterized in that The method is prepared by any one of claims 1 to 6.

8. A pharmaceutical composition, characterized in that Comprising the exosomes according to claim 7 and pharmaceutically acceptable excipients.

9. Use of the method according to any one of claims 1 to 6, the exosomes according to claim 7, or the pharmaceutical composition according to claim 8 in the preparation of a product that promotes fibroblast proliferation, inhibits collagen production, or promotes fibroblast migration.

10. Use of the method according to any one of claims 1 to 6, the exosomes according to claim 7, or the pharmaceutical composition according to claim 8 in the preparation of a product for promoting skin wound healing.

Images