Bacillus licheniformis, polluted water body remediation agent and application of polluted water body remediation agent

Abstract

The invention relates to bacillus licheniformis, a polluted water body remediation agent and application thereof, and belongs to the technical field of microorganisms for sewage treatment. The technical problem to be solved by the invention is to provide the bacillus licheniformis with strong adaptability, high activity and good pollution control effect. The bacillus licheniformis QHAN001 is preserved in the China General Microbiological Culture Collection Center (CGMCC) on June 25, 2024, and the preservation number of the bacillus licheniformis QHAN001 is CGMCC NO.30755. The bacillus licheniformis QHAN001 has the advantages that the bacillus licheniformis QHAN001 can be used for preparing the The bacillus licheniformis QHAN001 disclosed by the invention is applied to laboratory simulated sewage purification and also has a better treatment effect than other similar strains, and the treatment time is shorter, the pollution index digestion is lower, and the treatment effect stability is stronger. Meanwhile, the strain is good in preservation stability, and the survival rate after freeze-drying preservation for one year is still higher than 92%; the culture propagation speed is high, and the CFU (colony-forming unit) of the culture solution can reach 109-1010 pieces / mL within 18 hours at the temperature of 37 DEG C.

Description

Technical Field

[0001] The invention relates to Bacillus licheniformis, a polluted water body repair agent and application thereof, and belongs to the technical field of microorganisms for sewage treatment. Background Art

[0002] Water is the source of all life on Earth. With the development of human society, a large amount of domestic sewage and industrial and agricultural wastewater are discharged into environmental water bodies, causing increasingly serious water pollution problems. In recent years, the urbanization process has been accelerating, the scale of cities has been expanding, the population density has been increasing, the amount of municipal wastewater and low-pollution water has been increasing, and the environmental protection supporting facilities have been delayed and unequal, resulting in frequent water pollution problems. Polluted water bodies lead to the reduction of biological communities, the destruction of biodiversity, and the destruction of the balance of water ecosystems. In urban or urban settlements, domestic sewage and industrial wastewater are concentrated in sewage treatment plants for treatment. The use of bio-enhancement and chemical methods can treat highly polluted sewage to meet the discharge standards before being discharged into rivers. The sewage caused by agricultural non-point source pollution generally flows directly into rivers, lakes and reservoirs, causing water pollution. Most of them are low-pollution inferior water quality, causing the formation of black and smelly water bodies or algal blooms.

[0003] Microorganisms play a very important role as decomposers in water bodies, thus participating in the material cycle, energy cycle and information transmission network of water bodies. Microorganisms can degrade and transform pollutants such as organic matter, heavy metals, toxic and harmful substances through metabolism. Organic matter can be decomposed into harmless substances such as water, carbon dioxide and small molecules; heavy metals can be converted into a stable state, or separated from water bodies by absorption, adsorption and flocculation by microorganisms to reduce harm to the environment; toxic and harmful substances can be decomposed into non-toxic or low-toxic substances. Microorganisms are of various types and widely distributed, reproduce rapidly and in large numbers, have simple structures and are easy to mutate, so they have a very strong ability to adapt to the environment, and are gradually attracting people's attention in the prevention and control of water pollution.

[0004] In the process of using microorganisms to treat water pollution, species such as Bacillus, nitrifying bacteria, yeast, and Pseudomonas are used more frequently. However, it is not easy for these species to survive and reproduce in nature to form dominant populations. The effects of different species in the same water body or the same species in different water bodies are very unstable, and the strains are easily inactivated after preservation. Therefore, it is particularly important to select strains with strong adaptability, high vitality, and good pollution control effects. Summary of the invention

[0005] In view of the above defects, the first technical problem solved by the present invention is to provide a Bacillus licheniformis with strong adaptability, high activity and good pollution control effect.

[0006] The Bacillus licheniformis QHAN001 of the present invention, Latin name: Bacillus licheniformis, is deposited in the General Microbiology Center (CGMCC) of the China Microorganism Culture Collection Administration, the deposit date is June 25, 2024, the deposit number is CGMCC NO.30755, and the deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0007] The second technical problem solved by the present invention is to provide a polluted water body repair agent.

[0008] The polluted water body repairing agent of the present invention contains the above-mentioned Bacillus licheniformis.

[0009] In one embodiment of the present invention, the polluted water body remediation agent is a liquid bacterial agent or a solid bacterial agent.

[0010] The present invention also provides use of the Bacillus licheniformis QHAN001 or the polluted water body repair agent of the present invention in the treatment of polluted water bodies.

[0011] The Bacillus licheniformis QHAN001 of the present invention can be used for the treatment of polluted water bodies.

[0012] In one embodiment of the present invention, the polluted water treatment is to reduce the ammonia nitrogen and nitrite content in the water.

[0013] In one embodiment of the present invention, the concentration of Bacillus licheniformis QHAN001 in the polluted water is controlled to be 1×10 7 CFU / ml and above.

[0014] The present invention also provides application of the Bacillus licheniformis QHAN001 or the polluted water body repair agent of the present invention in ecological restoration.

[0015] The Bacillus licheniformis QHAN001 of the present invention can also be used in ecological restoration. The Bacillus licheniformis QHAN001 of the present invention can be put into polluted water to effectively reduce the ammonia nitrogen and nitrite content in the water, and the bacteria attach to solid objects (such as stones, river walls, aquatic plants, etc.) to form a micro-ecological system.

[0016] Compared with the prior art, the present invention has the following beneficial effects: The Bacillus licheniformis QHAN001 of the present invention has achieved better treatment effects than other similar strains in the purification of laboratory simulated sewage, which is manifested in shorter treatment time, lower pollution index elimination, and stronger treatment effect stability. At the same time, the strain has good storage stability, and the survival rate of freeze-dried storage for one year is still higher than 92%; the culture and reproduction speed is fast, and the CFU of the culture solution at 37°C for 18 hours can reach 10 9 ~10 10Pieces / mL. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is a colony map of Bacillus licheniformis QHAN001 of the present invention.

[0018] Figure 2 This is a microscopic image of the Bacillus licheniformis QHAN001 of the present invention. DETAILED DESCRIPTION

[0019] The Bacillus licheniformis QHAN001 of the present invention, Latin name: Bacillus licheniformis, is deposited in the General Microbiology Center (CGMCC) of the China Microorganism Culture Collection Administration, the deposit date is June 25, 2024, the deposit number is CGMCC NO.30755, and the deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0020] The Bacillus licheniformis QHAN001 of the present invention is isolated and screened from water samples of polluted rivers and lakes. The protease activity and amylase activity of the strain are very high in laboratory tests. It is applied to the purification of laboratory simulated sewage and has achieved better treatment effects than other similar strains, which are manifested in shorter treatment time, lower pollution index elimination, and stronger treatment effect stability. At the same time, the strain has good storage stability, and the survival rate of freeze-dried storage for one year is still higher than 92%; the culture and reproduction speed is fast, and the CFU of the culture solution at 37°C for 18 hours can reach 10 9 ~10 10 Pieces / mL.

[0021] The 16s rDNA gene sequence of Bacillus licheniformis QHAN001 of the present invention is shown as SEQ ID No.1.

[0022] The polluted water body repairing agent of the present invention contains the above-mentioned Bacillus licheniformis.

[0023] In one embodiment of the present invention, the polluted water body remediation agent is a liquid bacterial agent or a solid bacterial agent.

[0024] In one embodiment of the present invention, the polluted water body repair agent further includes an auxiliary material, and the auxiliary material is at least one of corn starch, maltodextrin, corn cob powder, wheat bran powder and bagasse powder.

[0025] The present invention also provides the use of the Bacillus licheniformis QHAN001 or the polluted water body repair agent of the present invention in polluted water body treatment and ecological restoration.

[0026] The Bacillus licheniformis QHAN001 of the present invention can be used for the treatment of polluted water bodies.

[0027] In one embodiment of the present invention, the polluted water treatment is to reduce the ammonia nitrogen and nitrite content in the water.

[0028] The Bacillus licheniformis QHAN001 of the present invention can be directly put into the polluted water body, or it can be prepared into a preparation together with various auxiliary materials and put into the polluted water body. In one embodiment of the present invention, the concentration of Bacillus licheniformis QHAN001 in the polluted water body is ensured to be 1×10 7 CFU / ml and above.

[0029] The Bacillus licheniformis QHAN001 of the present invention can also be used in ecological restoration. The Bacillus licheniformis QHAN001 of the present invention can be put into polluted water to effectively reduce the ammonia nitrogen and nitrite content in the water, and the bacteria attach to solid objects (such as stones, river walls, aquatic plants, etc.) to form a micro-ecological system.

[0030] The specific implementation modes of the present invention are further described below in conjunction with embodiments, but the present invention is not limited to the scope of the embodiments.

[0031] Example 1 Isolation, screening and identification of Bacillus licheniformis QHAN001 1. Isolation and screening of Bacillus licheniformis QHAN001 Take the algae root zone sediment sample from the 15cm depth of the dense black algae in the shallow area of ​​Yueyang River in Anyue County, Sichuan Province, weigh 5g of the sediment and inject it into a 200mL triangular flask containing 95mL of sterilized enrichment medium, and mix it thoroughly. Take 10mL of the mixture into a sterilized 18×180mm test tube with a stopper, pasteurize it in a water bath at 80℃ for 15min, take it out and cool it, and then dilute it in a gradient under sterile conditions.

[0032] Take 1 mL of pasteurized solution and make gradient dilutions. -2 , 10 -3 , 10 -4 Pipette 0.5 mL of the dilution onto the surface of the LB plate, spread it with sterilized glass beads, and then culture it in a constant temperature incubator at 37°C for about 24 h.

[0033] When white wrinkled colonies appear on the plate, select single colonies with sparse colonies and no pollution for Gram staining. For colonies that meet the requirements of Bacillus licheniformis, perform LB plate streaking purification, repeat streaking for more than 3 times, and after at least three single colony selections, it can be determined that the strain has been purified. The purified strain is stored in glycerol, and physiological, biochemical and molecular biological identifications are performed simultaneously. After confirming that the isolated and purified colonies are the target strains, freeze-dried powder is prepared and preserved. The freeze-dried protective agent formula is selected as: 8% sucrose, 6% milk powder, 1% maltodextrin, and 0.05% ascorbic acid.

[0034] A strain of Bacillus licheniformis was screened by this method and named QHAN001. It was deposited in the General Microbiology Center of China Microbiological Culture Collection (CGMCC) with the deposit number CGMCC NO.30755 and the deposit date of June 25, 2024. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. 。

[0035] 2. Identification of Bacillus licheniformis (1) Morphological identification: Through culture observation, the colonies of this strain are off-white, spread out, irregular in shape, with rough edges, flat, opaque, and expanding toward the edges. For details, see Figure 1 The strain is Gram-positive, and the bacteria are straight rod-shaped, arranged singly, in pairs or in short chains. There are spores, which are nearly oval, mesogenetic, and the spore capsules are not swollen. For details, see Figure 2 .

[0036] (2) Molecular biological identification: PCR amplification was performed on the 16S rDNA of the strain, and the primers used for amplification were upstream primer 27F and downstream primer 1492R, wherein the sequence of 27F was AGAGTTTGATCCTGGCTCAG, as shown in SEQ ID No.2; the sequence of 1492R was ACGGCTACCTTGTTACGACTT, as shown in SEQ ID No.3. The amplified product was recovered and sequenced to obtain the 16s rDNA gene sequence of the strain, as shown in SEQ ID No.1.

[0037] The sequence was compared with the sequences registered in the GenBank database for homology. The 16S rDNA sequence of this strain was 100% homologous to that of Bacillus licheniformis.

[0038] The strain QHAN001 was fermented and cultured in the culture medium: 1.5 g / L malt extract powder, 5 g / L glucose, 5 g / L soybean meal powder, 10 g / L soybean powder, 0.5 g / L manganese sulfate, 1.5 g / L magnesium sulfate, 1.5 g / L potassium dihydrogen phosphate, pH 7.2. Culture was carried out in a 300 L fermenter with a filling ratio of 60%, 37°C, aeration volume of 40 L / min, stirring at 300 rpm, and fermentation time of 48 h.

[0039] The number of strains at different times was determined, and the results are shown in Table 1.

[0040] Table 1 Unit: CFU / mL The strain QHAN001 was freeze-dried and stored, and its stability was tested. The results are shown in Table 2.

[0041] Table 2 Unit: CFU / mL Example 2: Purification of wastewater by Bacillus licheniformis QHAN001 A 5 L cylindrical glass cylinder with a diameter of 20 cm was used, which contained 4 L of simulated wastewater. The ammonia nitrogen concentration in the wastewater was 225.23 mg / L and the nitrite concentration was 31.79 mg / L. The bacterial suspension of QHAN001 was inoculated into the cylinder to a final concentration of 10 7 CFU / mL, cultured at room temperature of 24-28℃, starting from the addition of bacterial suspension (0 h), sampling was performed every 12 h to determine the concentration of ammonia nitrogen, and sampling was performed every 6 h to determine the concentration of nitrite. The results are shown in Table 3. Ammonia nitrogen was determined by Nessler's reagent colorimetry, and nitrite was determined by α-naphthylamine colorimetry. Strain C was used as the control group, where strain C was the existing Bacillus licheniformis CGMCC 1.6510 purchased from the China General Microbiological Culture Collection Management Center.

[0042] Table 3 Among them, “ / ” means not detected.

[0043] It can be seen that the strain of the present invention can better digest wastewater and reduce the concentrations of ammonia nitrogen and nitrite in the wastewater. The nitrite concentration can be reduced to 0.33 mg / L after only 24 hours of treatment.

[0044] Example 3 Application of Bacillus licheniformis QHAN001 in ecological restoration The porous materials such as volcanic rocks were used as carriers to attach QHAN001 bacteria for testing, as follows: The "bacteria house" is made of high-temperature sintered porous stone material, using 2.35×10 10 CFU / mL QHAN001 bacterial suspension was soaked and attached to obtain immobilized bacteria-carrying stones, which were used as the bacteria-carrying stone group. 10 The bacteria were soaked and attached to the bacteria suspension of strain C at a concentration of CFU / mL to obtain immobilized bacteria-carrying stones, which served as the positive control group.

[0045] In a 20 cm diameter cylindrical glass tank, 4 L of simulated wastewater was placed inside. Two bacteria-carrying stones (2.5×2.5×9.5 cm) were placed in the tank, and 500 g of water grass (hydrilla) and three 3-4 cm zebrafish were placed in the glass fiber reinforced plastic. A porous stone without bacteria was placed as a blank control group CK. The cells were cultured at room temperature of 24-28°C, and samples were taken once a day to determine the concentrations of ammonia nitrogen and nitrite. The results are shown in Table 4. The determination of ammonia nitrogen was carried out by Nessler's reagent colorimetry, and the determination of nitrite was carried out by α-naphthylamine colorimetry.

[0046] Table 4 It can be seen that the strain of the present invention can attach to solid objects to form a micro-ecosystem, which can be used in ecological restoration to better reduce the concentration of ammonia nitrogen and nitrite in wastewater.

Claims

1. Bacillus licheniformis QHAN001, characterized in that: It is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration (CGMCC), the deposit date is June 25, 2024, and the deposit number is CGMCC NO.30755.

2. A contaminated water restoration agent containing the Bacillus licheniformis according to claim 1.

3. The polluted water restoration agent according to claim 2, characterized in that: The polluted water body repair agent is a liquid bacterial agent or a solid bacterial agent.

4. Use of the Bacillus licheniformis QHAN001 described in claim 1 or the polluted water body repair agent described in claim 2 or 3 in the treatment of polluted water bodies.

5. The use according to claim 4, characterized in that: Adding Bacillus licheniformis QHAN001 into polluted water bodies can reduce the content of ammonia nitrogen and nitrite in the polluted water bodies.

6. The use according to claim 5, characterized in that: The concentration of Bacillus licheniformis QHAN001 in polluted water was controlled to 1×10 7 CFU / ml and above.

7. Use of the Bacillus licheniformis QHAN001 according to claim 1 or the polluted water body repair agent according to claim 2 or 3 in ecological restoration.

Images