Genetically engineered bacterium for producing rhamnolipid as well as construction method and application of genetically engineered bacterium

Abstract

The invention relates to the technical field of genetic engineering, and discloses a genetically engineered bacterium for producing rhamnolipid, a construction method and application, the genetically engineered bacterium comprises a chassis bacterium and a recombinant plasmid which is introduced into the chassis bacterium and satisfies self-replication; the base bacteria are pseudomonas putida rhlAB-rmlBDAC-flag, and the base bacteria are pseudomonas putida rhlAB-rmlBDAC-flag; the recombinant plasmid comprises an rhlAB gene of pseudomonas aeruginosa and one or any combination of more than two of an accA gene, an accBC gene, an accD gene and a fabD gene in a pseudomonas putida genome. The preparation method comprises the following steps: on the basis of pseudomonas putida rhlAB-rmlBDAC-flag, carrying out heterologous overexpression on a rhamnosyl transferase subunit A gene rhlA and a rhamnosyl transferase subunit B gene rhlB from pseudomonas aeruginosa; meanwhile, related enzymes synthesized by precursor substance 3-hydroxyl alkanoyl-3-hydroxyl alkanoate (HAA) in a rhamnolipid synthesis route, namely acetyl coenzyme A carboxyl transferase genes accA, accBC and accD and an acyl carrier protein transacylase gene FabD, are overexpressed, so that the yield of the rhamnolipid is further increased.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and genetic engineering, and relates to a genetic engineering bacterium producing rhamnolipid, a construction method and application thereof in preparing rhamnolipid by microbial fermentation. Background Art

[0002] Rhamnolipids (RL) are produced by Pseudomonas aeruginosa under aerobic conditions by fermentation with a variety of hydrophobic or hydrophilic carbon sources. They are mainly composed of one to two hydrophilic rhamnose units and one to two hydrophobic fatty acid chains. They are a type of biosurfactant with the advantages of being non-toxic, environmentally friendly, biodegradable and biocompatible. They are the biosurfactants with the longest research time and the most mature application technology. They are widely used in industries such as oil extraction, environmental pollution remediation, agriculture, and cosmetics. Therefore, rhamnolipids have excellent properties and broad application prospects.

[0003] Although Pseudomonas aeruginosa has the superior ability to synthesize rhamnolipids at high titers, it is a conditional pathogen with poor biosafety. Burkholderia is another natural rhamnolipid production strain, but its fermentation production is also limited due to its long fermentation period and low rhamnolipid production. To solve this problem, Pseudomonas putida has attracted researchers' attention to rhamnolipid biosynthesis as a safe strain.

[0004] Pseudomonas putida KT2440 is a GRAS-certified environmentally safe model strain of the genus Pseudomonas. It has a clear genetic background, and the biosynthesis process of the product is not affected by cell quorum sensing. It has excellent degradation of environmental pollutants and strong survival ability under harsh conditions. At the same time, it also has the advantage that the biosynthesis process of the product is not affected by cell quorum sensing, which is an ideal cell chassis for the production of rhamnolipids. The synthesis of rhamnolipids depends on three metabolic pathways, namely the synthesis pathway of lipid precursor β-hydroxy fatty acids (HAAs), the synthesis pathway of glycosyl precursor dTDP-L-rhamnose, and the polymerization of lipid precursors and glycosyl precursors to form rhamnolipids. At present, the main problem of using Pseudomonas putida to produce rhamnolipids is that the fermentation yield is not high. The general approach is: the strategy of transforming Pseudomonas putida to produce rhamnolipids through metabolic engineering strategies mainly includes knocking out redundant gene clusters, synthesizing promoter libraries, heterologous expression of rhlAB, and strengthening the supply of precursor dTDP-L-rhamnose. However, metabolically engineered Pseudomonas putida still has certain defects and problems, such as the complexity of the biosynthetic pathway and the insufficient supply of rhamnolipid precursors, which leads to low yields.

[0005] Therefore, there is an urgent need to construct a genetically engineered bacterium that can enable Pseudomonas putida to efficiently express rhamnolipids. Summary of the invention

[0006] In view of this, the present invention proposes a construction method and application of a genetically engineered bacterium producing rhamnolipid. The genetically engineered bacterium producing rhamnolipid provided by the present invention uses Pseudomonas putida rhlAB-rmlBDAC-△flag as the base bacterium, overexpresses the rhlAB gene in the Pseudomonas aeruginosa PAO1 genome and one or more of the accA gene, accBC gene, accD gene, and fabD gene in the Pseudomonas putida genome, and increases the rhamnolipid production in Pseudomonas putida, and the obtained genetically engineered bacteria ferments and prepares rhamnolipid with a higher titer.

[0007] One of the purposes of the present invention is to provide a genetically engineered bacterium for producing rhamnolipid, characterized in that it comprises a base bacterium and a recombinant plasmid introduced into the base bacterium that satisfies self-replication; the base bacterium is Pseudomonas putida rhlAB-rmlBDAC-△flag; the recombinant plasmid comprises the rhlAB gene of Pseudomonas aeruginosa and one or any combination of two or more of the accA gene, accBC gene, accD gene, and fabD gene in the genome of Pseudomonas putida; the nucleotide sequence of the rhlAB gene is shown in SEQ ID NO.1; the nucleotide sequence of the accA gene is shown in SEQ ID NO.2; the nucleotide sequence of the accBC gene is shown in SEQ ID NO.3; the nucleotide sequence of the accD gene is shown in SEQ ID NO.4; the nucleotide sequence of the fabD gene is shown in SEQ ID NO.5.

[0008] As a preferred embodiment of the present invention, the Pseudomonas putida rhlAB-rmlBDAC-△flag is a recombinant strain obtained by overexpressing the rhlAB gene and rmlBDAC gene in Pseudomonas aeruginosa in a mutant strain in which the flag gene cluster in the Pseudomonas putida genome is knocked out.

[0009] As a preferred embodiment of the present invention, the nucleotide sequence of the rmlBDAC gene is shown as SEQ ID NO.6.

[0010] As a preferred embodiment of the present invention, the strain of Pseudomonas putida described in the present invention is Pseudomonas putida KT2440.

[0011] As a preferred embodiment of the present invention, the strain of Pseudomonas aeruginosa described in the present invention is Pseudomonas aeruginosa PA01.

[0012] As a preferred embodiment of the present invention, the recombinant plasmid comprises the rhlAB gene of Pseudomonas aeruginosa PA01 and the accA gene, accD gene and fabD gene in the genome of Pseudomonas putida.

[0013] Alternatively, the recombinant plasmid comprises the rhlAB gene of Pseudomonas aeruginosa PA01 and the accA gene and accBC gene in the genome of Pseudomonas putida.

[0014] Alternatively, the recombinant plasmid comprises the rhlAB gene of Pseudomonas aeruginosa PA01 and the accA gene, accBC gene and accD gene in the genome of Pseudomonas putida.

[0015] Alternatively, the recombinant plasmid comprises the rhlAB gene of Pseudomonas aeruginosa PA01 and the accA gene and accD gene in the genome of Pseudomonas putida.

[0016] The second object of the present invention is to provide a method for constructing a genetically engineered bacterium producing rhamnolipid, comprising the following steps:

[0017] Step 1, preparing Pseudomonas putida rhlAB-rmlBDAC-△flag competent cells;

[0018] Step 2, constructing a recombinant plasmid PMK-AB-accA: using a one-step cloning method to overexpress the rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 and one or any combination of two or more of the accA gene, accBC gene, accD gene, and fabD gene in the genome of Pseudomonas putida in the expression vector pMK to obtain a recombinant plasmid;

[0019] Step 3: Using Pseudomonas putida rhlAB-rmlBDAC-△flag as the base bacteria, overexpressing the recombinant plasmid to obtain a genetically engineered bacterium that produces rhamnolipid.

[0020] As a preferred embodiment of the present invention, the preparation of the rhlAB-rmlBDAC-△flag competent state of Pseudomonas putida in step 1 comprises:

[0021] Step 1) knocking out the flag gene cluster of Pseudomonas putida KT2440 to obtain a gene knockout mutant strain KT2440Δflag;

[0022] Step 2) The rhlAB gene and rmlBDAC gene in Pseudomonas aeruginosa PA01 were overexpressed in the gene knockout mutant strain KT2440△flag to obtain Pseudomonas putida rhlAB-rmlBDAC-△flag.

[0023] As a preferred embodiment of the present invention, the knockout of the flag gene cluster of Pseudomonas putida KT2440 in step 1) is carried out by utilizing homologous recombination.

[0024] Specifically, the genome of Pseudomonas putida KT2440 was used as a template, and the upstream and downstream homologous arm fragments of the flag gene were amplified using primer pairs P7 / P8 and P9 / P10, and then the two fragments were connected by overlapping PCR technology using primers P7 / P10 to obtain a Δflag fragment; the pPribmobsacB vector was double-digested with HindIII and EcoRI, and the Δflag fragment was connected to the pPribmobsacB vector with C115 ligase to obtain a suicide vector pPrib-Δflag; the suicide vector pPrib-Δflag was introduced into Pseudomonas putida KT2440 competent cells by electroporation, and the gene knockout mutant strain KT2440Δflag was obtained by co-screening with gentamicin and ampicillin.

[0025] As a preferred embodiment of the present invention, the step of overexpressing the key gene of Pseudomonas aeruginosa PA01 in the gene knockout mutant in step 2) comprises:

[0026] The rmlBDAC gene was amplified by PCR using primer pair P21 / P22 with P. aeruginosa PAO1 as template;

[0027] Using pBBRIMCS-AB-rmlBDAC vector as template, primer pair P23 / P24 was used to PCR amplify the vector backbone pBBRIMCS-rhlAB-P46, which was then electroporated into the competent gene knockout mutant strain KT2440Δflag after one-step cloning to obtain the genetically engineered bacteria rhlAB-rmlBDAC-Δflag.

[0028] As a preferred embodiment of the present invention, in step 3, Pseudomonas putida rhlAB-rmlBDAC-Δflag is used as the base bacteria to overexpress the recombinant plasmid, including:

[0029] The step of preparing Pseudomonas putida rhlAB-rmlBDAC-△flag competent cells; and

[0030] The step of electroporating the correctly sequenced recombinant plasmid into rhlAB-rmlBDAC-△flag competent cells of Pseudomonas putida at a voltage of 1.2-1.5 kV.

[0031] Specifically, the genetically engineered bacteria include:

[0032] The accA gene in the genome of Pseudomonas putida KT2440 and the rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 were overexpressed in the expression vector pMK, and the vector was introduced into the genetically engineered bacteria accA-pu obtained by Pseudomonas putida rhlAB-rmlBDAC-△flag;

[0033] The accBC gene in the genome of Pseudomonas putida KT2440 and the rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 were overexpressed in the expression vector pMK, and the vector was introduced into the genetically engineered bacteria accBC-pu obtained by Pseudomonas putida rhlAB-rmlBDAC-△flag;

[0034] The accD gene in the genome of Pseudomonas putida KT2440 and the rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 were overexpressed in the expression vector pMK, and the vector was introduced into the genetically engineered bacteria accD-pu obtained by Pseudomonas putida rhlAB-rmlBDAC-△flag;

[0035] The fabD gene in the genome of Pseudomonas putida KT2440 and the rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 were overexpressed in the expression vector pMK, and the vector was introduced into the genetically engineered bacteria fabD-pu obtained by Pseudomonas putida rhlAB-rmlBDAC-△flag;

[0036] The accA and accBC genes in the genome of Pseudomonas putida KT2440 and the rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 were overexpressed in the expression vector pMK, and the vector was introduced into the genetically engineered bacteria accABC-pu obtained by Pseudomonas putida rhlAB-rmlBDAC-△flag;

[0037] The accA, accBC and accD genes in the genome of Pseudomonas putida KT2440 and the rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 were overexpressed in the expression vector pMK, and the vector was introduced into the genetically engineered bacteria accABCD-pu obtained by Pseudomonas putida rhlAB-rmlBDAC-△flag;

[0038] Overexpressing the accA and accD genes in the genome of Pseudomonas putida KT2440 and the rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 in the expression vector pMK, and introducing the vector into the genetically engineered bacteria accAD-pu obtained by Pseudomonas putida rhlAB-rmlBDAC-△flag; and / or

[0039] The accA, accD and fabD genes in the genome of Pseudomonas putida KT2440 and the rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 were overexpressed in the expression vector pMK, and the vector was introduced into the genetically engineered bacteria accAD-fabD-pu obtained by Pseudomonas putida rhlAB-rmlBDAC-△flag.

[0040] As a preferred embodiment of the present invention, the method of co-introducing the accA gene in the genome of Pseudomonas putida KT2440 and the rhlAB gene of Pseudomonas aeruginosa PA01 into the strain Pseudomonas putida rhlAB-rmlBDAC-△flag is:

[0041] Using the genome of Pseudomonas aeruginosa PAO1 as a template, primers P1 and P2 were used as primers to amplify the rhlAB gene fragment, primers P3 and P4 were used as primers to amplify the accA gene fragment and the expression plasmid pMK (the expression plasmid pMK needs to be double-digested with EcoRI and KpnI in advance) for one-step cloning;

[0042] The recombinant plasmid after one-step cloning was electroporated into the electroporation competent Pseudomonas putida rhlAB-rmlBDAC-△flag.

[0043] As a preferred embodiment of the present invention, the method of co-introducing the accBC gene in the genome of Pseudomonas putida KT2440 and the rhlAB gene of Pseudomonas aeruginosa PA01 into the strain Pseudomonas putida rhlAB-rmlBDAC-△flag is:

[0044] Using the genome of Pseudomonas aeruginosa PAO1 as a template, primers P1 and P2 were used as primers to amplify the rhlAB gene fragment, and primers P5 and P6 were used as primers to amplify the accBC gene fragment, which were cloned into the expression plasmid pMK (the expression plasmid pMK needed to be double-digested with EcoRI and KpnI in advance) in one step;

[0045] The recombinant plasmid after one-step cloning was electroporated into the electroporation competent Pseudomonas putida rhlAB-rmlBDAC-△flag.

[0046] As a preferred embodiment of the present invention, the method of co-introducing the accD gene in the genome of Pseudomonas putida KT2440 and the rhlAB gene of Pseudomonas aeruginosa PA01 into the strain Pseudomonas putida rhlAB-rmlBDAC-△flag is:

[0047] Using the genome of Pseudomonas aeruginosa PAO1 as a template, primers P1 and P2 were used as primers to amplify the rhlAB gene fragment, primers P7 and P8 were used as primers to amplify the accD gene fragment and the expression plasmid pMK (the expression plasmid pMK needs to be double-digested with EcoRI and KpnI in advance) for one-step cloning;

[0048] The recombinant plasmid after one-step cloning was electroporated into the electroporation competent Pseudomonas putida rhlAB-rmlBDAC-△flag.

[0049] As a preferred embodiment of the present invention, the fabD gene in the genome of Pseudomonas putida KT2440 and the rhlAB gene of Pseudomonas aeruginosa PA01 are co-introduced into the strain Pseudomonas putida rhlAB-rmlBDAC-△flag by: using the genome of Pseudomonas aeruginosa PAO1 as a template, using primers P1 and P2 as primers to amplify the rhlAB gene fragment, using primers P9 and P10 as primers to amplify the fabD gene fragment and the expression plasmid pMK (the expression plasmid pMK needs to be double-digested with EcoRI and KpnI in advance) for one-step cloning;

[0050] The recombinant plasmid after one-step cloning was electroporated into the electroporation competent Pseudomonas putida rhlAB-rmlBDAC-△flag.

[0051] As a preferred embodiment of the present invention, the method of co-introducing the accA gene and accBC gene in the genome of Pseudomonas putida KT2440 and the rhlAB gene of Pseudomonas aeruginosa PA01 into the strain Pseudomonas putida rhlAB-rmlBDAC-△flag is:

[0052] Using the genome of Pseudomonas aeruginosa PAO1 as a template, primers P1 and P2 were used to amplify the rhlAB gene fragment, primers P3 and P11 were used to amplify the accA gene fragment, and primers P12 and P6 were used to amplify the accBC gene fragment and the expression plasmid pMK (the expression plasmid pMK needs to be double-digested with EcoRI and KpnI in advance) for one-step cloning;

[0053] The recombinant plasmid after one-step cloning was electroporated into the electroporation competent Pseudomonas putida rhlAB-rmlBDAC-△flag.

[0054] As a preferred embodiment of the present invention, the method of introducing the accA gene, accBC gene, accD gene in the genome of Pseudomonas putida KT2440 and the rhlAB gene of Pseudomonas aeruginosa PA01 into the strain Pseudomonas putida rhlAB-rmlBDAC-△flag is as follows:

[0055] Using the genome of Pseudomonas aeruginosa PAO1 as a template, primers P1 and P2 were used as primers to amplify the rhlAB gene fragment, primers P3 and P11 were used as primers to amplify the accA gene fragment, primers P12 and P13 were used as primers to amplify the accBC gene fragment, and primers P14 and P8 were used as primers to amplify the accD gene fragment and the expression plasmid pMK (the expression plasmid pMK needs to be double-digested with EcoRI and KpnI in advance) for one-step cloning;

[0056] The recombinant plasmid after one-step cloning was electroporated into the electroporation competent Pseudomonas putida rhlAB-rmlBDAC-△flag.

[0057] As a preferred embodiment of the present invention, the method of introducing the accA gene and accD gene in the genome of Pseudomonas putida KT2440 and the rhlAB gene of Pseudomonas aeruginosa PA01 into the strain Pseudomonas putida rhlAB-rmlBDAC-△flag is as follows:

[0058] Using the genome of Pseudomonas aeruginosa PAO1 as a template, primers P1 and P2 were used as primers to amplify the rhlAB gene fragment, primers P3 and P15 were used as primers to amplify the accA gene fragment, and primers P16 and P8 were used as primers to amplify the accD gene fragment and the expression plasmid pMK (the expression plasmid pMK needs to be double-digested with EcoRI and KpnI in advance) for one-step cloning;

[0059] The recombinant plasmid after one-step cloning was electroporated into the electroporation competent Pseudomonas putida rhlAB-rmlBDAC-△flag.

[0060] As a preferred embodiment of the present invention, the method of introducing the accA gene, accD gene, fabD gene in the genome of Pseudomonas putida KT2440 and the rhlAB gene of Pseudomonas aeruginosa PA01 into the strain Pseudomonas putida rhlAB-rmlBDAC-△flag is as follows:

[0061] Using the genome of Pseudomonas aeruginosa PAO1 as a template, primers P1 and P2 were used as primers to amplify the rhlAB gene fragment, primers P3 and P15 were used as primers to amplify the accA gene fragment, primers P16 and P17 were used as primers to amplify the accD gene fragment, and primers P18 and P10 were used as primers to amplify the fabD gene fragment and the expression plasmid pMK (the expression plasmid pMK needs to be double-digested with EcoRI and KpnI in advance) for one-step cloning;

[0062] The recombinant plasmid after one-step cloning was electroporated into the electroporation competent Pseudomonas putida rhlAB-rmlBDAC-△flag.

[0063] The third object of the present invention is to provide an application of a genetically engineered bacterium in the preparation of rhamnolipids by microbial fermentation.

[0064] Preferably, the application includes the following steps: the application includes the following steps: streaking the genetically engineered bacteria on an LB plate containing gentamicin, ampicillin and kanamycin, culturing until a single colony grows, picking a single colony and inoculating it into an LB liquid culture medium containing gentamicin, ampicillin and kanamycin, and culturing it overnight at 30°C and 200rpm as a seed solution; inoculating the seed solution into a fermentation medium at an inoculum concentration of 2% by volume, fermenting and culturing it under the conditions of natural pH and temperature of 30°C, taking the fermentation liquid, and separating and purifying rhamnolipid; wherein the final concentration of kanamycin in the culture medium is 0.05 mg / L; the final concentration of gentamicin in the culture medium is 0.025 mg / L, and the final concentration of ampicillin in the culture medium is 0.1 mg / L; the fermentation culture medium is composed of: 10 g / L glucose, 5 g / L yeast extract, 10 g / L peptone, 10 g / L sodium chloride, the solvent is deionized water, and the pH value is natural.

[0065] The present invention further improves the yield of rhamnolipid by heterologously overexpressing rhamnosyltransferase subunit A gene rhlA and rhamnosyltransferase subunit B gene rhlB from Pseudomonas aeruginosa on the basis of Pseudomonas putida rhlAB-rmlBDAC-△flag; and simultaneously overexpressing the related enzymes for the synthesis of precursor substance 3-hydroxyalkanoyl-3-hydroxyalkanoate (HAA) in the rhamnolipid synthesis pathway, namely acetyl-CoA carboxyltransferase accA gene, accBC gene, accD gene and acyl carrier protein transacylase fabD gene. In the metabolism of the strain, there is a nonlinear association between different metabolic pathways, as well as the competition and cooperation relationship between the cofactor and the main metabolic pathway. The genetically engineered bacteria accA-pu, accBC-pu, accD-pu and fabD-pu for improving rhamnolipid production provided by the present invention have improved production compared with the control genetically engineered strain rhlAB-rmlBDAC-△flag, so the accA gene, accBC gene, accD gene and fabD gene are combined and overexpressed.

[0066] Compared with the prior art, the present invention has the following technical effects:

[0067] (1) The present invention further improves the production of rhamnolipid by heterologously overexpressing rhamnosyltransferase subunit A gene rhlA and rhamnosyltransferase subunit B gene rhlB from Pseudomonas aeruginosa PAO1 on the basis of Pseudomonas putida rhlAB-rmlBDAC-△flag; and simultaneously overexpressing the related enzymes for the synthesis of the precursor substance 3-hydroxyalkanoyl-3-hydroxyalkanoate (HAA) in the rhamnolipid synthesis pathway, namely acetyl-CoA carboxyltransferase accA, accBC, accD and acyl carrier protein transacylase fabD;

[0068] (2) The genetically engineered bacterium accABC-pu for increasing rhamnolipid production provided by the present invention increases the supply of HAA, a precursor for rhamnolipid synthesis, by overexpressing accA and accBC genes, thereby increasing the production of rhamnolipid by 2.24 times compared with that of Pseudomonas putida rhlAB-rmlBDAC-△flag;

[0069] (3) The genetically engineered bacteria accABCD-pu for producing rhamnolipids provided by the present invention increases the overexpression of the accD gene on the basis of accABC-pu, so that the production of rhamnolipids is increased by 1.85 times compared with that of Pseudomonas putida rhlAB-rmlBDAC-△flag;

[0070] (4) The genetically engineered bacteria accAD-pu for producing rhamnolipids provided by the present invention deleted the overexpression of the accBC gene on the basis of accABCD-pu, so that the production of rhamnolipids was increased by 2.5 times compared with that of Pseudomonas putida rhlAB-rmlBDAC-△flag;

[0071] (5) The genetically engineered bacteria accAD-fabD-pu for improving rhamnolipid production provided by the present invention increases the overexpression of the fabD gene on the basis of accAD-pu, thereby further improving the rhamnolipid production in Pseudomonas putida KT2440, which is 2.93 times higher than that of Pseudomonas putida rhlAB-rmlBDAC-△flag;

[0072] (6) The genetically engineered bacteria provided by the present invention are applied to the production of rhamnolipids by microbial fermentation, and have the characteristics of high yield, cheap substrate, and easy separation, and have industrial prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0073] Figure 1 Schematic diagram of the synthesis pathway and modification of rhamnolipids in Pseudomonas putida;

[0074] Figure 2 is the OD of accA-pu in Example 1 of the present invention 600and rhamnolipid content and titer comparison of the control strain rhlAB-rmlBDAC-△flag;

[0075] Figure 3 is the OD of accBC-pu in Example 2 of the present invention 600 and rhamnolipid content and titer comparison of the control strain rhlAB-rmlBDAC-△flag;

[0076] Figure 4 is the OD of accD-pu in Example 3 of the present invention 600 and rhamnolipid content and titer comparison of the control strain rhlAB-rmlBDAC-△flag;

[0077] Figure 5 is the OD of fabD-pu in Example 4 of the present invention 600 and rhamnolipid content and titer comparison of the control strain rhlAB-rmlBDAC-△flag;

[0078] Figure 6 is the OD of accABC-pu in Example 5 of the present invention 600 and rhamnolipid content and titer comparison of the control strain rhlAB-rmlBDAC-△flag;

[0079] Figure 7 is the OD of accABCD-pu in Example 6 of the present invention 600 and rhamnolipid content and titer comparison of the control strain rhlAB-rmlBDAC-△flag;

[0080] Figure 8 is the OD of accAD-pu in Example 7 of the present invention 600 and rhamnolipid content and titer comparison of the control strain rhlAB-rmlBDAC-△flag;

[0081] Figure 9 is the OD of accAD-fabD-pu in Example 8 of the present invention 600 and rhamnolipid content and titer comparison of the control strain rhlAB-rmlBDAC-△flag;

[0082] Figure 10 The gel images are of all gene amplifications in Examples 1-8 of the present invention.

[0083] Figure 11 This is a gel image of the PCR verification of the accA-pu, accBC-pu, accD-pu, and fabD-pu colonies in Examples 1-4 of the present invention.

[0084] Figure 12 This is a gel image of colony PCR verification of accABC-pu, accABCD-pu, accAD-pu, and accAD-fabD-pu in Examples 5-6 of the present invention. DETAILED DESCRIPTION

[0085] The following describes the embodiments of the present invention through specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.

[0086] It should be noted that the process equipment or devices not specifically specified in the following embodiments are all conventional equipment or devices in the art.

[0087] In addition, it should be understood that one or more method steps mentioned in the present invention do not exclude the existence of other method steps before or after the combination step or the insertion of other method steps between these explicitly mentioned steps, unless otherwise specified; it should also be understood that the combination connection relationship between one or more devices / apparatuses mentioned in the present invention does not exclude the existence of other devices / apparatuses before or after the combination device / apparatus or the insertion of other devices / apparatuses between these explicitly mentioned two devices / apparatuses, unless otherwise specified. Moreover, unless otherwise specified, the numbering of each method step is only a convenient tool for identifying each method step, and is not intended to limit the order of arrangement of each method step or the scope of the present invention. Changes or adjustments in their relative relationships should also be regarded as the scope of the present invention without substantially changing the technical content.

[0088] The present invention will be further described below in conjunction with the embodiments.

[0089] The starting strains of the present invention, Pseudomonas putida KT2440, Pseudomonas aeruginosa PAO1, vector pBBRIMCS and pMK vector were all purchased from Hangzhou Hongsai Biotechnology Co., Ltd. In the following examples, the final concentration of kanamycin in the culture medium was 0.05 mg / L; the final concentration of gentamicin in the culture medium was 0.025 mg / L, and the final concentration of ampicillin in the culture medium was 0.1 mg / L.

[0090] The primer sequence information used in Examples 1-8 is shown in Table 1.

[0091] Table 1

[0092] Primer Name Sequence (5’-3’) P1 ACGACGGCCAGTGCCAAGCTTCAGATTGATCTGCCGCAACC P2 TTGTCGAGTGCCTCATCGCTCCCCCGTGTATAAAGGACGT P3 ACGTCCTTTATACACGGGGGAGCGATGAGGCACTCGACAA P4 CTATGACCATGATTACGAATTCAAGATGCTGGCAGCCGAGAA P5 CCATGGACGTAACCGGGTAG P6 GCTTCGACTGCGAGTCGAAG P7 AACGACGGCCAGTGCCAAGCTTAACAGCAGGATGAGCATGGACG P8 GATTGTATACAACCTGTCGAGCCCG P9 CGGGCTCGACAGGTTGTATACAATCCGCGAGTCCTCTTGATGCAAA P10 CTATGACCATGATTACGAATTCCATTTGCTATTGCAGCACGAGAGGA P11 CCGGCTTTTCGGTAAGGGTGA P12 ATTCGTCCAGGCCATCGCTC P13 CGACGGTATCGATAAGCTTGATGCGGCGCGAAAGTCTGTT P14 CCGCGGTGGCGGCCGCTCTAGATCAGGACGCAGCCTTCAGCCA P15 TAAGGAGGTTTTCTAATGGCCCACCTGGT P16 TCAGAACGGCAGTTGCAGCTCAGG P17 GATGGCTGAAGGCTGCGTCCTGAAGGCCCTTCTCCAGTTTTTCTTCT P18 ACCAGGTGGGCCATTAGAAAACCTCCTTAGCCGTTTTCCTCGCAGGCTG P19 CCTGAGCTGCAACTGCCGTTCTGATCTAGAGCGGCCGCCACCGC P20 TCAGGACGCAGCCTTCAGCCATC P21 GGAAAACGGCTAAGGAGGTTTTCTAATGACGATTCTCGTGACCGGCAG P22 TCAGGGGAAGCAGTCGGCGT P23 ACGCCGACTGCTTCCCCTGATCTAGAGCGGCCGCCACCGC P24 TAGAAAACCTCCTTAGCCGTTTTCC

[0093] In the following examples, the rhamnolipid content was determined by UHPLC detection, and the specific detection method is as follows:

[0094] (1) Chromatographic conditions: C18 column (150×4.6 mm, particle size 3 μm, Thermo Fisher Scientific Inc., Waltham, MA, USA), electrospray ionization detector;

[0095] (2) Mobile phase: acetonitrile, 0.2% formic acid (v / v);

[0096] (3) Instrumental method: within 1 to 9 minutes, the acetonitrile concentration was linearly increased from 70% to 100%, and within 11 to 12 minutes, the acetonitrile concentration was linearly decreased from 100% to 70%, column temperature: 40°C;

[0097] (4) Data collection time: 15 minutes.

[0098] In the following examples, the culture medium composition is as follows:

[0099] LB liquid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, the solvent is tap water, and the pH value is natural.

[0100] LB plates were prepared by adding 16 g / L agar to LB liquid medium.

[0101] LBS solid culture medium: 10g / L peptone, 5g / L yeast extract, 10g / L NaCl, 100g / L sucrose, 4g / L agar, the solvent is tap water, and the pH value is natural.

[0102] Fermentation medium: glucose 10g / L, yeast extract 5g / L, peptone 10g / L, sodium chloride 10g / L, solvent is deionized water, pH value is natural.

[0103] In the embodiment of the present invention, the added concentrations of kanamycin (Kan), ampicillin (Amp), and gentamicin (Gm) are 25 mg / L, 100 mg / L, and 25 mg / L, respectively.

[0104] The chassis bacteria Pseudomonas putida rhlAB-rmlBDAC-△flag in the present application is obtained by referring to the preparation method in Chinese invention patent CN117511841A.

[0105] Example 1: Construction of genetically engineered bacteria AccA-pu

[0106] S1, preparation of rhlAB-rmlBDAC-△flag competent cells of the bottom bacteria Pseudomonas putida;

[0107] Pseudomonas putida rhlAB-rmlBDAC-△flag was streaked on LB solid medium and cultured at 30°C overnight. A single colony was picked and inoculated into 10 ml LB liquid medium. After culturing at 30°C and 200 rpm for 12 h, 2% inoculum was inoculated into 50 ml LB liquid medium by volume and cultured at 30°C and 200 rpm until OD 600 =0.7~1.4, and immediately put it in ice bath for 20 minutes. Transfer the bacterial solution to a pre-cooled 50ml sterile centrifuge tube and centrifuge it at 5000rpm for 10 minutes, discard the supernatant, resuspend it with 20ml pre-cooled HEPES buffer, centrifuge it at 5000rpm for 10 minutes, repeat the washing three times, and finally resuspend it with 1ml10% glycerol and dispense it into sterile 1.5ml EP tubes, 100μL per tube, and store it at -80℃.

[0108] S2. Construction of recombinant plasmid PMK-AB-accA:

[0109] Using primer pair P1 / P2, the rhlAB gene (nucleotide sequence is shown in SEQ ID NO.1) was amplified by PCR using Pseudomonas aeruginosa PAO1 bacterial solution as a template, and using primer pair P3 / P4, the accA gene (nucleotide sequence is shown in SEQ ID NO.2) was amplified by PCR using Pseudomonas putida KT2440 bacterial solution as a template. The PCR reaction system refers to Table 2 in Example 1, and the PCR program refers to Table 3 in Example 1; the pMK plasmid was digested with EcoRI and KpnI, and then the rhlAB gene, accA gene and pMK (EcoRI, KpnI) were connected with C115 of Vazyme Company, and sequencing was verified to obtain the recombinant plasmid PMK-AB-accA.

[0110] Table 2 Components of gene amplification PCR system

[0111] Component Dosage Template (PAO1 Genome) 1 μL Forward Primer (10 μM) 1 μL Reverse Primer (10 μM) 1 μL 2×Phanta Max Buffer 25 μL dNTP Mix (10 mM) 1 μL Phanta Max Super-Fidelity DNAPolymerase 0.5μL <![CDATA[dd H2O]]> Make up to 50 μL

[0112] Table 3 Gene amplification PCR program

[0113]

[0114] Table 4 Components of colony verification PCR system

[0115] Components Dosage Template (recombinant plasmid) 1μL Upstream primer (10 μM) 1μL Downstream primer (10 μM) 1μL 2×Phanta Max Buffer 25μL dNTP Mix (10mM) 1μL Phanta Max Super-Fidelity DNA Polymerase 0.5μL <![CDATA[dd H2O]]> Make up to 50 μL

[0116] Table 5 Colony verification PCR program table

[0117]

[0118] S3. Construction of genetically engineered strain accA-pu:

[0119] The correctly sequenced recombinant plasmid PMK-AB-accA was electroporated into rhlAB-rmlBDAC-△flag competent cells at a voltage of 1.2-1.5 kV, and 1-2 ml LB was added. After recovery in a shaker at 30°C and 200 rpm for 1.5 hours, the bacterial solution was spread on an LB plate containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L), and cultured until a single colony grew. A single colony was picked and inoculated into 10 ml LB liquid containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L). After culturing at 30°C and 200 rpm for 12 hours, 600 μL of the bacterial solution was added to 600 μL of 50% glycerol, and placed in a 2 ml sterile glycerol tube for storage at -80°C. The strain was named accA-pu.

[0120] S4. Streak the overexpression strain accA-pu on an LB plate containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L), culture until a single colony grows, pick a single colony and inoculate it into 10 ml LB medium containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture it overnight at 30°C and 200 rpm as a seed solution; inoculate 500 μL of the seed solution into a 500 mL shake flask containing 50 mL of fermentation medium and ferment for 72 h. The control strain rhlAB-rmlBDAC-△flag was streaked on an LB plate containing gentamicin (25 mg / L) and ampicillin (100 mg / L), cultured until a single colony grew, picked a single colony and inoculated it into 10 ml LB medium containing gentamicin (25 mg / L) and ampicillin (100 mg / L), and cultured overnight at 30°C and 200 rpm as a seed solution; 500 μL of seed solution was inoculated into a 500 mL shake flask containing 50 mL of fermentation medium and fermented for 72 hours. After the fermentation was completed, 1 mL of the fermentation liquid was centrifuged at room temperature at 12000 rpm for 2 minutes, 500 μL of the supernatant was taken and mixed with 500 μL of acetonitrile, and after overnight at 4°C, the content of rhamnolipid was detected according to the HPLC detection method in the specific embodiment, and 1 mL of the fermentation liquid was taken to determine the biomass OD 600 OD in the fermentation supernatant 600 Comparison of rhamnolipid content with that of control strains Figure 2 As shown, the genetically engineered bacteria accA-pu for improving rhamnolipid production provided by the present invention increases the supply of rhamnolipid synthesis precursors dTDP-L-rhamnose and HAA by overexpressing the accA gene, thereby slightly improving the rhamnolipid production compared to rhlAB-rmlBDAC-△flag.

[0121] Example 2: Construction of genetically engineered bacteria accBC-pu

[0122] S1. Construction of recombinant plasmid PMK-AB-accBC;

[0123] The rhlAB gene was amplified using primer pair P1 / P2 with Pseudomonas aeruginosa PAO1 bacterial solution as a template, and the accBC gene was amplified using primer pair P5 / P6 with Pseudomonas putida KT2440 bacterial solution as a template (the nucleotide sequence is shown in SEQ ID NO.3). The pMK plasmid was digested with EcoRI and KpnI, and then the rhlAB gene, accBC gene and pMK (EcoRI, KpnI) were connected using Vazyme's C115, and sequenced for verification (the system component table and program table for gene amplification PCR and colony verification PCR are shown in Table 2-5), and the vector PMK-AB-accBC was obtained.

[0124] S2, construct the genetically engineered bacteria accBC-pu;

[0125] The correctly sequenced vector PMK-AB-accBC was electroporated into rhlAB-rmlBDAC-△flag competent cells at a voltage of 1.2-1.5 kV, and 1-2 ml LB was added. After resuscitation in a shaker at 30°C and 200 rpm for 1.5 hours, the bacterial solution was spread on an LB plate containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L), and cultured until a single colony grew. A single colony was picked and inoculated into 10 ml LB liquid containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L). After culturing at 30°C and 200 rpm for 12 hours, 600 μL of the bacterial solution was added to 600 μL of 50% glycerol, and placed in a 2 ml sterile glycerol tube and stored at -80°C. The strain was named accBC-pu.

[0126] S3. Streak the overexpression strain accBC-pu on an LB plate containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L), culture until a single colony grows, pick a single colony and inoculate it into 10 ml LB medium containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture it overnight at 30°C and 200 rpm to use as seed solution; inoculate 500 μL of seed solution into a 500 mL shake flask containing 50 mL of fermentation medium and ferment for 72 h. The control strain rhlAB-rmlBDAC-△flag was streaked on an LB plate containing gentamicin (25 mg / L) and ampicillin (100 mg / L), cultured until a single colony grew, picked a single colony and inoculated it into 10 ml LB medium containing gentamicin (25 mg / L) and ampicillin (100 mg / L), and cultured overnight at 30°C and 200 rpm as a seed solution; 500 μL of seed solution was inoculated into a 500 mL shake flask containing 50 mL of fermentation medium and fermented for 72 hours. After the fermentation was completed, 1 mL of the fermentation liquid was centrifuged at room temperature at 12000 rpm for 2 minutes, 500 μL of the supernatant was taken and mixed with 500 μL of acetonitrile, and after overnight at 4°C, the content of rhamnolipid was detected according to the HPLC detection method in the specific embodiment, and 1 mL of the fermentation liquid was taken to determine the biomass OD 600 OD in the fermentation supernatant 600 Comparison of rhamnolipid content with that of control strains Figure 3 As shown, the genetically engineered bacteria accBC-pu for improving rhamnolipid production provided by the present invention increases the supply of rhamnolipid synthesis precursors dTDP-L-rhamnose and HAA by overexpressing the accBC gene, thereby increasing the rhamnolipid production by 1.14 times compared with rhlAB-rmlBDAC-△flag.

[0127] Example 3. Construction of strain accD-pu

[0128] S1. Construction of plasmid PMK-AB-accD

[0129] The rhlAB gene was amplified using primer pair P1 / P2 with Pseudomonas aeruginosa PAO1 bacterial solution as a template, and the accD gene was amplified using primer pair P7 / P8 with Pseudomonas putida KT2440 bacterial solution as a template (the nucleotide sequence is shown in SEQ ID NO.4). The pMK plasmid was digested with EcoRI and KpnI, and then rhlAB, accBC and pMK (EcoRI, KpnI) were connected using Vazyme's C115, and sequenced for verification (the system component table and program table for gene amplification PCR and colony verification PCR are shown in Table 2-5), and the vector PMK-AB-accD was obtained.

[0130] S2, construction of strain accD-pu;

[0131] The correctly sequenced vector PMK-AB-accD was electroporated into rhlAB-rmlBDAC-△flag competent cells at a voltage of 1.2-1.5 kV, and 1-2 ml LB was added. After recovery in a shaker at 30°C and 200 rpm for 1.5 hours, the bacterial solution was spread on an LB plate containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L), and cultured until a single colony grew. A single colony was picked and inoculated into 10 ml LB liquid containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L). After culturing at 30°C and 200 rpm for 12 hours, 600 μL of the bacterial solution was added to 600 μL of 50% glycerol, and placed in a 2 ml sterile glycerol tube for storage at -80°C. The strain was named accD-pu.

[0132] S3. Streak the overexpression strain accD-pu on an LB plate containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L), culture until a single colony grows, pick a single colony and inoculate it into 10 ml LB medium containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture it overnight at 30°C and 200 rpm to use as seed solution; inoculate 500 μL of seed solution into a 500 mL shake flask containing 50 mL of fermentation medium and ferment for 72 h. The control strain rhlAB-rmlBDAC-△flag was streaked on an LB plate containing gentamicin (25 mg / L) and ampicillin (100 mg / L), cultured until a single colony grew, picked a single colony and inoculated it into 10 ml LB medium containing gentamicin (25 mg / L) and ampicillin (100 mg / L), and cultured overnight at 30°C and 200 rpm as a seed solution; 500 μL of seed solution was inoculated into a 500 mL shake flask containing 50 mL of fermentation medium and fermented for 72 hours. After the fermentation was completed, 1 mL of the fermentation liquid was centrifuged at room temperature at 12000 rpm for 2 minutes, 500 μL of the supernatant was taken and mixed with 500 μL of acetonitrile, and after overnight at 4°C, the content of rhamnolipid was detected according to the HPLC detection method in the specific embodiment, and 1 mL of the fermentation liquid was taken to determine the biomass OD 600 OD in the fermentation supernatant 600 Comparison of rhamnolipid content with that of control strains Figure 4 As shown, the genetically engineered bacteria accD-pu for improving rhamnolipid production provided by the present invention increases the supply of rhamnolipid synthesis precursors dTDP-L-rhamnose and HAA by overexpressing the accD gene, thereby increasing the rhamnolipid production by 1.07 times compared with rhlAB-rmlBDAC-△flag.

[0133] Example 4. Construction of strain fabD-pu

[0134] S1, construction of plasmid PMK-AB-fabD;

[0135] The rhlAB gene was amplified using primer pair P1 / P2 with Pseudomonas aeruginosa PAO1 bacterial solution as a template, and the fabD gene was amplified using primer pair P9 / P10 with Pseudomonas putida KT2440 bacterial solution as a template (the nucleotide sequence is shown in SEQ ID NO.5). The pMK plasmid was digested with EcoRI and KpnI, and then rhlAB, accBC and pMK (EcoRI, KpnI) were connected using Vazyme's C115, and sequenced for verification (the system component table and program table for gene amplification PCR and colony verification PCR are shown in Table 2-5), and the vector PMK-AB-fabD was obtained.

[0136] S2, construction of strain fabD-pu;

[0137] The correctly sequenced vector PMK-AB-fabD was electroporated into rhlAB-rmlBDAC-△flag competent cells at a voltage of 1.2-1.5 kV, and 1-2 ml LB was added. After recovery in a shaker at 30°C and 200 rpm for 1.5 h, the bacterial solution was spread on an LB plate containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L), and cultured until a single colony grew. A single colony was picked and inoculated into 10 ml LB liquid containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L). After culturing at 30°C and 200 rpm for 12 h, 600 μL of the bacterial solution was added to 600 μL of 50% glycerol, and placed in a 2 ml sterile glycerol tube for storage at -80°C. The strain was named fabD-pu.

[0138] S3. Streak the overexpression strain fabD-pu on an LB plate containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L), culture until a single colony grows, pick a single colony and inoculate it into 10 ml LB medium containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture it overnight at 30°C and 200 rpm to use as seed solution; inoculate 500 μL of seed solution into a 500 mL shake flask containing 50 mL of fermentation medium and ferment for 72 h. The control strain rhlAB-rmlBDAC-△flag was streaked on an LB plate containing gentamicin (25 mg / L) and ampicillin (100 mg / L), cultured until a single colony grew, picked a single colony and inoculated it into 10 ml LB medium containing gentamicin (25 mg / L) and ampicillin (100 mg / L), and cultured overnight at 30°C and 200 rpm as a seed solution; 500 μL of seed solution was inoculated into a 500 mL shake flask containing 50 mL of fermentation medium and fermented for 72 hours. After the fermentation was completed, 1 mL of the fermentation liquid was centrifuged at room temperature at 12000 rpm for 2 minutes, 500 μL of the supernatant was taken and mixed with 500 μL of acetonitrile, and after overnight at 4°C, the content of rhamnolipid was detected according to the HPLC detection method in the specific embodiment, and 1 mL of the fermentation liquid was taken to determine the biomass OD 600 OD in the fermentation supernatant 600 Comparison of rhamnolipid content with that of control strains Figure 5 As shown, the genetically engineered bacteria fabD-pu for improving rhamnolipid production provided by the present invention increases the supply of rhamnolipid synthesis precursors dTDP-L-rhamnose and HAA by overexpressing the fabD gene, thereby increasing the rhamnolipid production by 1.17 times compared with rhlAB-rmlBDAC-△flag.

[0139] Example 5. Construction of strain accABC-pu

[0140] S1, construction of plasmid PMK-AB-accA-accBC;

[0141] The rhlAB gene was amplified using primer pair P1 / P2 with the bacterial culture of Pseudomonas aeruginosa PAO1 as a template, the accA gene was amplified using primer pair P3 / P11 with the bacterial culture of Pseudomonas putida KT2440 as a template, and the accBC gene was amplified using primer pair P12 / P6 with the bacterial culture of Pseudomonas putida KT2440 as a template. The pMK plasmid was digested with EcoRI and KpnI, and then rhlAB, accBC and pMK (EcoRI, KpnI) were connected using Vazyme's C115 and sequenced for verification (the system component table and procedure table for gene amplification PCR and colony verification PCR are shown in Table 2-5) to obtain the vector PMK-AB-accA-accBC.

[0142] S2, construction of strain accABC-pu;

[0143] The correctly sequenced vector PMK-AB-accA-accBC was electroporated into rhlAB-rmlBDAC-△flag competent cells at a voltage of 1.2-1.5 kV, and 1-2 ml LB was added. After resuscitation in a shaker at 30°C and 200 rpm for 1.5 h, the bacterial solution was spread on an LB plate containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L), and cultured until a single colony grew. A single colony was picked and inoculated into 10 ml LB liquid containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L). After culturing at 30°C and 200 rpm for 12 h, 600 μL of the bacterial solution was added to 600 μL of 50% glycerol, and the cells were placed in a 2 ml sterile glycerol tube and stored at -80°C. The strain was named accABC-pu.

[0144] S3. Streak the overexpression strain accABC-pu on an LB plate containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L), culture until a single colony grows, pick a single colony and inoculate it into 10 ml LB medium containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture it overnight at 30°C and 200 rpm to use as seed solution; inoculate 500 μL of seed solution into a 500 mL shake flask containing 50 mL of fermentation medium and ferment for 72 h. The control strain rhlAB-rmlBDAC-△flag was streaked on an LB plate containing gentamicin (25 mg / L) and ampicillin (100 mg / L), cultured until a single colony grew, picked a single colony and inoculated it into 10 ml LB medium containing gentamicin (25 mg / L) and ampicillin (100 mg / L), and cultured overnight at 30°C and 200 rpm as a seed solution; 500 μL of seed solution was inoculated into a 500 mL shake flask containing 50 mL of fermentation medium and fermented for 72 hours. After the fermentation was completed, 1 mL of the fermentation liquid was centrifuged at room temperature at 12000 rpm for 2 minutes, 500 μL of the supernatant was taken and mixed with 500 μL of acetonitrile, and after overnight at 4°C, the content of rhamnolipid was detected according to the HPLC detection method in the specific embodiment, and 1 mL of the fermentation liquid was taken to determine the biomass OD 600 OD in the fermentation supernatant 600 Comparison of rhamnolipid content with that of control strains Figure 6 As shown, the genetically engineered bacteria accABC-pu for improving rhamnolipid production provided by the present invention increases the supply of rhamnolipid synthesis precursors dTDP-L-rhamnose and HAA by overexpressing accA, accBC, and rmlBDAC genes, thereby increasing the rhamnolipid production by 2.24 times compared with rhlAB-rmlBDAC-△flag.

[0145] Example 6. Construction of strain accABCD-pu

[0146] S1, construction of plasmid PMK-AB-accA-accBC-accD;

[0147] The rhlAB gene was amplified using primer pair P1 / P2 and the bacterial solution of Pseudomonas aeruginosa PAO1 as a template, the accA gene was amplified using primer pair P3 / P11 and the accBC gene was amplified using the bacterial solution of Pseudomonas putida KT2440 as a template, the accD gene was amplified using primer pair P14 / P8 and the bacterial solution of Pseudomonas putida KT2440 as a template, the pMK plasmid was digested with EcoRI and KpnI, and then rhlAB, accA, accBC, accD and pMK (EcoRI, KpnI) were connected using C115 from Vazyme and verified by sequencing to obtain the vector PMK-AB-accA-accBC-accD.

[0148] S2, construction of strain accABCD-pu;

[0149] The correctly sequenced vector PMK-AB-accA-accBC-accD was electroporated into rhlAB-rmlBDAC-△flag competent cells at a voltage of 1.2-1.5 kV, and 1-2 ml LB was added. After recovery in a shaker at 30°C and 200 rpm for 1.5 hours, the bacterial solution was spread on an LB plate containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L), and cultured until a single colony grew. A single colony was picked and inoculated into 10 ml LB liquid containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L). After culturing at 30°C and 200 rpm for 12 hours, 600 μL of the bacterial solution was added to 600 μL of 50% glycerol, and the cells were placed in a 2 ml sterile glycerol tube and stored at -80°C. The strain was named accABCD-pu.

[0150] S3. Streak the overexpression strain accABCD-pu on an LB plate containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L), culture until a single colony grows, pick a single colony and inoculate it into 10 ml LB medium containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture it overnight at 30°C and 200 rpm to use as seed solution; inoculate 500 μL of seed solution into a 500 mL shake flask containing 50 mL of fermentation medium and ferment for 72 h. The control strain rhlAB-rmlBDAC-△flag was streaked on an LB plate containing gentamicin (25 mg / L) and ampicillin (100 mg / L), cultured until a single colony grew, picked a single colony and inoculated it into 10 ml LB medium containing gentamicin (25 mg / L) and ampicillin (100 mg / L), and cultured overnight at 30°C and 200 rpm as a seed solution; 500 μL of seed solution was inoculated into a 500 mL shake flask containing 50 mL of fermentation medium and fermented for 72 hours. After the fermentation was completed, 1 mL of the fermentation liquid was centrifuged at room temperature at 12000 rpm for 2 minutes, 500 μL of the supernatant was taken and mixed with 500 μL of acetonitrile, and after overnight at 4°C, the content of rhamnolipid was detected according to the HPLC detection method in the specific embodiment, and 1 mL of the fermentation liquid was taken to determine the biomass OD 600 OD in the fermentation supernatant 600 Comparison of rhamnolipid content with that of control strains Figure 7 As shown, the genetically engineered bacterium accABCD-pu for producing rhamnolipid provided by the present invention increases the overexpression of the accD gene on the basis of accABC-pu, so that the yield of rhamnolipid is increased by 1.84 times compared with rhlAB-rmlBDAC-△flag.

[0151] Example 7, construction of strain accAD-pu;

[0152] S1, construction of plasmid PMK-AB-accA-accD;

[0153] The rhlAB gene was amplified using primer pair P1 / P2 with the bacterial culture of Pseudomonas aeruginosa PAO1 as a template, the accA gene was amplified using primer pair P3 / P15 with the bacterial culture of Pseudomonas putida KT2440 as a template, and the accD gene was amplified using primer pair P16 / P8 with the bacterial culture of Pseudomonas putida KT2440 as a template. The pMK plasmid was digested with EcoRI and KpnI, and then rhlAB, accA, accD and pMK (EcoRI, KpnI) were connected using Vazyme's C115 and sequenced for verification (the system component table and procedure table for gene amplification PCR and colony verification PCR are shown in Table 2-5) to obtain the vector PMK-AB-accA-accD.

[0154] S2, construction of strain accAD-pu;

[0155] The correctly sequenced vector PMK-AB-accA-accD was electroporated into rhlAB-rmlBDAC-△flag competent cells at a voltage of 1.2-1.5 kV, and 1-2 ml LB was added. After resuscitation in a shaker at 30°C and 200 rpm for 1.5 h, the bacterial solution was spread on an LB plate containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L), and cultured until a single colony grew. A single colony was picked and inoculated into 10 ml LB liquid containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L). After culturing at 30°C and 200 rpm for 12 h, 600 μL of the bacterial solution was added to 600 μL of 50% glycerol, and the cells were placed in a 2 ml sterile glycerol tube and stored at -80°C. The strain was named accAD-pu.

[0156] S3. Streak the overexpression strain accAD-pu on an LB plate containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L), culture until a single colony grows, pick a single colony and inoculate it into 10 ml LB medium containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture it overnight at 30°C and 200 rpm as a seed solution; inoculate 500 μL of the seed solution into a 500 mL shake flask containing 50 mL of fermentation medium and ferment for 72 h. The control strain rhlAB-rmlBDAC-△flag was streaked on an LB plate containing gentamicin (25 mg / L) and ampicillin (100 mg / L), cultured until a single colony grew, picked a single colony and inoculated it into 10 ml LB medium containing gentamicin (25 mg / L) and ampicillin (100 mg / L), and cultured overnight at 30°C and 200 rpm as a seed solution; 500 μL of seed solution was inoculated into a 500 mL shake flask containing 50 mL of fermentation medium and fermented for 72 hours. After the fermentation was completed, 1 mL of the fermentation liquid was centrifuged at room temperature at 12000 rpm for 2 minutes, 500 μL of the supernatant was taken and mixed with 500 μL of acetonitrile, and after overnight at 4°C, the content of rhamnolipid was detected according to the HPLC detection method in the specific embodiment, and 1 mL of the fermentation liquid was taken to determine the biomass OD 600 OD in the fermentation supernatant 600 Comparison of rhamnolipid content with that of control strains Figure 8As shown, the genetically engineered bacteria accAD-pu for producing rhamnolipid provided by the present invention deletes the overexpression of the accBC gene on the basis of accABCD-pu, so that the yield of rhamnolipid is increased by 2.5 times compared with rhlAB-rmlBDAC-△flag.

[0157] Example 8. Construction of strain accAD-fabD-pu

[0158] S1, construction of plasmid PMK-AB-accA-accD-fabD;

[0159] The rhlAB gene was amplified using primer pair P1 / P2 and the bacterial culture of Pseudomonas aeruginosa PAO1 as a template, the accA gene was amplified using primer pair P3 / P15 and the bacterial culture of Pseudomonas putida KT2440 as a template, the accD gene was amplified using primer pair P16 / P17 and the fabD gene was amplified using primer pair P18 / P10 and the bacterial culture of Pseudomonas putida KT2440 as a template, the pMK plasmid was digested with EcoRI and KpnI, and then rhlAB, accA, accD, fabD and pMK (EcoRI, KpnI) were connected using C115 from Vazyme, and sequenced for verification (the system component table and procedure table for gene amplification PCR and colony verification PCR are shown in Table 2-5), and the vector PMK-AB-accA-accD-fabD was obtained.

[0160] S2, construction of strain accAD-fabD-pu;

[0161] The correctly sequenced vector PMK-AB-accA-accD-fabD was electroporated into rhlAB-rmlBDAC-△flag competent cells at a voltage of 1.2-1.5 kV, and 1-2 ml LB was added. After resuscitation in a shaker at 30°C and 200 rpm for 1.5 h, the bacterial solution was spread on an LB plate containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L), and cultured until a single colony grew. A single colony was picked and inoculated into 10 ml LB liquid containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L). After culturing at 30°C and 200 rpm for 12 h, 600 μL of the bacterial solution was added to 600 μL of 50% glycerol, and the cells were placed in a 2 ml sterile glycerol tube and stored at -80°C. The strain was named accAD-fabD-pu.

[0162] S3. Streak the overexpression strain accAD-fabD-pu on an LB plate containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L), culture until a single colony grows, pick a single colony and inoculate it into 10 ml LB medium containing gentamicin (25 mg / L), ampicillin (100 mg / L) and kanamycin (25 mg / L), and culture it overnight at 30°C and 200 rpm as a seed solution; inoculate 500 μL of the seed solution into a 500 mL shake flask containing 50 mL of fermentation medium and ferment for 72 h. The control strain rhlAB-rmlBDAC-△flag was streaked on an LB plate containing gentamicin (25 mg / L) and ampicillin (100 mg / L), cultured until a single colony grew, picked a single colony and inoculated it into 10 ml LB medium containing gentamicin (25 mg / L) and ampicillin (100 mg / L), and cultured overnight at 30°C and 200 rpm as a seed solution; 500 μL of seed solution was inoculated into a 500 mL shake flask containing 50 mL of fermentation medium and fermented for 72 hours. After the fermentation was completed, 1 mL of the fermentation liquid was centrifuged at room temperature at 12000 rpm for 2 minutes, 500 μL of the supernatant was taken and mixed with 500 μL of acetonitrile, and after overnight at 4°C, the content of rhamnolipid was detected according to the HPLC detection method in the specific embodiment, and 1 mL of the fermentation liquid was taken to determine the biomass OD 600 OD in the fermentation supernatant 600 Comparison of rhamnolipid content with that of control strains Fig. 9 As shown, the genetically engineered bacteria accAD-fabD-pu for improving rhamnolipid production provided by the present invention increases the overexpression of the fabD gene on the basis of accAD-pu, so that the rhamnolipid production in Pseudomonas putida KT2440 is further improved, which is 2.93 times higher than that of rhlAB-rmlBDAC-△flag. This genetically engineered bacteria has the highest rhamnolipid production.

[0163] The raw materials and equipment used in the present invention, unless otherwise specified, are all commonly used raw materials and equipment in the art; the methods used in the present invention, unless otherwise specified, are all conventional methods in the art.

[0164] The above examples are for the purpose of illustrating the embodiments disclosed by the present invention and are not to be construed as limitations of the present invention. In addition, the various modifications listed herein and the variations of methods and compositions in the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention is not limited to these specific embodiments. In fact, various modifications obvious to those skilled in the art as described above to obtain the invention should be included within the scope of the present invention.

Claims

1. A genetically engineered bacterium producing rhamnolipid, characterized in that: It comprises a base bacterium and a recombinant plasmid introduced into the base bacterium and capable of self-replication; the base bacterium is Pseudomonas putida rhlAB-rmlBDAC-△flag; the recombinant plasmid comprises the rhlAB gene of Pseudomonas aeruginosa and any combination of one or more of the accA gene, accBC gene, accD gene and fabD gene in the genome of Pseudomonas putida; the nucleotide sequence of the rhlAB gene is shown in SEQ ID NO.1; the nucleotide sequence of the accA gene is shown in SEQ ID NO.2; the nucleotide sequence of the accBC gene is shown in SEQ ID NO.3; the nucleotide sequence of the accD gene is shown in SEQ ID NO.4; the nucleotide sequence of the fabD gene is shown in SEQ ID NO.

5.

2. The genetically engineered bacterium producing rhamnolipid according to claim 1, characterized in that: The Pseudomonas putida rhlAB-rmlBDAC-△flag is a recombinant strain obtained by overexpressing the rhlAB gene and the rmlBDAC gene in Pseudomonas aeruginosa in a mutant strain in which the flag gene cluster in the Pseudomonas putida genome is knocked out.

3. The genetically engineered bacterium producing rhamnolipid according to claim 2, characterized in that: The recombinant plasmid contains the rhlAB gene of Pseudomonas aeruginosa and the accA gene, accD gene and fabD gene in the genome of Pseudomonas putida.

4. The genetically engineered bacterium producing rhamnolipid according to claim 2, characterized in that: The recombinant plasmid contains the rhlAB gene of Pseudomonas aeruginosa PA01 and the accA gene and accBC gene in the genome of Pseudomonas putida.

5. The genetically engineered bacterium producing rhamnolipid according to claim 2, characterized in that: The recombinant plasmid contains the rhlAB gene of Pseudomonas aeruginosa PA01 and the accA gene, accBC gene and accD gene in the genome of Pseudomonas putida.

6. The genetically engineered bacterium producing rhamnolipid according to claim 2, characterized in that: The recombinant plasmid contains the rhlAB gene of Pseudomonas aeruginosa PA01 and the accA gene and accD gene in the genome of Pseudomonas putida.

7. A method for constructing a genetically engineered bacterium producing rhamnolipid according to any one of claims 1 to 6, characterized in that: The following steps are involved: Step 1, preparing Pseudomonas putida rhlAB-rmlBDAC-△flag competent cells; Step 2, constructing a recombinant plasmid PMK-AB-accA: using a one-step cloning method to overexpress the rhlAB gene in the genome of Pseudomonas aeruginosa PAO1 and one or any combination of two or more of the accA gene, accBC gene, accD gene, and fabD gene in the genome of Pseudomonas putida in the expression vector pMK to obtain a recombinant plasmid; Step 3: Using Pseudomonas putida rhlAB-rmlBDAC-△flag as the base bacteria, overexpressing the recombinant plasmid to obtain a genetically engineered bacterium that produces rhamnolipid.

8. The construction method according to claim 7, characterized in that: In step 4, Pseudomonas putida rhlAB-rmlBDAC-△flag is used as the base strain to overexpress the recombinant plasmid, including: The invention relates to a step of preparing rhlAB-rmlBDAC-△flag competent cells of Pseudomonas putida; and a step of electrotransferring the correctly sequenced recombinant plasmid into rhlAB-rmlBDAC-△flag competent cells at a voltage of 1.2-1.5 kV.

9. Use of the genetically engineered bacterium producing rhamnolipid as claimed in any one of claims 1 to 6 in preparing rhamnolipid by microbial fermentation.

10. The use according to claim 9, characterized in that The application comprises the following steps: streaking genetically engineered bacteria on an LB plate containing gentamicin, ampicillin and kanamycin, culturing until a single colony grows, picking a single colony and inoculating it into an LB liquid culture medium containing gentamicin, ampicillin and kanamycin, and culturing it overnight at 30°C and 200rpm to serve as a seed solution; inoculating the seed solution into a fermentation culture medium at an inoculum amount of 2% by volume, fermenting and culturing it under the conditions of natural pH and temperature of 30°C, taking the fermentation liquid, and separating and purifying rhamnolipid; wherein the final concentration of kanamycin in the culture medium is 0.05 mg / L; the final concentration of gentamicin in the culture medium is 0.025 mg / L, and the final concentration of ampicillin in the culture medium is 0.1 mg / L; the fermentation culture medium is composed of: 10 g / L glucose, 5 g / L yeast extract, 10 g / L peptone, 10 g / L sodium chloride, the solvent is deionized water, and the pH value is natural.

Images