Application of rice minor heading period gene Ndf1
By knocking out the Ndf1 gene, which has a low effect on the heading period of rice, through gene editing technology, the problems of unstable growth period and low nitrogen fertilizer use efficiency in rice have been solved. This has resulted in earlier heading period, increased yield, and improved nitrogen use efficiency, laying a theoretical foundation for the breeding of high-yield and stable-product varieties.
Patent Information
- Application Number
- CN202411453550.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-17
- Publication Date
- 2025-01-07
AI Technical Summary
In existing technologies, the growth period of rice is unstable, nitrogen fertilizer utilization efficiency is low, resulting in unstable yield and quality. Furthermore, excessive application of nitrogen fertilizer causes environmental problems, making it difficult to effectively regulate the flowering time of rice and increase yield through traditional methods.
By knocking out the Ndf1 gene, which has a low effect on heading time in rice, through gene editing technology, the growth period and nitrogen use efficiency of rice can be regulated. The Ndf1 gene can be edited at multiple targets in rice using the CRISPR/Cas9 system to obtain ndf1 mutant plants, thereby improving heading time sensitivity and nitrogen use efficiency.
This has resulted in earlier heading of rice, increased yield, significantly improved nitrogen use efficiency, and enhanced growth period stability, providing a theoretical basis for the breeding of high-yield and stable varieties.
Smart Images
Figure CN119265225A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of plant genetic engineering, discloses the genetic engineering application of a rice micro-effect heading period gene Ndf1, and specifically relates to the application of Ndf1 in regulating the growth period of rice and improving yield and nitrogen utilization efficiency. Background Art
[0002] Nitrogen (N) is one of the essential macronutrients for plant growth and development. Nitrogen is a core component of amino acids, proteins, nucleic acids, chlorophyll, and various primary and secondary metabolites in living organisms. The atmosphere contains a large amount of nitrogen, but it cannot be directly absorbed by most non-leguminous plants. Almost all the nitrogen in plants and animals on Earth comes from the soil. In agricultural production, the nitrogen content in the soil is often a key factor limiting crop yields (Stahl et al., 2017; Xu et al., 2012). Therefore, the high yield and quality of modern crops are very dependent on the application of nitrogen fertilizers, but excessive application of nitrogen fertilizers often causes environmental problems such as soil acidification, eutrophication of water bodies, greenhouse gas emissions, and low nitrogen fertilizer utilization efficiency, which seriously restricts the sustainable development of agriculture.
[0003] Nitrogen is not only an important nutrient for plant growth, but also participates in regulating the conversion from vegetative growth to reproductive growth, affecting the growth period. Flowering time is one of the key indicators for measuring the growth period of crops, and plays a vital role in the formation of crop yield and quality. In agricultural production, excessive application of nitrogen fertilizer will cause the phenomenon of "greed for green and late maturity", that is, it will lead to the extension of the entire growth period of crops, disrupt the farming order, and cause crops to miss the appropriate growth period, resulting in reduced yield and quality and inefficient nutrients. Not only that, because of the delay in the growth period of the previous crop, the subsequent crop cannot be sown or transplanted in time, and its agricultural planting efficiency and benefits are greatly affected. Therefore, a stable crop growth period is an important basis for ensuring stable crop yields and high efficiency of nitrogen fertilizers.
[0004] The effect of nitrogen on plant flowering is determined by both external conditions and internal genetic factors. Recent studies have shown that nitrogen affects flowering time regulation in rice and shows rich genetic diversity. Zhang Shuanan et al. (2020) analyzed the transcriptome library of the apical meristem of rice stems before and after flowering under different nitrogen concentrations and found that a MYB family transcription factor, N-regulated heading date 1 (Nhd1), can respond to upstream glutamine (Glutamine, Gln) signals. Nhd1 directly activates the flowering gene Hd3a through positive regulation, thereby regulating the flowering time of rice. Whether Nhd1 or Hd3a is missing, the flowering time of rice is delayed under different sunshine conditions, and the flowering response to nitrogen fertilizer is lost, increasing the cumulative nitrogen absorption. Nhd1 can also inhibit the expression of the nitrogen assimilation gene Fd-GOGAT, reduce its enzyme activity and change the glutamine content. The loss of Nhd1 can enhance the efficiency of nitrogen assimilation, while improving yield and nitrogen use efficiency (NUE). The results showed that Nhd1 has the function of synergistically regulating the growth period and nitrogen utilization efficiency of rice (Zhang et al., 2020).
[0005] Early rice heading date gene mining was mainly carried out through forward genetics methods such as natural population QTL positioning and mutant positional cloning. Many major heading date genes have been identified through these methods, but the functional changes of these genes are usually accompanied by significant changes in other traits such as rice yield and plant height. The yield growth of Chinese rice varieties has been slow in recent years, indicating that before new breakthroughs in germplasm resource development and gene layout, the aggregation of minor genes may be one of the effective means to improve yield potential. However, there are few reports on the mining and utilization of minor heading date genes. Cloning the Nhd1-dependent nitrogen-mediated rice minor heading date gene Ndf1 (Nhd1-dependentfloweringfactor 1) not only lays an important foundation for constructing a network pathway for nitrogen regulation of flowering in rice and other plants, but also provides a theoretical basis for breeding high-yield, stable-yield and nitrogen-efficient varieties characterized by a stable growth period. Summary of the invention
[0006] The purpose of the present invention is to provide engineering application of rice micro-effect heading period gene Ndf1 and its encoding protein.
[0007] The purpose of the present invention is achieved through the following technical solutions:
[0008] The application of the rice micro-effective heading period gene Ndf1 in regulating rice growth period, yield and nitrogen use efficiency under high and low nitrogen conditions. The sequence number of the rice micro-effective heading period gene Ndf1 is LOC_Os11g47710 (Os11g0703400), and the sequence information is shown in SEQ ID No.1.
[0009] As a preferred embodiment of the present invention, the use of knocking out the rice micro-effective heading period gene Ndf1 in advancing the heading period of rice, improving yield (early maturity without reducing yield) and increasing nitrogen utilization efficiency.
[0010] The plant is preferably a monocotyledonous plant, further preferably rice, corn or wheat, and particularly preferably rice.
[0011] Beneficial Effects
[0012] 1. The present invention obtains ndf1 mutant plants through gene editing technology. Field tests and analysis prove that the mutant plants have a slight effect of advancing the heading period and increase the sensitivity of the heading period to nitrogen response.
[0013] 2. The effective tillers of ndf1 mutant plants are significantly increased compared with wild-type plants, and the yield is improved.
[0014] 3. The nitrogen utilization efficiency of ndf1 mutant plants was significantly increased compared with that of wild-type plants, indicating the important role of this gene in the coordinated regulation of growth period and nitrogen utilization efficiency, and establishing a theoretical basis for future rice variety improvement.
[0015] 4. There are mainly three natural variation haplotypes in the coding region of the rice micro-effect heading period gene Ndf1 in the 3K database, and the statistical data of population flowering time show that there are significant differences in the average flowering time among the three haplotypes. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 EMS-induced mutagenesis of the nhd1 mutant resulted in a stable inheritance line nhd1ndf1 / nhd1ndf2 with a flowering period close to that of the Nipponbare wild type. Mutmap positioning of the F2 population was constructed, and the candidate gene was knocked out in the nhd1 mutant background to observe the flowering period phenotype, and the rice minor heading period gene Ndf1 was cloned.
[0017] Figure 2 Mutation sites of each strain of ndf1 mutant.
[0018] Figure 3 The phenotypes of ndf1 mutant plants under high and low nitrogen conditions during heading and flowering; their heading date was significantly advanced compared with the wild type and negative plants, and the sensitivity of the heading date to nitrogen response was increased.
[0019] Figure 4The phenotype of ndf1 mutant plants under high and low nitrogen conditions in the late growth period showed that their effective tillers were significantly increased compared with the wild type and negative plants.
[0020] Figure 5 In the late growth stage, the yield of ndf1 mutant plants under high and low nitrogen conditions was significantly increased compared with wild-type and negative plants.
[0021] Figure 6 In the late growth period, the nitrogen use efficiency (NUE) of ndf1 mutant plants under high and low nitrogen conditions was significantly increased compared with wild-type and negative plants.
[0022] Figure 7 There are mainly three natural variation haplotypes in the coding region of the rice minor heading date gene Ndf1 in the 3K database, and the statistical data of population flowering time showed that there were significant differences in the average flowering time among the three haplotypes. Specific implementation methods
[0024] Example 1 Construction of EMS-induced nhd1 mutant library and cloning of Ndf1
[0025] The seeds of the nhd1 mutant were used as mutagenesis materials, and the mutant materials were treated with 0.8% (V / V) ethyl methanesulfonate (EMS) for 12 hours. The M1 generation screened materials with heading and flowering time close to that of the Nipponbare wild type, and no significant differences in other traits. After the individual plants were harvested, the M2 generation was planted again to continue a new round of screening with heading and flowering time close to that of the Nipponbare wild type, and finally the line nhd1ndf1 / ndf2 with a flowering period close to that of Nipponbare and stable inheritance was obtained; the nhd1 ndf1 / ndf2 line was backcrossed with the nhd1 mutant mother for one generation and selfed for two generations to obtain the F2 segregation population. Twenty plants in the population whose heading and flowering were similar to those of the nhd1 mutant and those similar to the wild type were used as DNA mixed pool samples for Mutmap analysis to obtain candidate genes linked to the phenotype. On this basis, CRISPR-Cas9 technology was used to construct candidate gene mutant materials in the background of the nhd1 mutant to observe the flowering phenotype in the field. It was found that the late flowering phenotype of the nhd1 mutant after the candidate gene E1 mutation could be restored to the Nipponbare wild type, and finally the gene Ndf1 was cloned.
[0026] Example 2 Construction of ndf1 mutant plants
[0027] The ndf1 mutant was constructed using the CRISPR / Cas9 vector multi-target system, according to the CRISPR / Cas9 vector system and its operation method in the prior art (Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, et al. (2015). A Robust CRISPR / Cas9 System for Convenient, High Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol Plant, 8: 1274-1284.). According to the ndf1 gene sequence, two mutation target sites, 5'-TTGAAATCGACACAAGCTAT-3' and 5'-AACAGAAGAACTGGTAAACC-3', were selected for reverse complementary double-strand synthesis. The reaction system for double-strand synthesis is as follows: 10uM of the sense strand and 10ul of the antisense strand, mixed and centrifuged. In the PCR instrument, one cycle reaction is as follows: 95°C for 2 min, 72°C for 2 min, 55°C for 2 min, 37°C for 2 min, 25°C for 2 min, 15°C for 2 min, and finally maintaining a constant temperature of 15°C.
[0028] Using the cutting and connecting method, the reaction is as follows:
[0029] 0.5ul(~20ng)pYLgRNA-OsU3(Ma Plants.MolPlant,8:1274-1284.);
[0030] 0.5μ1 linker (final concentration 0.05uM)
[0031] 5U BsaI endonuclease
[0032] 1x BsaI Endonuclease Buffer
[0033] 1ul 10x T DNA ligase buffer:
[0034] Add ddH2O to 10μ1
[0035] Finally, add about 20-35U (0.05-0.1μl) T4 DNA ligase. Use PCR instrument to cycle the reaction for 5 cycles: 37℃5min, 20℃5min.
[0036] Amplify the gRNA expression cassette (using a two-step approach)
[0037] (a) First round of amplification (2 PCR reactions per gRNA expression cassette, 15u1 each):
[0038] Take 1 μl of the ligation product as a template, use UF (5'-CTCCGTTTTACCTGTGGAATCG-3') and the adapter reverse primers Ndf1-U3-R (5'-AAACATAGCTTGTGTCGATTTCAA-3') and Ndf1-U6a-R (5'-AAACGGTTTACCAGTTCTTCTGTT-3') (reaction 1),
[0039] Adapter forward primers Ndf1-U3-F (5'-GGCATTGAAATCGACACAAGCTAT-3') and Ndf1-U6a-F
[0040] (5'-GCCGAACAGAAGAACTGGTAAACC-3') / gRNA-R(5'-CGGAGGAAAATTCCATCCAC-3') (reaction 2), 0.2uM each, appropriate amount of high-fidelity PCR enzyme.
[0041] 95℃3min
[0042] 25-28 cycles: 95℃15s, 55℃15s, 72℃20s
[0043] 72℃5min
[0044] (b) Second round of PCR:
[0045] Mix the position-specific primer pairs into a 10x working solution with a concentration of 1.5uM. The primer pair is B1'+B2 (PT1).
[0046] B2'+BL(PT2)
[0047] Uctcg-B1':5'-TTCAGAggtCtCTCtCgACTAGTGGAATCGGCAGCAAAGG-3'
[0048] gRctga-B2:5'-AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC-3'
[0049] Uctga-B2':5'-TTCAGAggtctcTctgaCACTGGAATCGGCAGCAAAGG-3'
[0050] gRctgt-BL:5'-AGCGTGggtctcGaccgACGCGTCCATCCACTCCAAGCTC-3'
[0051] Take 1μl of the first round PCR reaction 1 and 2 products, dilute them 10 times with H2O, and take 1ul of each to mix as a template. Add 1 / 10 of each primer combination working solution to 50ul PCR reaction system (final concentration 0.15uM). Use appropriate amount of KOD-Plus or other high-fidelity PCR enzyme. Amplify 20 cycles: 95℃10s, 55℃15s, 68℃20s. Take 2~3u1 for electrophoresis to check whether the product length meets the requirements and estimate the approximate concentration of the sample. Purify the PCR product with a PCR product purification kit.
[0052] The last step is the cutting and connecting method:
[0053] Take 30ng of purified product, add 60ng of uncut pYLCRISPR / Cas9-MH(B) plasmid (Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, et al. (2015). A Robust CRISPR / Cas9 System for Convenient, High Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol Plant, 8: 1274-1284.) (pre-diluted to about 100ng / ul and frozen for storage), and digest with 10U BsaI at 37℃ for ~10min in 15ul reaction (1x BsaI endonuclease buffer). Add 0.5ul 10xNEB T4 DNA ligase buffer (or 1.5ul 10x Takara T4 DNA ligase buffer), and 35U ligase. Use variable temperature cycle enzyme digestion and ligation for 10 to 15 cycles: 37°C for 2 min; 10°C for 3 min, 20°C for 5 min; and finally 37°C for 2 min.
[0054] The vector was used to transform Escherichia coli. After the plasmid was extracted, it was transformed into Agrobacterium, which was used to infect rice Nipponbare callus to obtain rice ndf1 mutant materials.
[0055] Example 3: Identification of rice ndf1 mutants
[0056] The Ndf1 mutant rice obtained in Example 1 was used to extract genomic DNA. Primers for identifying mutant materials were designed, and the sense strand and antisense strand primers were about 500 bp upstream and downstream of the target site, respectively. The primer sequences were as follows:
[0057] F:AGAACTCCAAATGCTTGCT
[0058] R:TGTGCCCAACAATCTAAGAA
[0059] The fragment length was about 1000 bp and the annealing temperature was 58°C.
[0060] The reaction products were sequenced and the sequences were aligned. First, three stable genetic materials were obtained in the Nipponbare (NIP) background, named ndf1-1, ndf1-2 and ndf1-3. The specific mutation methods are shown in Figure 2 The above mutant materials and the corresponding wild-type and negative plants were planted in the same plot, and the field phenotypes were counted starting from the second generation of genetic stability.
[0061] Example 4: Field test of rice ndf1 mutant and application of growth period effect
[0062] In 2022 and 2023, rice was planted in Nanjing Baima (119°10'4"E, 31°37'16"N) for two consecutive years. The rice planting row spacing is 25cm, the spacing is 15cm, there is one plant in each hole, seven plants in each row, and seven rows in one statistical plot. Normal water, fertilizer, and pest and disease management in the field. The nitrogen application rate for high-nitrogen fields is 350kg / ha, and the nitrogen application rate for low-nitrogen fields is 150kg / ha. All rice materials are planted under the same conditions. The heading period is the number of days from sowing to the appearance of the first inflorescence above the sword leaf, and the heading period is observed and recorded every day. Among them, at least 3 strains of mutants were planted and counted. The plot where each strain was located was divided into four areas on average. Each area was regarded as a biological replicate of the strain. The time when 30% of the main ears of 50% of the plants in each area were pulled out was counted and recorded as the heading time of the area. The mean and standard deviation were calculated using SPSS. According to Figure 2 Under low nitrogen conditions, the heading date of the ndf1 mutant material was 4 days earlier than that of the NIP material on average; under high nitrogen conditions, the heading date of the ndf1 mutant material was 2 days earlier than that of the NIP material on average.
[0063] Example 5: Application of yield effect test of rice ndf1 mutant under low nitrogen and high nitrogen conditions
[0064] according to Figure 3 and Figure 4The phenotypes and statistical data of the ndf1 mutant at maturity showed that under low nitrogen conditions, the number of effective tillers of the ndf1 mutant material increased by an average of 4 compared with NIP, and the yield per plant increased by about 4 g compared with NIP; under high nitrogen conditions, the number of effective tillers of the ndf1 mutant material increased by an average of 3 compared with NIP. Finally, for the yield per plant under high nitrogen conditions, the ndf1 mutant material increased by an average of about 3 g compared with NIP.
[0065] Example 6: Application of nitrogen utilization efficiency effect test of rice ndf1 mutant
[0066] The same materials were used under the planting conditions in Example 3. Under both low nitrogen and high nitrogen conditions, the biomass of the ndf1 mutant material was significantly higher than that of the WT. The ndf1 mutant material and the corresponding wild type were dried at 105°C, then divided and boiled. The nitrogen concentration of each part was determined using the Kjeldahl method, and the nitrogen utilization efficiency was calculated using the following three formulas.
[0067] ①NUpE=total nitrogen content in aboveground parts / total amount of nitrogen fertilizer applied
[0068] ②NUtE=yield / total nitrogen content in aboveground parts
[0069] ③NUE=NUpE*NutE
[0070] Results Figure 5 Under low nitrogen conditions, the NUE of the ndf1 mutant material increased by an average of 8.7 Kg grain / Kg N compared with NIP; under high nitrogen conditions, the NUE of the ndf1 mutant material increased by an average of 2.4 Kg grain / Kg N compared with NIP.
Claims
1. Application of the rice micro-effect heading period gene Ndf1 in regulating rice growth period, yield and nitrogen use efficiency. The sequence of the rice micro-effect heading period gene Ndf1 is shown in SEQ ID No.
1.
2. The use according to claim 1, characterized in that: Application of rice micro-effect heading date gene Ndf1 in regulating rice growth period, yield and nitrogen use efficiency under high nitrogen or low nitrogen conditions.
3. The use according to claim 1 or 2, characterized in that: Knocking out the rice micro-effect heading date gene Ndf1 can advance the rice heading date, increase yield and increase nitrogen utilization efficiency.