Methylated ATAC-seq library construction reagent and method

Abstract

The invention relates to the technical field of biology, in particular to a methylated ATAC-seq library construction reagent and a methylated ATAC-seq library construction method. A methylated ATAC-seq library construction reagent and a methylated ATAC-seq library construction method are developed, the position of open chromatin and methylation state information of basic DNA are obtained at the same time through one-time library construction, the problems on two levels are solved through one experimental scheme, and meanwhile the advantages of being simple in experimental operation and short in period are further achieved on the premise that the detection effect is not sacrificed. Therefore, the method is a reliable chromatin active region methylation detection technology.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to reagents and methods for constructing a methylation ATAC-seq library. Background Art

[0002] Eukaryotic DNA exists in the form of chromatin, and its basic unit is the nucleosome. The nucleosome is a structure formed by about 147bp of DNA wrapped around a histone nucleus, and the nucleosomes are connected by connecting DNA. Histones can undergo chemical modifications such as methylation or acetylation, and cytosine (C) in DNA can also be methylated at the 5 end. In the interphase nucleus, chromatin can exist in two states: euchromatin and heterochromatin. Most of the chromatin is tightly wrapped in the cell nucleus and has no transcriptional activity. Chromatin remodeling can make some of the dense chromatin loose, and this part of the loose chromatin is called open chromatin or accessible chromatin. Chromatin accessibility is the degree to which macromolecules in the nucleus can physically contact chromatinized DNA, which is determined by the occupancy and topological structure of the nucleosome and other chromatin binding factors that hinder DNA accessibility. Although the accessible genome accounts for about 2-3% of the total DNA sequence, it contains more than 90% of the binding regions of TFs (transcription factors). Chromatin accessibility reflects the total regulatory potential of TF binding and genetic loci. Targeted sequencing of chromatin open regions can help us understand the transcriptional regulation process of cells and determine which genes are transcriptionally active in cells.

[0003] Currently, there are several methods for sequencing open chromatin:

[0004] DNase-seq (DNase I hypersensitive sites sequencing): quantifies the relative abundance of DNase-sensitive chromatin in the genome by sequencing after DNase cleavage. Directed cleavage of DHS sites in open regions without cleaving protected regions is used to infer the possible position of nucleosomes and changes in chromatin openness.

[0005] MNase-seq: Micrococcal nuclease sequencing uses the endonuclease / exonuclease MNase to cut and remove accessible DNA and sequence it. This technique can identify the role of histones in regulating chromatin accessibility.

[0006] Both methods require restriction enzymes. Their disadvantages are that the cut fragments are not complete open chromatin information and the cutting is biased.

[0007] Open chromatin is sensitive to transposases, which can randomly insert into unprotected DNA sequences (similar to DNase), but transposases cannot cut DNA like restriction endonucleases. Professor William Greenleaf developed the ATAC-seq (assay for transposase-accessible chromatin using sequencing) technology.

[0008] ATAC-seq: Uses a hyperactive transposase (Tn5) to simultaneously cut and attach adapters to accessible DNA and sequence. Because Tn5 does not have the ability to cut and can directly capture the sequence of the entire open region, ATAC-seq is now widely used in the sequencing of open chromosomes. In addition, this method has good technical stability, simple and fast operation, and is suitable for situations where samples are limited, such as clinical and primary tissues. ATAC-seq libraries can usually be constructed in less than 2 hours using 10,000 to 20,000 cells (there have been reports of using as few as 500 cells); in contrast, DNase-seq and MNase-seq usually require hundreds of thousands of cells and several days to complete.

[0009] Chromatin accessibility is established through the dynamic interaction between histones, TFs and active chromatin remodelers. However, these methods have enrichment bias and can only directly detect a certain characteristic of chromatin. They cannot obtain information on the methylation state with single-molecule characteristics of the active region of chromatin, etc. Therefore, they cannot explain and understand the methylation state more comprehensively. In addition, the existing methods for detecting chromatin accessibility and methylation state are complicated in experimental operation, long in cycle and poor in detection effect. Summary of the invention

[0010] In view of this, the technical problem to be solved by the present invention is to provide reagents and methods for constructing a methylation ATAC-seq library.

[0011] The invention provides a lysing solution, which comprises: 5mM-15mM Tris-HCl, 5mM-15mM NaCl, 2mM-5mM MgCl2 and 0.01vol%-0.1vol% Igepal CA-630.

[0012] Furthermore, the lysis solution comprises: 10 mM Tris-HCl, 10 mM NaCl, 3 mM MgCl2 and 0.1 vol% Igepal CA-630.

[0013] The lysis solution of the present invention can achieve instant lysis of cells, with a short lysis time, good lysis effect, and simple ingredients, and has obvious advantages over lysis solutions with other composition ratios.

[0014] The present invention provides a reagent combination, which comprises the lysis solution as described in the present invention and at least one of a transposition reagent, an end repair reagent, a bisulfite treatment reagent, a PCR amplification reagent or a single-chain loop cyclization reagent.

[0015] The present invention provides a kit, which comprises auxiliary materials and at least one of the following I) to II):

[0016] 1), the lysate of the present invention;

[0017] II), the reagent combination described in the present invention.

[0018] Furthermore, the auxiliary material includes one or a combination of two or more of a solid phase carrier, a washing reagent, an eluting reagent, a stabilizer, an antioxidant or a buffer.

[0019] The present invention provides the use of at least one of the following i) to iii) in the construction of a chromatin accessibility and / or methylation analysis library:

[0020] i), the lysate of the present invention;

[0021] ii), the reagent combination of the present invention;

[0022] iii), the kit described in the present invention.

[0023] The present invention provides a library construction method for chromatin accessibility and / or methylation analysis, comprising the following steps:

[0024] Single cells were lysed, transposed, end-repaired, and treated with bisulfite before PCR amplification to obtain amplified products;

[0025] The amplified products were purified and single-stranded circularized to obtain the chromatin accessibility and methylation analysis library.

[0026] The lysis is to lyse the cells using the lysis solution of the present invention;

[0027] The ratio of single cells to lysate is 80,000 to 120,000 cells / 50 μL;

[0028] The method further includes a washing step before lysis, wherein the washing solution is PBS buffer and the washing conditions are 4° C. and 500 g centrifugation for 4 minutes.

[0029] Furthermore,

[0030] The ratio of single cells to lysate was 100,000 / 50 μL;

[0031] The method further includes a centrifugation step after lysis and before transposition, wherein the centrifugation conditions are 4° C. and 500 g for 5 to 15 minutes.

[0032] In the library construction method of the present invention,

[0033] The transposition enzyme is Tn5 transposase, and the Tn5 transposase is methylated;

[0034] The transposition conditions are 37°C, 30 minutes;

[0035] The step of purification is also included after the end repair and before the bisulfite treatment, and the purification is performed using AMpureXP magnetic beads;

[0036] In the library construction method of the present invention,

[0037] The primers for PCR amplification are AD153-F and AD153-R; specifically, the nucleotide sequence of AD153-F is shown in SEQ ID NO: 1; the nucleotide sequence of AD153-R is shown in SEQ ID NO: 2.

[0038] The PCR amplification procedure is: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, 10 to 13 cycles; and complete extension at 72°C for 10 min.

[0039] In the library construction method of the present invention,

[0040] The single-chain ring cyclization includes the steps of heat denaturation and enzyme cleavage;

[0041] The steps of thermal denaturation are:

[0042] The amplified product is mixed with water to perform a first reaction to obtain a first reactant;

[0043] The first reactant is mixed with the heat denaturation mixture to perform a second reaction;

[0044] Furthermore,

[0045] The conditions of the first reaction are 95°C for 5 minutes;

[0046] The conditions of the second reaction are 37°C, 30 minutes;

[0047] The heat denaturation mixture includes 10×TA buffer, 0.1M ATP, 20μM Ad153 splint oligo, and 600U / μl T4 DNA Ligase.

[0048] The enzyme digestion described in the present invention is exo I and exo III digestion.

[0049] The present invention improves the conventional library construction method for chromatin accessibility and methylation analysis, combines TAC-seq and BS-seq technologies, and adjusts the reagents and steps to adapt them to the library construction method of the present invention. Therefore, the reagents and steps of the library construction method of the present invention are coordinated as a whole and affect the library construction effect.

[0050] The present invention also provides a chromatin accessibility and methylation analysis library constructed by the library construction method, and the library is used to provide a standard and reference for detecting chromatin accessibility and methylation of samples.

[0051] The present invention develops a methylation ATAC-seq library construction method and reagents, and obtains the location of open chromatin and the methylation status information of the underlying DNA through a single library construction. One experimental scheme solves two problems at two levels. At the same time, the present invention also has the advantages of simple experimental operation and short cycle. Therefore, the present invention is a reliable methylation detection technology for chromatin active regions. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 The PCR2100 result graph of sample 1 is shown;

[0053] Figure 2 The PCR2100 result graph of sample 2 is shown;

[0054] Figure 3 Shows the methylation consistency analysis between two samples;

[0055] Figure 4 Shows the fragment distribution of Matac-5 library;

[0056] Figure 5 Shows the fragment distribution of Matac-6 library;

[0057] Figure 6 Shows the peak consistency analysis diagram between two samples;

[0058] Figure 7 The peak distribution obtained based on conventional ATAC library construction is shown;

[0059] Figure 8 Figure 2 shows the peak distribution obtained based on the database constructed by this patent. DETAILED DESCRIPTION

[0060] The present invention provides reagents and methods for constructing methylated ATAC-seq libraries. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications of this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0061] The present invention provides a technology that can simultaneously detect chromatin accessibility and DNA methylation status without enrichment bias and single-molecule features. It is an improved and upgraded version of ATAC-seq, combining ATAC-seq and BS-seq to determine the location of open chromatin and the methylation status of the underlying DNA. In addition to providing information that can fully capture the entire open area, methylation information in the regulatory region can also be obtained. A more comprehensive understanding of chromatin accessibility from an epigenetic level provides an extensible biophysical template for the organization of open chromatin between promoters and gene bodies, and provides an important research method for how the components of the chromatin epigenome interact with each other through this template.

[0062] The main process of this technology is: the transposase with embedded methylation modified adapter sequence randomly interrupts the chromatin in the cells treated with lysate, and then connects the adapter sequence to the DNA in the open area. These sequences are then end-repaired, and the obtained DNA is treated with bisulfite, PCR amplified, and circularized into single-stranded loops. After high-throughput sequencing, a new generation sequencer is used, and finally chromatin accessibility and methylation information analysis are performed. This technical solution mainly consists of the following six parts: cell lysis, transposition reaction and purification, end repair, bisulfite treatment, library preparation, on-machine sequencing and data analysis; the library preparation includes PCR amplification and single-stranded loop circularization reaction.

[0063] Cell lysis: Cells are lysed using a prepared lysis buffer.

[0064] Transposition reaction and purification: Tn5 transposase with embedded methylated modified adapters was added to the lysed cells for transposition reaction, and the fragmented DNA was purified and recovered.

[0065] End repair: Perform end repair on DNA fragments with methylated adapters added.

[0066] Bisulfite treatment: The insert fragment with the adapter sequence was treated with bisulfite using the Zymo DNA methylation Gold kit.

[0067] PCR amplification: Bisulfite-converted DNA was amplified using KAPA HiFi HotStart Uracil polymerase.

[0068] Single-stranded ring cyclization reaction: After the amplified product is purified by magnetic beads, it is denatured into a single strand at high temperature, and the single strand is circularized under the action of Ad153splintoligo, T4 DNA Ligase and ATP. The circularized product is subjected to the action of exo I and exo III to obtain a single-stranded ring that can be sequenced on the machine.

[0069] Sequencing and data analysis: The single-chain circle library was sequenced on the BGI-seq 500 sequencing platform. Data analysis mainly includes data quality control, low-quality reads filtering, construction of methylation reference genome index, data alignment, detection of chromatin open region signal enrichment regions (Peak Calling), study of binding site (peak) genomic distribution characteristics, and methylation information extraction.

[0070] The methylation ATAC-seq (methy ATAC) described in the present invention is a sequencing method that can simultaneously perform chromatin accessibility and methylation analysis, also referred to as mATAC-seq.

[0071] The test materials used in the present invention are all common commercial products and can be purchased in the market.

[0072] The present invention will be further described below in conjunction with embodiments:

[0073] Example 1 Method for constructing mATAC-seq libraries of cell lines and animal tissues

[0074] 1. Cell preparation:

[0075] Select 100,000 fresh cells and distribute them into 1.5 ml centrifuge tubes. Add appropriate amount of PBS to resuspend, centrifuge at 500 g for 4 minutes at 4°C, discard the supernatant, and place on ice.

[0076] 2. Lysis solution preparation:

[0077] In a 1.5 ml centrifuge tube, add the reagents listed in Table 1 to prepare the lysis solution:

[0078] Table 1. Lysis buffer preparation system

[0079] Reagents Volume (μl) Final concentration 1M Tris-HCl, pH 7.5 0.5 10mM 1M NaCl 0.5 10mM <![CDATA[0.3M MgCl2]]> 0.5 3mM 10% Igepal CA-630 0.5 0.01vol% Nuclease-free water 48 - Total 50 -

[0080] After the prepared lysate is lightly shaken and mixed, 50 μl is added to the prepared cells, and the mixture is gently pipetted and mixed, and centrifuged at 4°C and 500 g for 10 minutes. The supernatant is discarded and the transposition reaction is prepared.

[0081] 3. Transposition reaction and purification

[0082] Place the lysed cells on ice and configure the transposition reaction system as shown in Table 2:

[0083] Table 2. Transposition reaction system

[0084] Reagents Volume (μl) 5×TAG Buffer 10 Tn5 transposase 2 Nuclease-free water 38 Unmethylated Lambda DNA 0.1 (final mass is 1ng) Total 50

[0085] Add 50 μl of the prepared transposition system to resuspend the cells, gently pipette to mix thoroughly, and then place in a metal bath at 37°C for 30 minutes with shaking at 300 rpm.

[0086] After the transposition reaction was completed, the DNA was recovered using the Qiagen purification kit (MinElute PCR Purification Kit) and finally dissolved in 21 μl elution buffer.

[0087] 4. End Repair

[0088] Place the purified DNA product on ice and prepare the following end repair reaction system:

[0089] Table 3. End repair reaction system

[0090] Reagents Volume (μl) NEB buffer 2 (10×) 2.5 Klenow fragment (3'->5'exo-) 1.5 10mM(dATP,dGTP,dTTP,and 5-mdCTP)Mix 2 Total 6

[0091] Add 6 μl of the prepared end repair system, mix thoroughly and place in a metal bath for 30 minutes at 37°C. After the reaction, add 2.0×AMpureXP magnetic beads to purify and recover the product, and finally dissolve it back in 21 μl of elution buffer, which is 75% ethanol.

[0092] 5. Bisulfite treatment:

[0093] Add 200 ng of fragmented exogenous λDNA to the end-repair purification product, and then add bisulfite treatment for 2 hours. Bisulfite treatment uses EZ DNA Methylation-Gold Kit TM (ZYMO), operate according to the instructions of the kit, and finally elute the product in 12 μl buffer (buffer in the kit).

[0094] 6. PCR amplification:

[0095] In the product obtained in the previous step, the reagents are as shown in Table 4:

[0096] Table 4. PCR amplification system

[0097] Reagents Volume (μl) DNA 10 2×KAPA HiFi HotStart Uracil+ReadyMix 25 AD153-F(25μM) 1.5 AD153-R(25μM) 1.5 <![CDATA[H2O]]> 12 Total 50

[0098] The sequence of AD153-F is: pGAACGACATGGCTACGATCCGACTT (as shown in SEQ ID NO: 1), where p is phosphorylation modification; the sequence of AD153-R is:

[0099] TGTGAGCCAAGGAGTTGTTGTCTTC (as shown in SEQ ID NO: 2).

[0100] After mixing, react according to the procedure in Table 5:

[0101] Table 5. PCR amplification program

[0102]

[0103] After the PCR reaction, the product was purified using 0.5× and 0.7× XP magnetic beads, 1 μl of the purified product was taken for 2100 detection, and 1 μl was used for quantitative detection using the Qubit ds DNA Hs Assay kit.

[0104] 7. Single-chain ring cyclization:

[0105] 1. Thermal denaturation:

[0106] Take 170ng of the above PCR product, add water to make up to 48.2μl system, mix well, react at 95℃ for 5 minutes, and then immediately place at 4℃. Add the reagents shown in Table 6 in sequence:

[0107] Table 6. Thermal denaturation reaction system

[0108]

[0109] After mixing, incubate at 37°C for 30 minutes.

[0110] 2.Exo I and Exo III digestion:

[0111] After the above reaction is completed, the reagents shown in Table 7 are used in sequence:

[0112] Table 7. Enzyme digestion system

[0113] Heat denaturation products 0.35 μl 10×TA buffer 0.4 μl 20U / μl exo I 1.95 μl 200U / μl exo III 0.65 μl <![CDATA[H2O]]> 0.65 μl Total 4 μl

[0114] After mixing, react at 37°C for 30 minutes, then purify and recover with 2.5X XP magnetic beads and dissolve in 42 μl of deionized water.

[0115] 8. Sequencing and data analysis:

[0116] The single-stranded circle library was subjected to double-end sequencing on the BGI seq-500 sequencing platform. The methylation information of the chromatin open region and the signal enrichment region detection (Peak calling) information were obtained through data analysis and comparison.

[0117] IX. Data Results:

[0118] 1. PCR 2100 result chart:

[0119] Depend on Figure 1 and Figure 2 It can be seen that the results of the two libraries 2100 show that the libraries contain the main peaks of a single nucleosome, two nucleosomes and three nucleosomes, indicating that the library constructed by the patented method can obtain reliable and accurate open region information.

[0120] 2. Information analysis results:

[0121] 2.1 Basic data analysis results:

[0122] After data filtering and quality control of the two samples, the basic data analysis results are shown in Table 8. The library alignment rate is between 32.6% and 42.7%, and the conversion efficiency of heavy sulfate is greater than 99%.

[0123] Table 8. Results of basic data analysis of two samples

[0124] Sample name Sequencing data read count Unique Matching Rate Heavy pressure sulfate conversion efficiency mATAC-5 32676944 42.7％ 99.18％ mATAC-6 23878982 32.6％ 99.23％

[0125] 2.2 Methylation information consistency analysis:

[0126] Figure 3 This is a methylation consistency evaluation diagram between the two samples. As shown in the figure, among the 69012 methylation sites covered by reads in two biological replicates, 59464 sites have consistent methylation status, with a consistency rate of 86.16%. The methylation information of the two is highly consistent, indicating good repeatability.

[0127] 2.3 Evaluation of the consistency of chromatin openness between different samples:

[0128] 2.3.1 Distribution of library fragments obtained by sequencing between different samples

[0129] like Figure 4 and Figure 5 As shown, the reads obtained from sequencing the two libraries showed obvious fragment distribution characteristics, which were consistent with the characteristic distribution of typical ATAC library fragments.

[0130] 2.3.2 Peak call consistency analysis between different samples:

[0131] The peak detected between the two samples was analyzed by IDR (Irreproducible Discovery Rate) to evaluate the repeatability of the experiment and the accuracy of the peak. Figure 6 As shown, black represents the peak detected by IDR, and red represents the peak not detected by IDR. It can be seen from the figure that the peak detected in sample 1 and the open area peak detected in sample 2 have good repeatability and consistency (IDR threshold p<0.05).

[0132] 2.3.3 Peak consistency analysis with conventional ATAC library construction:

[0133] like Figure 7 and Figure 8 As shown, the distribution of chromatin open regions in the genome identified by the conventional ATAC method is highly consistent with that identified in this patent.

[0134] In summary, the implementation of this patented method can simultaneously analyze the information of open chromatin regions and obtain methylation information, and has good repeatability and consistency, and can effectively identify the location of chromatin active regions and detect methylation status.

[0135] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A lysate, characterized in that include: 5mM~15mM Tris-HCl, 5mM~15mM NaCl, 2mM~5mM MgCl2 and 0.01vol%~0.1vol% Igepal CA-630.

2. The lysate according to claim 1, characterized in that include: 10 mM Tris-HCl, 10 mM NaCl, 3 mM MgCl2 and 0.1 vol% Igepal CA-630.

3. A reagent combination, characterized in that: The method comprises at least one of the lysis solution as claimed in claim 1 or 2 and a transposition reagent, an end repair reagent, a bisulfite treatment reagent, a PCR amplification reagent or a single-stranded ring cyclization reagent.

4. A kit comprising auxiliary materials and at least one of the following I) to II): 1), a lysate as claimed in claim 1 or 2; II), the reagent combination as claimed in claim 3.

5. The kit according to claim 4, characterized in that The auxiliary material includes one or a combination of two or more of a solid phase carrier, a washing reagent, an eluting reagent, a stabilizer, an antioxidant or a buffer.

6. Use of at least one of the following i) to iii) in the construction of a chromatin accessibility and / or methylation analysis library: i), a lysate according to claim 1 or 2; ii), the reagent combination as claimed in claim 3; iii) A kit according to claim 4 or 5.

7. A method for building a library for chromatin accessibility and / or methylation analysis, characterized in that: The steps include: Single cells were lysed, transposed, end-repaired, and treated with bisulfite before PCR amplification to obtain amplified products; The amplified products were purified and single-stranded circularized to obtain the chromatin accessibility and methylation analysis library. The lysis is to lyse the cells using the lysis solution as claimed in claim 1 or 2.

8. The library construction method according to claim 7, characterized in that: The ratio of single cells to lysate is 80,000 to 120,000 cells / 50 μL; The step of washing is also included before the lysis, the washing solution is PBS buffer, and the washing conditions are 4°C, 500g centrifugation for 4 minutes; The step of centrifugation is also included after lysis and before transposition, and the centrifugation conditions are 4°C, 500g centrifugation for 5 to 15 minutes; The transposition enzyme is Tn5 transposase, and the Tn5 transposase is methylated; The transposition conditions are 37°C, 30 minutes; The step of purification is also included after the end repair and before the bisulfite treatment, and the purification is performed using AMpureXP magnetic beads; The PCR amplification procedure is: 95°C pre-denaturation for 3 min; 95°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 30 s, 10 to 13 cycles; 72°C complete extension for 10 min; The single-chain ring cyclization includes the steps of heat denaturation and enzyme cleavage; The thermal denaturation step comprises: The amplified product is mixed with water to perform a first reaction to obtain a first reactant; The first reactant is mixed with the heat denaturation mixture to perform a second reaction; The conditions of the first reaction are 95°C for 5 minutes; The conditions of the second reaction are 37°C, 30 minutes; The heat denaturation mixture includes 10×TA buffer, 0.1M ATP, 20μM Ad153 splint oligo, and 600U / μl T4 DNA Ligase; The enzyme digestion is exo I and exo III.

9. A library for analyzing chromatin accessibility and / or methylation constructed according to the library construction method of claim 7 or 8.

10. Application of at least one of the following a) to e) in obtaining chromatin accessibility and / or DNA methylation information, determining chromatin open positions, and studying the interaction of chromatin epigenomic components: a), a lysate according to claim 1 or 2; b) The reagent combination as claimed in claim 3; c) a kit as claimed in claim 4 or 5; d), a library for analyzing chromatin accessibility and / or methylation constructed by the library construction method according to claim 7 or 8, e) The library for analyzing chromatin accessibility and / or methylation according to claim 9.

Images