KASP molecular marker primer combination related to cold demand of peaches and application of KASP molecular marker primer combination

Abstract

The invention discloses a KASP molecular marker primer combination related to cold demand of peaches and application of the KASP molecular marker primer combination, and a KASP molecular marker Chr06: 26042043 primer combination and a KASP molecular marker Chr01: 46470090 primer combination are designed by utilizing the single-base difference of 26th, 042nd and 043rd bases of a peach chromosome 6 and 466470090 bases of a peach chromosome 1, and the KASP molecular marker Chr06: 26042043 primer combination and the KASP molecular marker Chr01: 46470090 primer combination are designed by utilizing the single-base difference of the 26th, 042nd and 043rd bases of the peach chromosome 6. The combination of the two molecular marker primers can be used for rapidly and accurately identifying the genotype of the peach, so that the cold demand attribute of the peach can be preliminarily distinguished in the peach seedling stage. The two markers show relatively high specificity and predictive ability when detecting the cold demand attribute of the peach. By reducing time and labor cost and simultaneously realizing high-throughput detection of a plurality of samples, the method disclosed by the invention remarkably improves the detection efficiency and has important significance on breeding peaches with target cold demand.

Description

Technical Field

[0001] The invention relates to a group of KASP molecular marker primer combinations related to peach chilling requirement, and provides a combination for assisting in screening peaches with different high and low chilling requirements (target chilling requirement peaches) that meet breeding requirements, belonging to the field of molecular biology. Background Art

[0002] Peach (Prunus persica (L.) Batsch) is the third largest deciduous economic fruit tree in the world, mainly distributed in temperate regions between 30° and 45° north and south latitudes. Peach needs a certain amount of low temperature exposure (i.e., cold demand) during winter dormancy to promote the buds to break the internal dormancy and bloom and unfold leaves smoothly. In recent years, the global climate warming trend is obvious, and abnormal climate phenomena such as warm winter, late spring cold, and late frost occur frequently, which brings new challenges to peach trees that are sensitive to temperature changes. Peach with high cold demand cannot bloom and grow normally due to insufficient cold demand, and its planting area is shrinking, which also limits the development of the peach industry to the south; at the same time, although peach with low cold demand can adapt to climate warming and can be planted in the south, its early flowering and early leafing characteristics are more vulnerable to frost threats. In contrast, peach trees with high cold demand have the characteristics of late flowering and late leafing, which can avoid the harm of late spring cold, but their cold demand is high, which is not conducive to adapting to climate warming. In addition, facility cultivation can bring good economic benefits, especially in the north where the area is gradually expanding, so there is an urgent need to accurately control the cooling requirement to improve the early regulation technology. Therefore, climate change (including insufficient low temperature and / or abnormal temperature) and industrial adjustment (precise zoning cultivation, extension to the south and facility cultivation, etc.) have put forward new requirements for ensuring the sustainability of the peach industry. In order to ensure that peaches adapt to specific growth conditions and avoid flowering and leafing under non-optimal conditions, it is urgent to pay attention to the breeding of target cooling requirements and fully and quickly understand the high and low cooling requirements.

[0003] However, currently the chilling requirement can only be identified through years of observation after peach trees enter normal production, resulting in low breeding efficiency. Therefore, it is necessary to combine modern molecular marker-assisted selection technology to achieve early prediction of chilling requirement.

[0004] Marker-assisted breeding in fruit tree breeding relies on the identification of DNA patterns associated with traits. The application of peach reference genome, SNP arrays, and GBS has opened up the possibility of developing cost-effective and user-friendly molecular tools for marker-assisted selection. Competitive allele-specific PCR (KASP) testing has become the preferred method for developing SNP-specific DNA tests, which can quickly, economically, and reliably determine SNP genotypes. However, to date, DNA testing of peach is still very limited, and most involve fruit quality or disease resistance. Based on the reported QTLs related to chilling requirement, scholars have developed genotyping toolkits based on high-resolution melting analysis to predict chilling requirement. Recently, American researchers used four chilling requirement-related SNP markers in the chilling requirement QTL segment identified on chromosome 1 of the peach genome in previous studies to develop KASP DNA testing. These molecular markers can distinguish low, medium, and high chilling requirement alleles in Clemson University peach breeding materials. In addition, Chinese scholars used the 30bp deletion in the promoter of the key chilling requirement gene PpDAM6 to establish a PCR marker. This marker was verified by local natural populations and can be used to distinguish peaches with a chilling requirement of more than 500 hours and those with a chilling requirement of less than 500 hours.

[0005] These studies provide an important theoretical and methodological basis for the development of efficient molecular tools and marker-assisted breeding strategies for peach chilling requirement. However, chilling requirement is a quantitative trait, and its variation may be explained by multiple loci and affected by environmental and population changes. The stability and effectiveness of existing markers in larger populations, populations with more complex genetic backgrounds, or populations in different environments are well guaranteed, but stable and effective molecular auxiliary markers for peach chilling requirement are still lacking. Therefore, genomic prediction is needed to associate more variation related to the trait to ensure that DNA tests can accurately predict actual phenotypes and are applicable to various genetic and environmental backgrounds, thereby providing strong technical support for the breeding of target chilling peaches that meet various environmental and production requirements. Summary of the invention

[0006] The purpose of the present invention is to provide a group of KASP molecular marker primer combinations related to peach chilling requirement and applications thereof.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is:

[0008] A set of KASP molecular marker Chr06:26042043 primer combinations related to the chilling requirement of peach, the primer combination comprising a forward primer 1, a forward primer 2 and a common reverse primer, wherein the nucleotide sequence of the forward primer 1 is shown in SEQ ID No.1, the nucleotide sequence of the forward primer 2 is shown in SEQ ID No.2, and the nucleotide sequence of the common reverse primer is shown in SEQ ID No.3.

[0009] Another set of primer combinations for KASP molecular marker Chr01:46470090 related to the chilling requirement of peach, the primer combination includes forward primer 1, forward primer 2 and a common reverse primer, wherein the nucleotide sequence of forward primer 1 is shown in SEQ ID No.4, the nucleotide sequence of forward primer 2 is shown in SEQ ID No.5, and the nucleotide sequence of the common reverse primer is shown in SEQ ID No.6.

[0010] To distinguish different genotypes, different fluorescent signal labels are added to the 5' ends of forward primer 1 and forward primer 2 of the Chr06:26042043 primer combination and the Chr01:46470090 primer combination. Preferably, a FAM fluorescent signal label (GAAGGTGACCAAGTTCATGCT) is added to the 5' end of forward primer 1, and a VIC fluorescent signal label (GAAGGTCGGAGTCAACGGATT) is added to the 5' end of forward primer 2.

[0011] The invention also discloses the application of the above-mentioned KASP molecular marker Chr06:26042043 primer combination or the KASP molecular marker Chr01:46470090 primer combination in identifying the high or low cold requirement attribute of peach.

[0012] The high and low attributes of peach cooling requirement refer to the classification based on the size of the cooling requirement of peaches, which are specifically divided into low, medium, high and extremely high cooling requirement peaches, referring to peaches with cooling requirement <400h, 400h≤cooling requirement <600h, 600h≤cooling requirement <900h and cooling requirement ≥900h respectively.

[0013] Preferably, the steps include:

[0014] (1) Primer synthesis: synthesizing the above-mentioned KASP molecular marker Chr06:26042043 primer combination, or the above-mentioned KASP molecular marker Chr01:46470090 primer combination;

[0015] (2) DNA extraction: extracting genomic DNA from the peach to be identified;

[0016] (3) KASP reaction: using the genomic DNA extracted in step (2) as a template, and using the KASP molecular marker Chr06:26042043 primer combination or the KASP molecular marker Chr01:46470090 primer combination synthesized in step (1) to perform a KASP reaction;

[0017] (4) KASP product detection and analysis: Detect the genotyping of the amplified product and preliminarily determine the high or low chilling requirement of the peach based on the genotyping;

[0018] There is no requirement for the order of steps (1) and (2).

[0019] Preferably, the KASP reaction system is a 5 μl PCR reaction system, comprising 2.5 μl 2*KASP master mix, 1.25 μl primer combination and 1.25 μl genomic DNA; the reaction procedure of step (3) is: pre-denaturation at 95°C for 10 min, 1 cycle; denaturation at 95°C for 20 s; annealing and extension at 61-55°C for 60 s, for a total of 10 cycles; denaturation at 95°C for 20 s, annealing and extension at 55°C for 60 s, for a total of 27 cycles; reading at 25°C for 30 s, for 1 cycle.

[0020] The present invention also discloses the application of a molecular marker primer combination in identifying the high or low chilling requirement of peaches, wherein the molecular marker primer combination is a combination of two groups of KASP molecular marker primer combinations, namely, the KASP molecular marker Chr06:26042043 primer combination and the KASP molecular marker Chr01:46470090 primer combination, which can more accurately identify the high or low chilling requirement of peaches.

[0021] The invention also discloses a kit containing the primer combination as described above.

[0022] The present invention utilizes the single base difference between the 26,042,043 base of peach chromosome 6 and the 46,470,090 base of chromosome 1 to design a primer combination of KASP molecular marker Chr06:26042043 and a primer combination of KASP molecular marker Chr01:Chr01:46470090. A FAM fluorescent signal label is added to the 5' end of the forward primer 1 of the molecular marker Chr06:26042043 and Chr01:46470090, and a VIC fluorescent signal label is added to the 5' end of the forward primer 2. The genotype is determined according to the proportion of the fluorescent signal.

[0023] The peach genotypes identified by the Chr06:26042043 marker include C:C, C:T, and T:T, respectively. Specifically, if base C is detected at the site, it is the allele type connected to the FAM fluorescent label sequence. At this time, the FAM fluorescent signal accounts for a high proportion, and the configuration of the peach to be tested is determined to be the homozygous genotype C:C; if base T is detected, it is the allele type connected to the VIC fluorescent label sequence. The proportion of the VIC fluorescent signal is high, and the configuration of the peach to be tested is determined to be the homozygous genotype T:T; if bases T and C are detected at the same time, it is an intermediate type that is simultaneously connected to the FAM fluorescent label sequence and the VIC fluorescent label sequence, and the configuration of the peach to be tested is determined to be the heterozygous genotype C:T.

[0024] The peach genotypes identified by the Chr01:46470090 marker include T:T, T:C, and C:C, respectively. Specifically, if base T is detected at the SNP site, it is the allele type connected to the FAM fluorescent label sequence, and the FAM fluorescent signal accounts for a high proportion, then the configuration of the peach to be tested is determined to be the homozygous genotype T:T; if base C is detected, it is the allele type connected to the VIC fluorescent label sequence, and the VIC fluorescent signal accounts for a high proportion, then the configuration of the peach to be tested is determined to be the homozygous genotype C:C; if bases T and C are detected at the same time, it is an intermediate type that is simultaneously connected to the FAM fluorescent label sequence and the VIC fluorescent label sequence, then the configuration of the peach to be tested is determined to be the heterozygous genotype T:C.

[0025] The present invention uses molecular markers to quickly and accurately identify the genetic typing of peaches at this site, thereby preliminarily determining the high and low cold requirement attributes of peaches. The present invention can preliminarily and quickly distinguish the cold requirement attributes of peaches at the peach seedling stage by identifying genetic typing, reducing time and labor costs while being able to high-throughput test multiple samples, greatly improving the detection efficiency, and playing an important role in breeding target cold-requirement peaches. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Sequences and ideas used to design primers.

[0027] Figure 2 This is a schematic diagram of the typing results of the KASP molecular marker Chr06:26042043 in Example 2.

[0028] Figure 3 This is the cooling requirement distribution of different genotypes in Example 2.

[0029] Figure 4 This is a schematic diagram of the typing results of the KASP molecular marker Chr01:46470090 in Example 3.

[0030] Figure 5 This is the cooling requirement distribution of different genotypes in Example 3.

[0031] Figure 6 First-generation sequencing (Sanger sequencing) site SNP typing of the positive control of two KASP molecular markers. DETAILED DESCRIPTION

[0032] The specific implementation modes of the present invention are further described below in conjunction with the accompanying drawings, but the description of the embodiments does not impose any limitation on the protection scope of the present invention.

[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by technicians in the technical field to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0034] Unless otherwise specified, the materials and instruments used in the following examples can be obtained from conventional commercial channels.

[0035] Example 1 Design of primer combination for KASP detection of molecular markers

[0036] The upstream and downstream sequences of the SNPs at position 26,042,043 of chromosome 6 and position 46,470,090 of chromosome 1 were searched, and the KASP primers Chr06:26042043 and KASP primers Chr01:46470090 were designed respectively using Primer Premier 5.0 software to detect peach genotypes with different chilling requirements. KASP primers Chr06:26042043 and KASP primers Chr01:46470090 were designed in the 5'-3' direction of the sequence. The design ideas are as follows: Figure 1 The designed primer sequences are shown in Table 1. Figure 1 In the figure, the blue bottom marks Chr06_26042043-forward primer (SEQ ID No.1 and SEQ ID No.2), the yellow bottom marks Chr06_26042043-common reverse primer (SEQ ID No.3); the purple bottom marks Chr01:46470090 forward primer (SEQ ID No.4 and SEQ IDNo.5), and the brown bottom marks Chr01:46470090-common reverse primer (SEQID No.6).

[0037] To distinguish different genotypes, FAM fluorescent signal tags (GAAGGTGACCAAGTTCATGCT) were added to the 5' ends of Chr06:26042043 forward primer 1 and Chr01:46470090 forward primer 1, and VIC fluorescent signal tags (GAAGGTCGGAGTCAACGGATT) were added to the 5' ends of Chr06:26042043 forward primer 2 and Chr01:46470090 forward primer 2. The primer combination sequence can specifically bind to the corresponding sequence upstream and downstream of the SNP site.

[0038] The KASP primer Chr06:26042043 primer combination and the KASP primer Chr01:46470090 primer combination are prepared by diluting the respective forward primer 1, forward primer 2 and common reverse primer to 10 μM with TE (pH 8.0), and then mixing the respective forward primer 1: forward primer 2: common reverse primer = 1:1:3.

[0039] Table 1 KASP primer Chr06:26042043 and KASP primer Chr01:46470090 sequences

[0040] Chr06:26042043-Forward Primer 1 CAGTGGTATGGCTGGGAACAAGAC(SEQ ID No.1) Chr06:26042043-Forward Primer 2 CAGTGGTATGGCTGGGAACAAGAT(SEQ ID No.2) Chr06:26042043-shared reverse primer AAGTTCGATGCTCTCTCCTTAGAC(SEQ ID No.3) Chr01:46470090-Forward Primer 1 AAAATAAATCGTATCGCCGGGCAGT(SEQ ID No.4) Chr01:46470090-Forward Primer 2 AAAATAAATCGTATCGCCGGGCAGC(SEQ ID No.5) Chr01:46470090-shared reverse primer AAAACACAGAGTATAGCCGGTTGG(SEQ ID No.6)

[0041] Example 2 Application of KASP molecular marker Chr06:26042043

[0042] 287 peaches with rich genetic backgrounds (including cultivars, local varieties and wild resources from China, the United States, Thailand and other countries, and belonging to common peach, Gansu peach, mountain peach and Xinjiang peach germplasm types) were used as test materials to determine the chilling requirement (Table 2), of which 39 peaches with low chilling requirements, 62 peaches with medium chilling requirements, 164 peaches with high chilling requirements, and 22 peaches with extremely high chilling requirements. DNA from 287 peach materials was extracted using the CTAB method, and the entire batch of DNA samples was diluted to a concentration between 1-9 ng / μL in proportion.

[0043] The peach genotype detection was performed using the KASP primer Chr06:26042043 provided in Example 2, and the reaction system was as follows:

[0044] A 5 μl PCR reaction system was used, including 2.5 μl 2*KASP master mix, 1.25 μl primer combination and 1.25 μl diluted sample DNA (Note: 1.25 μl buffer TE was used instead of sample DNA in the negative control; the positive control was selected from peach materials that were subjected to site SNP typing using first-generation sequencing (Sanger sequencing) (included in these 287 peach samples, including C:C genotype peach 'Yuxia Pantao' and T:T genotype peach 'Yejihong' (SNP typing diagram see Figure 6 )), PCR analysis was performed according to the instructions of CFX ConnectTM Real-Time System (Bio-Rad, USA). The PCR reaction program was as follows: pre-denaturation at 95°C for 10 min, 1 cycle; denaturation at 95°C for 20 s; annealing and extension at 61-55°C for 60 s, 10 cycles in total; denaturation at 95°C for 20 s, annealing and extension at 55°C for 60 s, 27 cycles in total; reading at 25°C for 30 s, 1 cycle.

[0045] Three genotypes were detected using KASP primers Chr06:26042043, namely CC, CT and TT. The relevant typing results are shown in Figure 2-3 and Table 2. Figure 2 It can be seen that the genotype is determined by detecting two fluorescence intensities in the KASP product. Each point in the figure represents a sample of material to be tested. For easy observation, the genotypes represented by various points in the figure are marked. The red point represents the homozygous genotype C:C, the blue point represents the homozygous genotype T:T, the green point represents the heterozygous genotype C:T, and the black point represents the negative control; among the 287 samples, 149 strains were of C:C genotype, 96 strains were of T:T genotype, and 42 strains were of C:T genotype.

[0046] Table 2 The chilling requirement of the tested peach and the genotype detected by KASP molecular marker Chr06:26042043.

[0047]

[0048]

[0049]

[0050] Depend on Figure 3 As shown in Table 2, the average chilling requirement of peaches with genotype C:C is 569h; the average chilling requirement of peaches with genotype C:T is 711h; the average chilling requirement of peaches with genotype TT is 719h. According to the results of the independent sample t test, there is no significant difference in chilling requirement between peaches with genotype C:T and T:T, but both are significantly higher than peaches with genotype C:C (p < 0.01), which is statistically significant. There are 149 peaches with genotype C:C, including 34 peaches with low chilling requirement, 43 peaches with medium chilling requirement, 72 peaches with high chilling requirement, and 0 peaches with extremely high chilling requirement. There are 139 peaches with genotype C:T and T:T, including 5 peaches with low chilling requirement, 19 peaches with medium chilling requirement, 93 peaches with high chilling requirement, and 22 peaches with extremely high chilling requirement.

[0051] Example 3 Application of KASP molecular marker Chr01:46470090

[0052] 287 peaches with rich genetic background (including cultivars, local varieties and wild resources from China, the United States, Thailand and other countries, and belonging to common peach, Gansu peach, mountain peach and Xinjiang peach and other germplasm types) were used as test materials to determine the cold requirement (Table 3), among which the number of peaches with low cold requirement was 39, the number of peaches with medium cold requirement was 62, the number of peaches with high cold requirement was 164, and the number of peaches with extremely high cold requirement was 22. DNA of 287 peach materials was extracted by CTAB method, and the whole batch of DNA samples was diluted to a concentration of 1-9 ng / μL in proportion. Peach genotype detection was performed using KASP primer Chr01:46470090 provided in Example 1, and the reaction system was as follows:

[0053] A 5 μl PCR reaction system was used, including 2.5 μl 2*KASP master mix, 1.25 μl primer combination and 1.25 μl diluted sample DNA (Note: 1.25 μl buffer TE was used instead of sample DNA in the negative control; the positive control was selected from peach materials that were subjected to site SNP typing using first-generation sequencing (reverse sequencing) (included in these 287 peach samples, including C:C genotype peach 'Flordaglo' and T:T genotype peach 'Feicheng Baili' (SNP typing diagram see Figure 6 )), PCR analysis was performed according to the instructions of CFX ConnectTM Real-Time System (Bio-Rad, USA). The PCR reaction program was as follows: pre-denaturation at 95°C for 10 min, 1 cycle; denaturation at 95°C for 20 s; annealing and extension at 61-55°C for 60 s, 10 cycles in total; denaturation at 95°C for 20 s, annealing and extension at 55°C for 60 s, 27 cycles in total; reading at 25°C for 30 s, 1 cycle.

[0054] KASP primer Chr01:46470090 detected three genotypes, namely T:T, T:C and C:C. Figure 4-5 and Table 3. Figure 4 It can be seen that the genotype is determined by detecting the two fluorescence intensities in the KASP product. Each point in the figure represents a sample of the material to be tested. For easy observation, the genotypes represented by the various points in the figure are marked. The red point represents the homozygous genotype T:T, the blue point represents the homozygous genotype C:C, the green point represents the heterozygous genotype T:C, and the black point represents the negative control; there are 259 samples of the T:T genotype, 13 samples of the C:C genotype, and 15 samples of the T:C genotype.

[0055] Table 3 Chilling requirement of the tested peach and genotype detected by KASP molecular marker Chr01:46470090.

[0056]

[0057]

[0058]

[0059]

[0060] Depend on Figure 5 As shown in Table 3, the average chilling requirement of peaches with genotype C:C is 367h; the average chilling requirement of peaches with genotype T:C is 314h; the average chilling requirement of peaches with genotype T:T is 673h. According to the results of the independent sample t test, there is no significant difference in chilling requirement between peaches with genotype C:C and T:C, but both are significantly lower than peaches with genotype T:T (p < 0.01), which is statistically significant. There are 28 peaches with genotype C:C and T:C, including 21 peaches with low chilling requirement, 6 peaches with medium chilling requirement, 1 peaches with high chilling requirement, and 0 peaches with extremely high chilling requirement. There are 259 peaches with genotype T:T, including 18 peaches with low chilling requirement, 56 peaches with medium chilling requirement, 163 peaches with high chilling requirement, and 22 peaches with extremely high chilling requirement.

[0061] Table 4: The effect of two molecular markers on the classification of peach chilling requirement

[0062]

[0063] Note: The proportion refers to the proportion of the number of peaches of a certain level of cold requirement identified by a certain marker and a certain genotype in the total number of peaches identified by this marker and this genotype, which is equal to the number of peaches of a certain level of cold requirement identified by a certain marker and a certain genotype / the total number of peaches identified by this marker and this genotype*100%; the identification success rate refers to the success probability of a certain marker and a certain genotype identifying peaches of a certain level of cold requirement, which is equal to the number of peaches of a certain level of cold requirement identified by a certain marker and a certain genotype / the actual total number of peaches of that level of cold requirement*100%.

[0064] Based on the data analysis and arrangement in Table 4, the identification effects of different genotypes of two KASP molecular markers (Chr06:26042043 and Chr01:46470090) on peach trees with different high and low chilling requirements were clearly summarized.

[0065] Among the C:C genotype samples marked by Chr06:26042043, peaches with low cold requirement accounted for 22.8%, and the identification success rate of peaches with this cold requirement attribute was 87.2%. Therefore, this genotype is very suitable for breeding peaches with low cold requirement; peaches with medium cold requirement accounted for 28.9%, and the identification success rate was 69.4%, indicating that this genotype also has a good identification ability for peaches with medium cold requirement; peaches with high cold requirement accounted for 48.3%, and the identification success rate decreased to 43.9%, and the identification ability for peaches with high cold requirement was relatively low; peaches with extremely high cold requirement accounted for 0%, and this genotype could not identify peaches with extremely high cold requirement. Therefore, the identification effect of the C:C genotype is mainly concentrated on peaches with low and medium cold requirement, and the identification ability gradually weakens with the increase of cold requirement, especially for peaches with extremely high cold requirement.

[0066] Among the samples of C:T and T:T genotypes marked by Chr06:26042043, the proportion of peaches with low cold requirement was only 3.6%, and the identification success rate was also low, only 12.8%, indicating that this genotype does not have a good identification ability for peach trees with low cold requirement; the proportion of peaches with medium cold requirement was 13.7%, and the identification success rate was 30.6%, and the identification effect on peach trees with medium cold requirement was also relatively limited. The proportion of peaches with high cold requirement increased to 66.9%, and the identification success rate was 56.1%. This genotype has a good identification effect on peaches with high cold requirement. For peach tree samples with extremely high cold requirement, although the proportion was only 15.8%, the identification success rate reached 100%, indicating that the C:T and T:T genotypes are very suitable for identifying peach trees with extremely high cold requirement. Therefore, the C:T and T:T genotypes are mainly used for the identification of peach trees with high cold requirement and extremely high cold requirement, especially when identifying peach trees with extremely high cold requirement.

[0067] Among the C:C and T:C genotype samples marked by Chr01:46470090, the proportion of peaches with low cold requirements was as high as 75%, and the identification success rate was 53.8%, which shows that this genotype is suitable for the screening of peach trees with low cold requirements; the proportion of samples with medium cold requirements was 21.4%, but the identification success rate was only 9.7%, and the identification effect on peach trees with medium cold requirements was weak. The proportion of samples with high cold requirements and extremely high cold requirements and the identification success rate were very low, and these peach trees with high or extremely high cold requirements could not be effectively identified. Therefore, the C:C and T:C genotypes are suitable for the screening of peach trees with low cold requirements (cold requirements <400h), but the identification ability of peach trees with medium, high and extremely high cold requirements (cold requirements ≥400h) is poor.

[0068] Among the samples of T:T genotype marked by Chr01:46470090, the proportion of peaches with low cold requirement was 7%, and the identification success rate was 46.2%. Although it was relatively low, it still had a certain identification ability. The proportion of samples with medium cold requirement was 21.6%, and the identification success rate was as high as 90.3%, which showed that the T:T genotype was very suitable for the identification of peach trees with medium cold requirement. The proportion of samples with high cold requirement was 62.9%, and the identification success rate was 99.4%. This genotype was very accurate in the identification of peach trees with high cold requirement. Although the proportion of samples with cold requirement CR ≥ 900h was only 8.5%, its identification success rate reached 100%, indicating that the T:T genotype had extremely high identification efficiency for peach trees with extremely high cold requirement. Therefore, the T:T genotype is suitable for the screening of peach trees with medium, high and extremely high cold requirement (cold requirement ≥ 400h), especially in the high cold requirement and extremely high cold requirement range, it showed very high identification ability.

[0069] In summary, the C:C genotype of Chr06:26042043 and the C:C and T:C genotypes of Chr01:46470090 can be used to identify peach trees with low chilling requirements, while the C:T and T:T genotypes of Chr06:26042043 and the T:T genotype of Chr01:46470090 provide very accurate identification capabilities for peach trees with medium, high and extremely high chilling requirements. The two KASP molecular markers can be directly applied to molecular breeding programs to accelerate the breeding process by screening peach breeding materials and new varieties with different CR levels.

[0070] In breeding, two markers can also be used in combination to improve the identification success rate of the target cold-requirement peach and accurately distinguish and cultivate it. For example, when cultivating low-cold-requirement peaches, the KASP molecular marker Chr06:26042043 and the KASP molecular marker Chr01:46470090 are used in combination. First, the C:C genotype of the KASP molecular marker Chr06:26042043 is used with a high probability (identification success rate of 87.2%) to lock in the low-cold-requirement peach material, and then the KASP molecular marker Chr01:46470090 C:C and T:C genotypes are used to accurately identify most of the low-cold-requirement peaches (accounting for 75%), greatly improving the probability and accuracy of obtaining low-cold-requirement peaches.

[0071] The molecular markers provided by the present invention will show important reference and application prospects in different breeding projects in peach-growing areas around the world.

[0072] Although the present invention is disclosed as above, the present invention is not limited thereto. Any person skilled in the art can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the scope defined by the claims.

Claims

1. A set of KASP molecular marker Chr06:26042043 primer combinations related to peach cold requirement, characterized in that: It comprises a forward primer 1, a forward primer 2 and a common reverse primer, wherein the nucleotide sequence of the forward primer 1 is shown as SEQ ID No.1, the nucleotide sequence of the forward primer 2 is shown as SEQ ID No.2, and the nucleotide sequence of the common reverse primer is shown as SEQ ID No.

3.

2. The KASP molecular marker Chr06:26042043 primer combination according to claim 1, characterized in that: Different fluorescent signal labels are added to the 5' end of forward primer 1 and forward primer 2, respectively.

3. A set of primer combinations of KASP molecular marker Chr01:46470090 related to peach cold requirement, characterized in that: It comprises a forward primer 1, a forward primer 2 and a common reverse primer, wherein the nucleotide sequence of the forward primer 1 is shown as SEQ ID No.4, the nucleotide sequence of the forward primer 2 is shown as SEQ ID No.5, and the nucleotide sequence of the common reverse primer is shown as SEQ ID No.

6.

4. The KASP molecular marker Chr01:46470090 primer combination according to claim 3, characterized in that: Different fluorescent signal labels are added to the 5' end of forward primer 1 and forward primer 2, respectively.

5. Use of the KASP molecular marker Chr06:26042043 primer combination described in claim 1 or 2, or the KASP molecular marker Chr01:46470090 primer combination described in claim 3 or 4 in identifying the high or low chilling requirement of peach.

6. The use according to claim 5, characterized in that: The steps include: (1) Primer synthesis: synthesizing the KASP molecular marker Chr06:26042043 primer combination described in claim 1 or 2, or the KASP molecular marker Chr01:46470090 primer combination described in claim 3 or 4; (2) DNA extraction: extracting genomic DNA from the peach to be identified; (3) KASP reaction: using the genomic DNA extracted in step (2) as a template, and using the KASP molecular marker Chr06:26042043 primer combination synthesized in step (1) or the KASP molecular marker Chr01:46470090 primer combination described in claim 3 or 4 to perform a KASP reaction; (4) KASP product detection and analysis: Detect the genotyping of the amplified product and preliminarily determine the high or low chilling requirement of the peach based on the genotyping; There is no requirement for the order of steps (1) and (2).

7. Application of a molecular marker primer combination in identifying the high or low chilling requirement of peach, wherein the molecular marker primer combination comprises the KASP molecular marker Chr06:26042043 primer combination described in claim 1 or 2, and the KASP molecular marker Chr01:46470090 primer combination described in claim 3 or 4.

8. A kit, characterized in that: It comprises one or two sets of the KASP molecular marker Chr06:26042043 primer combination described in claim 1 or 2 and the KASP molecular marker Chr01:46470090 primer combination described in claim 3 or 4.

Images