Application of NFE2L2 inhibitor in preparation of medicine for inhibiting growth of endometriosis focus

Abstract

The invention discloses an application of an NFE2L2 inhibitor in preparation of a medicine for inhibiting growth of an endometriosis focus. The NFE2L2 inhibitor is ML385. It is proved for the first time that expression of the NFE2L2 in different types of endometriosis focuses (endometriosis focuses, ovarian endometriosis focuses and deep endometriosis focuses) is increased, and inhibition of the NFE2L2 can reduce the resistance of cells to an oxidative stress environment, increase ferroptosis sensitivity and reduce the viability of the cells; by applying the ML385, the growth of an endometriosis focus can be obviously inhibited, and a new treatment strategy is provided for treating the endometriosis.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to the use of an NFE2L2 inhibitor in the preparation of a drug for inhibiting the growth of endometriosis lesions. Background Art

[0002] Endometriosis (EM) is a disease in which endometrial tissue (glands and stroma) with growth function appears outside the mucosa of the uterine cavity. It is estimated that about 190 million women worldwide suffer from endometriosis, and the prevalence rate among infertile women can be as high as 50%. The clinical manifestations of endometriosis may include progressive dysmenorrhea, dyspareunia, menstrual abnormalities and infertility, which seriously affect women's health and quality of life.

[0003] Drug therapy plays a major role in the long-term management of endometriosis. Currently, mainstream drugs for EM are all related to antagonizing the effects of estrogen, such as combined oral contraceptives, high-efficiency progestins such as dienogest, levonorgestrel intrauterine releasing system, gonadotropin-releasing hormone agonists, etc. Long-term use of sex hormone drugs inhibits ovulation, and it is impossible to prepare for pregnancy during medication. However, completing childbearing is the main demand of many endometriosis patients to seek medical treatment, so the use of the above drugs is naturally contrary to this purpose. In addition, long-term use of sex hormone drugs requires vigilance against the risks of thromboembolism, bone loss, breast disease and even breast cancer. However, after stopping the drug, patients face the risk of symptom and disease recurrence. Therefore, it is urgent to find new non-sex hormone drugs to treat endometriosis.

[0004] ML385, as a recognized NFE2L2 inhibitor, can bind to NFE2L2 and inhibit the expression of its downstream target genes. Specifically, ML385 binds to the "N" cap collar basic leucine zipper (CNC-bZIP) Neh1 domain of NFE2L2, thereby interfering with the binding of the V-MafMAFG-NRF2 protein complex to the regulatory DNA binding sequence. ML385 has been used in many molecular biological studies as an NFE2L2 inhibitor, and there have been reports of ML385 regulating the body's oxidative stress protection or chemotherapy resistance in animal experiments. However, there are currently no reports on the use of ML385 in endometriosis and the inhibition of ectopic lesion growth. Summary of the invention

[0005] The purpose of the present invention is to provide an application of a NFE2L2 inhibitor in the preparation of a drug for inhibiting the growth of endometriosis lesions in view of the deficiencies in the prior art.

[0006] To achieve the above object, the technical solution adopted by the present invention is:

[0007] The first aspect is to provide the use of NFE2L2 inhibitors in the preparation of drugs for inhibiting the growth of endometriosis lesions.

[0008] Furthermore, the NFE2L2 inhibitor is ML385.

[0009] Furthermore, the drug for inhibiting the growth of endometriosis lesions also includes pharmaceutically acceptable excipients.

[0010] The second aspect is to provide a composition for use in preparing a drug for inhibiting the growth of endometriosis lesions, wherein the composition includes a NFE2L2 inhibitor.

[0011] Furthermore, the NFE2L2 inhibitor is ML385.

[0012] The present invention adopts the above technical solution, and has the following technical effects compared with the prior art:

[0013] The present invention demonstrates for the first time that NFE2L2 expression is elevated in different types of endometriosis lesions (peritoneal endometriosis lesions, ovarian endometriosis lesions, deep endometriosis lesions), and that inhibition of NFE2L2 can reduce the resistance of cells to oxidative stress, increase sensitivity to ferroptosis, and reduce cell viability; administration of ML385 can significantly inhibit the growth of endometriosis lesions, providing a new therapeutic strategy for the treatment of endometriosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 The results of the immunohistochemical analysis of NFE2L2 in human tissues in Example 1 are shown.

[0015] Figure 2 The results of the human endometrial stromal cell (HESC) related experiments in Example 2 are shown, wherein A is RT-qPCR (left) and Western Blot (right); B is the cell proliferation experiment result; C is the lipid oxidation experiment result; and D is the lipid peroxidation level analysis result.

[0016] Figure 3 The results of lesion changes in endometriosis mice after administration of ML385 in Example 3 are shown; wherein A is a photo of lesion tissue; B is the statistical result of lesion tissue weight change; and C is the statistical result of lesion tissue diameter change. DETAILED DESCRIPTION

[0017] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments, but is not intended to be limiting of the present invention. It should be noted that the embodiments and features in the embodiments of the present invention may be combined with each other without conflict.

[0018] The present invention provides the use of ML385 as a NFE2L2 (Nrf2, nuclear factor erythroid 2-related factor 2) inhibitor in inhibiting the growth of endometriosis lesions. The specific verification experiment is as follows. The reagents and raw materials used in the following examples are commercially available or can be prepared according to literature methods.

[0019] Example 1

[0020] Immunohistochemical analysis of NFE2L2 in human tissues:

[0021] 1) Fresh tissues were fixed with 4% paraformaldehyde at 4°C for 24 hours. The tissues were trimmed appropriately and placed in a dehydration box.

[0022] 2) Place the dehydration box in a dehydrator for gradient ethanol dehydration, and finally melt the paraffin at 65°C for 1 hour, repeating 3 times.

[0023] 3) Embed the waxed tissue in an embedding machine. Cool it in a -20℃ freezer. After the wax solidifies, take the wax block out of the embedding frame and trim it. Place it in a paraffin slicer for slicing.

[0024] 4) Bake the paraffin sections at 60°C for 30 minutes, and then dewax and hydrate them according to the steps.

[0025] 5) Immerse the slices in antigen retrieval solution preheated to 100°C and place in a 100°C water bath for 15-20 minutes. Remove the slices and cool at room temperature for 1 hour. Wash in PBS solution 3 times, 5 minutes each time.

[0026] 6) Add hydrogen peroxide to the slices, incubate at room temperature for 10 minutes, and then wash in PBS solution three times, each time for 5 minutes.

[0027] 7) Add blocking solution, incubate at room temperature for 5 minutes, and then wash in PBS solution 3 times, 5 minutes each time.

[0028] 8) Add primary antibody diluted to a specific ratio and incubate overnight at 4°C in a humidified chamber.

[0029] 9) The next day, remove the wet box, discard the primary antibody, and wash three times in 1× PBST solution, 5 minutes each time;

[0030] 10) Add an antibody-amplifying agent, incubate for 10 minutes, and then wash three times in 1× PBST solution, 5 minutes each time;

[0031] 11) Add enzyme-labeled secondary antibody polymer, incubate in dark for 10 minutes, and then wash in 1× PBST solution 3 times, 5 minutes each time;

[0032] 12) Prepare DAB color developing solution, observe the color development of tissue sections under a microscope to control the color development time (about 1-3 minutes), and immerse in ddH 2O to stop color development; counterstain with hematoxylin for 30 seconds, and wash with tap water for 20 minutes.

[0033] 13) Follow the steps to dehydrate, make transparent, and seal the slides with neutral gum.

[0034] 14) Image analysis: Observe the sections under a microscope and collect images. The H-score method was used to perform semi-quantitative analysis of protein expression levels: the scoring parameters were strong (3×), medium (2×), and weak (1×) to determine the staining intensity, and the percentage of different staining intensity areas in the entire image was estimated. The H-score was calculated according to the following formula: H-score = 1× (% cells 1×) + 2× (% cells 2×) + 3× (% cells 3×), with a score between 0 and 300. The H-score was independently evaluated by 2 researchers at different times, and the average of the two was taken as the final H-score.

[0035] The results are as follows Figure 1 As shown, compared with the eutopic endometrium (EU), the expression of NFE2L2 in endometrial stromal cells in peritoneal endometriosis (PE), ovarian endometriosis (OE), and deep endometriosis (DE) tissues was increased.

[0036] Example 2

[0037] 2.1 siRNA transfection into cells and verification of transfection efficiency

[0038] (1) Transfection: RNAi products were purchased from Jima Gene, including siRNA NFE2L2-Homo-530, NFE2L2-Homo-809, negative control, β-actin positive control and DEPC water. According to the instructions, the siRNA and control tubes were centrifuged at 15000g for 30 seconds, 125μL DEPC water was added to each tube of the positive control tube and siRNA NFE2L2-Homo-530 and NFE2L2-Homo-809, and 62.5μL DEPC water was added to the negative control tube. After standing for 1 minute, pipetting was performed to mix, and the cells were stored at -20°C or used directly in subsequent experiments. Transfection was performed when the cell density reached about 70%-80%. The relevant reagents were configured according to the following system (Table 1) (taking a 24-well plate as an example):

[0039] Table 1

[0040]

[0041] Mix 2 was added to Mix 1 and allowed to stand at room temperature in the dark for 15 min. The original culture medium in the 24-well plate was aspirated, the cells were washed twice with PBS solution, 450 μL of complete culture medium was added to each well, and then the above solution was added. The plate was gently shaken to mix, and then placed at 37°C and 5% CO 2 Culture in a constant temperature incubator. Change to complete medium after 24 hours. Extract RNA after 48 hours to detect mRNA expression level, and extract protein after 48-96 hours to detect protein expression level.

[0042] (2) RT-qPCR identification of NFE2L2 RNA expression

[0043] The treated cells in each well were washed twice with PBS buffer, and 1 mL of Trizol reagent was added to fully lyse the cells. After collecting into 1.5 mL EP tubes, 200 μL of chloroform was added to each sample, and the mixture was vigorously shaken for 2 minutes, placed at room temperature for 3 minutes, and centrifuged at 4°C and 12000g for 10 minutes; 500 μL of the upper aqueous phase was transferred to a new EP tube, and an equal volume of isopropanol was added, and the mixture was vigorously shaken for 1 minute. After standing at room temperature for 20 minutes, the mixture was centrifuged at 4°C and 12000g for 10 minutes; the supernatant was discarded, and the white RNA precipitate at the bottom of the centrifuge tube was retained. 1 mL of 75% ethanol solution was added to wash the precipitate, and the precipitate was centrifuged at 4°C and 12000g for 10 minutes, and repeated twice; after completely removing the ethanol solution and drying the precipitate, RNase water was added to dissolve the RNA. The kit (Takara) was used for reverse transcription into cDNA, and the reverse transcription reaction conditions were: 37°C for 15 minutes, 85°C for 5 seconds, and 4°C for infinity. Take an appropriate amount of cDNA, prepare 25 μL qRT-PCR amplification system according to the fluorescence quantitative kit (Takara), add the above qRT-PCR reaction system to a 384-well plate, and put it into the fluorescence quantitative PCR instrument for amplification. The reaction program is: 95℃ pre-denaturation for 30 seconds; 95℃ 5 seconds, 60℃ 34 seconds, 40 cycles; 95℃ 15 seconds, 60℃ 1 minute, read the absorbance, and determine the melting curve. Use 2 -△△CT Methods The relative expression of the target gene was calculated and statistically analyzed.

[0044] Primers:

[0045] NFE2L2-Fw: GCGACGGAAAGAGTATGAGC

[0046] NFE2L2-Rw:GGGAGTAGTTGGCAGATCCA

[0047] β-actin-Fw: AGCGAGCATCCCCCAAAGTT

[0048] β-actin-Rw:GGGCACGAAGGCTCATCATT

[0049] Western blot analysis of Nrf2 protein expression

[0050] (3) The treated cells in each well were washed twice with PBS buffer, and RIPA lysis buffer was added to lyse the cells. The proteins were separated by SDS-PAGE and transferred to a PVDF membrane, which was blocked with TBST containing 5% bovine serum albumin (BSA) at room temperature for 1 hour. The corresponding primary antibody was added and incubated at 4°C overnight. After washing the membrane with TBST, it was incubated with the corresponding horseradish peroxidase (HRP)-labeled secondary antibody at room temperature for 1 hour. After washing with TBST, the ECL developer was prepared and covered on the surface of the PVDF membrane, and the membrane was placed in an automatic exposure instrument for development.

[0051] 2.2 Cell proliferation-toxicity assay

[0052] The samples were tested using a cell proliferation-toxicity detection kit (Cell Counting Kit, CCK-8):

[0053] 1) After counting the cells using a cell counting plate, inoculate 5,000 cells per well in a 96-well plate (avoiding the outermost circle) and wait for the cells to adhere to the wall. At the same time, add an appropriate amount of PBS to the outermost circle of the 96-well plate to keep it moist.

[0054] 2) Treat the cells accordingly.

[0055] 3) Discard the cell culture medium and add 100 μL of culture medium + 10 μL of CCK-8 solution to each well. At the same time, set up a well with the corresponding amount of cell culture medium and CCK-8 but no cells as a blank control.

[0056] 4) After incubating in a cell culture incubator at 37°C for 2 hours, the absorbance at 450 nm was measured using an enzyme-labeled instrument.

[0057] 5) Experimental results analysis:

[0058] Cell viability = [OD(drug added) - OD(blank)] / [OD(0 drug added) - OD(blank)] × 100%; Inhibition rate = [OD(0 drug added) - OD(drug added)] / [OD(0 drug added) - OD(blank)] × 100%;

[0059] OD (drug added): absorbance value of wells with cells, culture medium, CCK-8 solution, and drug solution;

[0060] OD (blank): absorbance value of wells with culture medium, CCK-8 solution, and no cells;

[0061] OD (0 drug addition): absorbance value of the wells containing cells, culture medium, CCK-8 solution, and no drug solution.

[0062] 2.3 Lipid oxidation (MDA) assay

[0063] Use the MDA test kit to perform MDA test on the sample:

[0064] 1) Sample preparation: After cell treatment, discard the culture medium, wash 2-3 times with pre-cooled PBS, add the corresponding volume of RIPA lysis buffer (100 μL per well of a 24-well plate), lyse on ice for 30 minutes, centrifuge at 10000g-12000g for 10 minutes at 4°C, and take the supernatant for subsequent determination. After sample preparation, use the BCA protein concentration determination kit to determine the protein concentration, so as to facilitate the subsequent calculation of the MDA content in the tissue or cell per unit protein weight.

[0065] 2) Reagent preparation:

[0066] Preparation of TBA storage solution: TBA and TBA preparation solution are prepared into a TBA storage solution with a concentration of 0.37% (such as 18.5 mg TBA + 5 ml TBA preparation solution; 25 mg TBA + 6.76 ml TBA preparation solution, etc.).

[0067] Preparation of MDA working solution: 150μl TBA diluent + 50μl TBA storage solution + 3μl antioxidant are required for one test. MDA working solution is prepared just before the test.

[0068] Dilution of standard: Prepare standards of different concentrations as needed for subsequent preparation of standard curves.

[0069] 3) Sample determination:

[0070] According to the following table (Table 2), add the lysate / standard / sample to be tested and MDA detection working solution into a 1.5 ml centrifuge tube.

[0071] Table 2

[0072]

[0073]

[0074] After mixing, heat in a metal bath at 100°C for 15 minutes.

[0075] Cool to room temperature in a water bath, centrifuge at 1000 g for 10 minutes at room temperature, take 200 μl of the supernatant and add it to a 96-well plate, and then measure the absorbance at 532 nm using an enzyme reader.

[0076] After calculating the MDA content in the sample solution, the MDA content in the initial sample was expressed by the protein content per unit weight (μmol / mg protein).

[0077] 2.4 Flow cytometric analysis to detect lipid peroxidation levels

[0078] (1) Treat the cultured HESCs with drugs, then discard the cell culture supernatant, add PBS to wash twice, then add 1 mL PBS, gently scrape the adherent cells with a cell scraper, transfer them to a 1.5 mL EP tube, and pipette into a single cell suspension.

[0079] (2) Add 0.2 μL C11-BODIPY fluorescent probe (1:5000) to 1 mL of single cell suspension, mix by pipetting, and incubate in a 37°C incubator in the dark for 30 minutes. Centrifuge at 1200 rpm for 5 minutes, remove the supernatant, add 1 mL PBS to wash twice, and then add 1 mL PBS and pipette into a cell suspension. Use flow cytometer to detect the intensity of the fluorescent probe, and use FlowJo V10 software for data analysis.

[0080] The results are as follows Figure 2 As shown, Figure 2 A: RT-qPCR (left) and Western Blot (right) verified the knockdown efficiency of Nrf2-siRNA at the RNA and protein levels, respectively; Figure 2 B: Cell proliferation experiments confirmed that under the stimulation of RSL3 (a recognized ferroptosis inducing agent, widely used in various experiments to induce ferroptosis), knocking out Nrf2 significantly inhibited cell viability compared with the control group; Figure 2 C: Lipid oxidation experiments confirmed that compared with the control group, knocking out Nrf2 significantly increased the intracellular MDA content, indicating an increase in the level of intracellular lipid peroxidation; Figure 2 D: Flow cytometry detected the fluorescence intensity of the lipid peroxide probe C11-BIDOPY. Compared with the control group, knocking out Nrf2 significantly increased the level of intracellular lipid ROS.

[0081] Example 3

[0082] 1. Establishment of mouse endometriosis model

[0083] A C57BL / 6 mouse was randomly selected as a donor mouse and injected subcutaneously with estradiol benzoate (150 μg / kg) behind the neck twice a week for 1 week. The mouse was killed by cervical dislocation and fixed on the operating table in a supine position. After the abdomen was disinfected with alcohol, a sterile treatment drape was laid on it, and sterile gloves were worn. The abdominal cavity was opened along the midline at 0.5 cm above the pubic symphysis;

[0084] Find the Y-shaped uterus in the lower abdomen, carefully pull out the left and right uterus, and carefully separate the bilateral mesometrium. Separate the uterine horns and ovaries, cut off the left and right uterus at the bifurcation of the Y-shaped uterus, and place them in a sterile curved dish filled with 10ml of 37℃ saline, repeatedly rinse the blood on the surface of the uterus, and further separate the remaining adherent mesometrium;

[0085] Place the two uterine horns in two sterile curved trays and cut them into pieces about 1 mm in size. 2 of fragments and suspended in 37°C saline;

[0086] The uterus of the donor mouse was implanted into the abdominal cavity of the recipient mouse at a ratio of 1:3, that is, the endometrium of one donor mouse supplied three recipient mice, and the tissue fragments in the curved dish were suspended with 0.3 ml of physiological saline;

[0087] A C57BL / 6 mouse was randomly selected as the recipient mouse. After anesthesia, the needle was inserted about 1 cm above the urethra. The needle was inserted as parallel to the abdominal wall as possible to avoid damaging abdominal organs or blood vessels. 0.3 ml of saline suspended with uterine tissue fragments was quickly injected into the abdominal cavity of the recipient mouse with a 20-gauge needle together with the uterine tissue fragments. After the wound was disinfected, the abdomen was massaged for a while and the mouse was placed back in the cage to wait for awakening.

[0088] Since modeling, estradiol benzoate was injected regularly (150 μg / kg, injected into the skin behind the neck, twice a week in the first 1-2 weeks after modeling, once a week from the third week until sacrifice). Several mice were sacrificed in the 4th to 6th week after modeling to check whether the modeling was successful.

[0089] 2. Drug treatment animal model

[0090] From the 9th week after modeling, the mice were divided into two groups, one group was treated with ML385 (30 mg / kg) and the other group was a control group, and the drug was intraperitoneally injected 3 times a week (the control group was injected with the solvent) for 4 consecutive weeks;

[0091] The mice in both groups were killed by cervical dislocation, and the number, size, characteristics, and adhesion of the ectopic peritoneal lesions to the surrounding tissues were recorded. The ectopic lesions were weighed and histologically observed.

[0092] The experimental results are as follows Figure 3 As shown: Compared with the control group, the lesion volume in the ML385-treated group was significantly reduced and the weight was also lower than that in the control group.

[0093] The above description is only a preferred embodiment of the present invention, and does not limit the implementation mode and protection scope of the present invention. For those skilled in the art, it should be aware that all solutions obtained by equivalent substitutions and obvious changes made using the contents of the specification and illustrations of the present invention should be included in the protection scope of the present invention.

Claims

1. Application of NFE2L2 inhibitors in the preparation of drugs for inhibiting the growth of endometriosis lesions.

2. The use according to claim 1, characterized in that: The NFE2L2 inhibitor is ML385.

3. The use according to claim 1, characterized in that: The drug for inhibiting the growth of endometriosis lesions also includes pharmaceutically acceptable excipients.

4. Use of a composition in the preparation of a drug for inhibiting the growth of endometriosis lesions, characterized in that: The composition comprises the NFE2L2 inhibitor of claim 1.

5. The use according to claim 4, characterized in that: The NFE2L2 inhibitor is ML385.

Images