Engineered cell membrane vesicles capable of triggering cascade permeation of extracellular vesicles as well as construction method and application of engineered cell membrane vesicles

Abstract

The invention belongs to the field of new auxiliary materials and new dosage forms of pharmaceutical preparations, and designs an engineered cell membrane vesicle which is loaded with TNF-alpha-Lamp2b plasmids and is modified with a calcium ion carrier A23187 and a membrane fusion accelerant VSVG on a membrane. The engineered cell membrane vesicles can mediate membrane fusion under an acidic condition under the help of VSVG protein, and A23187 can increase the intracellular calcium level, so that release of extracellular vesicles is stimulated. Through the enhanced permeation effect of the A23187, the transmission efficiency of the TNF-alpha between cells is successfully improved, further the permeation of the TNF-alpha in deep tumor tissues is realized, and the growth of tumors is effectively inhibited. The prepared engineered cell membrane vesicles can improve the tumor penetrating efficiency of the extracellular vesicles, and enhance the immune response of cancers. And a new strategy and more choices are provided for developing a tumor microenvironment intelligent response type drug delivery system.

Description

Technical Field

[0001] The present invention belongs to the field of new excipients and new dosage forms for pharmaceutical preparations, and relates to a preparation method and application of engineered cell membrane vesicles that trigger an in situ storm of extracellular vesicles, and specifically relates to an engineered cell membrane vesicle that triggers cascade permeation of extracellular vesicles, and a construction method and application thereof. Background Art

[0002] Cancer is one of the malignant tumors that poses a major threat to women's health worldwide. Among the many cancer subtypes, triple-negative breast cancer is particularly deadly due to its high invasiveness, and is sometimes even called the "most poisonous cancer." In recent years, with the deepening of medical research, immunotherapy has gradually shown its potential in the treatment of triple-negative breast cancer. However, a notable feature of triple-negative breast cancer is its "cold tumor" property, that is, the tumor has low immunogenicity and the tumor microenvironment has an immunosuppressive effect, which limits the effectiveness of traditional immunotherapy in dealing with triple-negative breast cancer. At present, an urgent challenge facing the medical community is how to effectively transform "cold tumors" into "hot tumors" and reshape the tumor's immune microenvironment to improve the efficacy of immunotherapy. This transformation is of great significance for the treatment of triple-negative breast cancer and is expected to bring new treatment options and hope to patients.

[0003] Tumor necrosis factor α (TNF-α) is a cytokine produced mainly by immune cells and plays a key role in anti-tumor immune response. TNF-α can directly act on tumor cells, activate intracellular apoptotic pathways, and thus induce tumor cell death. The dense accumulation of cells, thick extracellular matrix, and increased interstitial fluid pressure in the tumor microenvironment together form a barrier that limits the penetration and distribution of TNF-α, resulting in insufficient accumulation in the tumor, thereby reducing the therapeutic effect.

[0004] Extracellular vesicles (EVs) are extracellular structures composed of a lipid bilayer with a variety of transmembrane proteins modified on the surface. These vesicles can transfer bioactive molecules between cells and regulate the gene expression and function of recipient cells. Through extracellular vesicle-mediated membrane protein transfer, we can modify tumor cells, enhance their immunogenicity, and thus improve the tumor microenvironment for cancer immunotherapy. However, the performance of extracellular vesicles in the process of tumor penetration is not ideal, mainly due to their low secretion efficiency, which limits their potential in tumor treatment. Summary of the invention

[0005] The purpose of the present invention is to overcome the deficiencies of the above-mentioned prior art and provide an engineered cell membrane vesicle that triggers extracellular vesicle cascade permeation and a construction method and application thereof.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] An engineered cell membrane vesicle that triggers extracellular vesicle cascade penetration. The engineered cell membrane vesicle is a cell membrane vesicle (NVs) surface modified with a membrane fusion promoter and a compound that promotes extracellular vesicle secretion, and the interior of the vesicle is loaded with drugs.

[0008] The membrane fusion promoter is the surface glycoprotein (VSVG) of vesicular stomatitis virus, the compound promoting extracellular vesicle secretion is a calcium ion carrier (A23187), and the drug is a TNF-α-Lamp2b plasmid; wherein the mass ratio of the protein mass in the cell membrane vesicles to the TNF-α-Lamp2b is 2:1, and the mass ratio of the protein mass in the cell membrane vesicles to the A23187 is 2:1.

[0009] The TNF-α-Lamp2b plasmid is a fusion of the TNF-α protein sequence and the Lamp2b protein sequence to generate the TNF-α-Lamp2b plasmid.

[0010] A method for constructing engineered cell membrane vesicles, wherein the surface of cell membrane vesicles (NVs) is modified with a membrane fusion promoter and an extracellular vesicle-promoting compound, and the interior of the vesicles is loaded with drugs to obtain engineered cell membrane vesicles.

[0011] Specifically: a plasmid containing a membrane fusion promoter is transfected into cells, and then cell membrane vesicles carrying the membrane fusion promoter are extracted, and then the expressed TNF-α protein is sorted into extracellular vesicles through Lamp2b, and then it is incubated with a compound that promotes extracellular vesicle secretion to obtain engineered cell membrane vesicles.

[0012] The cells are tumor cells such as 4T1, CT26, and B16.

[0013] Furthermore, the cells were mixed with the transfection reagent and the VSVG plasmid and cultured, and then ultrasonically disrupted and centrifuged to obtain cell membrane vesicles (V-NVs) carrying a membrane fusion promoter; V-NVs and TNF-α-Lamp2b plasmid were mixed in proportion and electroporated, and then incubated; after incubation, A23187 was added and further incubated to obtain engineered cell membrane vesicles.

[0014] The cell membrane vesicles (V-NVs) carrying the membrane fusion promoter are prepared by adding a transfection reagent (PEI) and a VSVG plasmid to the cells after culturing for 12 hours and mixing them thoroughly; the cells are then cultured in Opti-MEM medium for 48 hours, and the cells are resuspended in PBS after culturing, broken after resuspension, centrifuged to collect the final precipitate, and filtered to collect the cell membrane vesicles carrying VSVG. The centrifugation conditions are 2000r.pm for 10 minutes, 5000r.pm for 10 minutes, and 15000r.pm for 60 minutes. After the first two centrifugations, the supernatant is taken, the precipitate is discarded, and the precipitate is taken from the last centrifugation and resuspended in PBS.

[0015] V-NVs and TNF-α-Lamp2b plasmids were mixed in proportion in an electrophoresis tank at 4°C, and electroporated using an electroporator at 400V, 25μF capacitance and 50Ω resistance with a pulse duration of 10-15 milliseconds, followed by incubation at 37°C for 30 minutes. A23187 was added after incubation, and the cells were incubated at 37°C for another 30 minutes to obtain engineered cell membrane vesicles.

[0016] Going further:

[0017] 4T1 cells were inoculated in a culture dish. After 12 hours, the VSVG plasmid and transfection reagent (PEI) were diluted with Opti-MEM medium, and the two were mixed at a mass ratio of 3:1. The cell culture medium was replaced with serum-free culture medium, and the VSVG plasmid was transfected into 4T1 tumor cells. After 48 hours of culture, the cells were collected. The cells were resuspended in PBS and sonicated for 60 seconds using an ultrasonic crusher in a sterile EP tube using 22w, 4°C parameters. Cell debris was removed by continuous centrifugation (2000r.p.m10 minutes, 5000r.p.m10 minutes, 15000r.pm 60 minutes). After the first two centrifugations, the supernatant was taken and the precipitate was discarded. After the last centrifugation, the precipitate was resuspended and filtered through a 0.22μm filter to collect cell membrane vesicles (V-NVs). The protein concentration of cell membrane vesicles was quantified by the BCA protein assay kit. The cell membrane vesicle protein mass and TNF-α-Lamp2b plasmid were mixed in a cooled 0.4 cm cuvette at a predetermined ratio of NVs:TNF-α-Lamp2b = 2:1, and electroporated at 400V, 25μF capacitance and 50Ω resistance, with a pulse duration of 10-15ms. After electroporation, incubate in a 37°C incubator for 30 minutes to wait for the vesicle membrane to recover. Add A23187 at a predetermined ratio of NVs protein mass: A23187 = 2:1, and incubate in a 37°C incubator for 30 minutes.

[0018] A use of the engineered cell membrane vesicles in the preparation of anti-tumor drugs.

[0019] The drug is administered by injection or topical administration.

[0020] The present invention has the following beneficial effects:

[0021] (1) The present invention prepares engineered cell membrane vesicles with uniform particle size, and the preparation method is simple, efficient, and has good stability, thereby achieving efficient delivery and deep penetration of tumor necrosis factor α.

[0022] (2) The engineered cell membrane vesicles prepared by the present invention have uniform particle size and good stability, and can respond to the acidic conditions in the tumor microenvironment. Through the enhanced permeability of A23187, the efficiency of tumor necrosis factor α transfer between cells is improved, thereby achieving penetration into deep tumor tissues and effectively inhibiting tumor growth. This discovery provides a new strategy to overcome the bottleneck of nano-drugs in tumor penetration and provides more options for the urgent need for efficient chemotherapy preparations in clinical treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Schematic diagram of the TNF-α-Lamp2b plasmid structure of Example 1 of the present invention

[0024] Figure 2 The size distribution and electron microscope image of NVs and V-NVs / T+A of Example 2 of the present invention; wherein A is NVs and B is V-NVs / T+A.

[0025] Figure 3 These are stability test graphs of NVs and V-NVs / T+A of Example 3 of the present invention; wherein A is a 12-hour stability test graph, and B is a 7-day stability test graph.

[0026] Figure 4 It is a FRET effect curve diagram of the liposome of Example 4 of the present invention and V-NVs / T+A at pH=6.3±0.1.

[0027] Figure 5 The expression of TNF-α mRNA in 4T1 cells incubated with NVs or V-NVs / T+A was analyzed by real-time fluorescence quantitative PCR in Example 5 of the present invention.

[0028] Figure 6 This is a diagram of the co-localization experiment of VSVG labeled with green fluorescence GFP and TNFα labeled with red fluorescence RFP in exosomes extracted from cells incubated with V-NVs / T+A according to Example 6 of the present invention.

[0029] Figure 7These are experimental diagrams of the cell uptake of NVs / T+A and V-NVs / T+A in 4T1 and 3T3 cells of Example 7 of the present invention, wherein A is a confocal image and B is a flow cytometry quantitative diagram.

[0030] Figure 8 This is an experimental diagram of the expression of VSVG protein in cells incubated with V-NVs / T+A in Example 8 of the present invention.

[0031] Fig. 9 This is a diagram showing the cytotoxicity experiment of V-NVs / T+A on 4T1 cells in Example 9 of the present invention.

[0032] Fig.10 These are flow cytometry experimental diagrams of the immune effects of V-NVs / T+A triggering dendritic cells and macrophages in Example 10 of the present invention; wherein A is a quantitative diagram of triggering dendritic cells, B is a quantitative diagram of triggering macrophages, C is a flow cytometry diagram of triggering dendritic cells, and D is a flow cytometry diagram of triggering macrophages.

[0033] Fig.11 This is a flow cytometry experiment diagram of V-NVs / T+A triggering 4T1 cell apoptosis in Example 11 of the present invention.

[0034] Fig.12 This is an experimental diagram of the A23187 solution and V-NVs / T+A in Example 12 of the present invention promoting EVs secretion in cells; wherein A is the effect of the solution in promoting EVs secretion, and B is the effect of each group of preparations in promoting EVs secretion.

[0035] Fig.13 The Ca after V-NVs / T+A treatment in Example 12 of the present invention is detected 2+ Horizontal flow cytometry results.

[0036] Fig.14 The Ca after V-NVs / T+A treatment in Example 12 of the present invention is detected 2+ Horizontal image of a confocal experiment.

[0037] Fig.15 This is a confocal experimental picture of the transfer of V-NVs / T+A between cells in the transwell experiment of Example 13 of the present invention.

[0038] Fig.16 This is a quantitative graph of the TNF-α content in the supernatant or extracted exosomes by flow cytometry in Example 13 of the present invention.

[0039] Fig.17 These are the confocal images and quantitative images of V-NVs / T+A entering the tumor spheroid according to Example 14 of the present invention; wherein A is the confocal image of the tumor spheroid, and B is the penetration quantitative image.

[0040] Fig.18 This is a confocal image of Example 14 of the present invention, which quantifies the toxicity of V-NVs / T+A to tumor spheroids through cytotoxicity.

[0041] Fig.19 This is a confocal observation experimental diagram of the cytotoxicity of V-NVs / T+A on tumor spheroids in Example 14 of the present invention.

[0042] Fig. 20 This is an in vivo fluorescence image of 4T1 tumor-bearing mice after intravenous injection of V-NVs / T+A in Example 15 of the present invention.

[0043] Fig.21 This is a quantitative graph of in vivo fluorescence in 4T1 tumor-bearing mice after intravenous injection of V-NVs / T+A in Example 15 of the present invention.

[0044] Fig. 22 This is a fluorescence quantitative image of the main organs and tumors in vitro after intravenous injection of V-NVs / T+A in 4T1 tumor-bearing mice in Example 15 of the present invention

[0045] Fig.23 This is a confocal microscope study of the penetration of V-NVs / T+A in 4T1 mouse tumors according to Example 15 of the present invention.

[0046] Fig.24 Bioluminescent imaging images of 4T1-Luc lung metastasis mice at different time points after treatment in Example 16 of the present invention

[0047] Fig.25 This is a photograph of the lung metastasis of Example 16 of the present invention stained with Bouin's fixative solution

[0048] Fig.26 This is an IVIS fluorescence imaging image of excised lung tissue after the treatment of Example 16 of the present invention.

[0049] Fig. 27 This is the tumor growth curve after treatment in Example 16 of the present invention.

[0050] Fig.28 This is the tumor image after treatment in Example 16 of the present invention.

[0051] Fig.29 DC cells and tumor CD8 + Flow cytometric analysis of T cells and M1 macrophages.

[0052] Fig.30 These are H&E staining images of liver sections after different treatments in Example 16 of the present invention.

[0053] Fig.31 These are H&E staining images of lung sections after different treatments in Example 16 of the present invention.

[0054] Fig.32 This is a graph showing the tumor growth curve after V-NVs / T+A treatment in Example 17 of the present invention.

[0055] Fig.33 This is a photo of a dissected 4T1 tumor after V-NVs / T+A treatment according to Example 17 of the present invention.

[0056] Fig.34 This is a graph showing changes in liver and kidney function indicators of 4T1 tumor-bearing mice after treatment with V-NVs / T+A in Example 17 of the present invention.

[0057] Fig.35 This is a graph showing the cytokine detection levels after V-NVs / T+A treatment in Example 17 of the present invention.

[0058] Fig.36 These are H&E staining images of organs of 4T1 tumor-bearing mice after treatment with V-NVs / T+A according to Example 17 of the present invention.

[0059] Fig.37 This is the systemic anti-tumor immune flow cytometry graph of V-NVs / T+A in Example 18 of the present invention. DETAILED DESCRIPTION

[0060] The specific implementation modes of the present invention are further described below in conjunction with examples. It should be noted that the specific implementation modes described here are only for illustrating and explaining the present invention, and are not limited to the present invention.

[0061] An engineered cell membrane vesicle for cascade deep tumor penetration and TNF-α cytokine therapy to enhance tumor immunotherapy. The engineered cell membrane vesicle prepared can mediate membrane fusion at acidic pH, improve the efficiency of exosome hitchhiking to penetrate tumors, and enhance the immune response to cancer.

[0062] Specifically, various types of cells are transfected with VSVG, cell membrane vesicles are separated therefrom, TNF-α-Lamp2b plasmid is loaded into VSVG cell membrane vesicles by electroporation, and A23187 is loaded into VSVG cell membrane vesicles by incubation.

[0063] Example 1: Preparation of TNF-α-Lamp2b plasmid:

[0064] Using I-5 TM 2× High-Fidelity Master Mix high-fidelity polymerase for PCR amplification (F1: CTTGGTAC CGAGCTCGGATCCGCCACCATGTGCCTCTCTCCGGTTAAAG; R1:AACG GGCCCTCTAGACTCGAGTCACAGGTCCTCCTCTGAGATCAGC). After the target fragment is PCR amplified, it is detected by electrophoresis on 1% agarose gel, and the DNA target fragment is recovered according to the instructions of the rapid agarose gel DNA recovery kit. Add XhoI and BamHI restriction endonucleases to the enzyme-cut vector pCDNA3.1(+), and digest at 37°C for 30 minutes. Add ClonExpress Mix to the system of vector fragment: target fragment 3:1 to obtain the target plasmid TNF-α-Lamp2b. (For details, see Interleukin 3-receptortargeted exosomes inhibit in vitro and in vivo Chronic Myelogenous Leukemiacell growth) The obtained plasmid is a replacement for IL-3 in the article, and the specific protein replaced is TNF-α: https: / / www.ncbi.nlm.nih.gov / gene / 21926. The plasmid structure is as follows Figure 1 shown.

[0065] Example 2: Preparation of engineered NVs

[0066] 1) Acquisition of NVs: 4T1 cells were initially placed in a culture dish and cultured for 12 hours, then resuspended in PBS and sonicated for 60 seconds using an ultrasonic disruptor in a sterile EP tube (22w, 4°C). Cell debris and microvesicles were removed by continuous centrifugation (10 minutes at 2000 r.pm, 10 minutes at 5000 r.pm, and 60 minutes at 15000 r.pm). After the first two centrifugations, the supernatant was taken and the precipitate was discarded. The precipitate was taken from the last centrifugation and re-spinned with PBS. The supernatant was filtered through a 0.22 μm filter to collect NVs.

[0067] 2) Obtaining NVs / T: Take the NVs and TNF-α-Lamp2b plasmids obtained in 1) and mix them in a cooled 0.4 cm cuvette at a predetermined ratio of NVs protein mass: TNF-α-Lamp2b mass = 2:1, and use an electroporator (BioRad, USA) at 400V, 25μF capacitance and 50Ω resistance, with a pulse duration of 10-15 milliseconds for electroporation. After electroporation, incubate in a 37°C incubator for 30 minutes, wait for the vesicle membrane to recover, and then obtain NVs / T.

[0068] 3) Obtaining NVs / A: Add A23187 to the NVs obtained in 1) at a predetermined ratio of NVs protein mass: A23187 mass = 2:1, and incubate in a 37°C incubator for 30 minutes to obtain NVs / A.

[0069] 4) Acquisition of V-NVs: 4T1 cells were initially placed in a culture dish and cultured for 12 hours, after which the cell culture medium was replaced with Opti-MEM medium for standby use. Transfection reagent (PEI) and VSVG plasmid (purchased from Wuhan Miaoling Biotechnology Co., Ltd.) were diluted and mixed in Opti-MEM medium for 15 minutes, respectively, with a mass ratio of transfection reagent to VSVG plasmid of 3:1; the above mixed solution was added to the cultured cells, and after 48 hours, the cells were resuspended in PBS and sonicated for 60 seconds using an ultrasonic disruptor in a sterile EP tube (22w, 4°C). Cell debris and microvesicles were removed by continuous centrifugation (10 minutes at 2000 r.pm, 10 minutes at 5000 r.pm, and 60 minutes at 15000 r.pm). After the first two centrifugations, the supernatant was taken and the precipitate was discarded. The precipitate was taken from the last centrifugation and re-spinned with PBS. The supernatant was filtered through a 0.22 μm filter to collect V-NVs.

[0070] 5) Obtaining V-NVs / A: Add A23187 to the V-NVs obtained in 4) at a predetermined ratio of V-NVs protein mass: A23187 mass = 2:1, and incubate in a 37°C incubator for 30 minutes to obtain V-NVs / A.

[0071] 6) Obtaining V-NVs / T: Take the V-NVs and TNF-α-Lamp2b plasmids obtained in 4) and mix them in a cooled 0.4 cm cuvette at a predetermined ratio of V-NVs protein mass: TNF-α-Lamp2b mass = 2:1, and use an electroporator (BioRad, USA) at 400V, 25μF capacitance and 50Ω resistance, with a pulse duration of 10-15 milliseconds for electroporation. After electroporation, incubate in a 37°C incubator for 30 minutes, wait for the vesicle membrane to recover, and obtain V-NVs / T.

[0072] 7) Obtaining NVs / T+A: Add A23187 to the NVs / T obtained in 2) at a predetermined ratio of V-NVs protein mass: A23187 mass = 2:1, and incubate in a 37°C incubator for 30 minutes to obtain NVs / T+A.

[0073] 8) Obtaining V-NVs / T+A: Add A23187 to the V-NVs / T obtained in 6) at a predetermined ratio of V-NVs protein mass: A23187 mass = 2:1, and incubate in a 37°C incubator for 30 minutes to obtain V-NVs / T+A.

[0074] The NVs and V-NVs / T+A with the same protein mass prepared in step 1) and step 8) of Example 1 were characterized using a Hitachi TEMH-7000 transmission electron microscope and a nanoparticle size potential analyzer. Figure 2 As shown, the cell membrane vesicles (NVs) obtained in step 1) have a particle size of about 110 nm. The engineered cell membrane vesicles (V-NVs / T+A) obtained in step 8) have a particle size of about 120 nm, and both are saucer-shaped under a transmission electron microscope.

[0075] Example 3: Colloidal stability test of engineered NVs

[0076] 1) 1 mL of NVs and V-NVs / T+A prepared in step 1) and step 8) of Example 1 were taken out respectively, added to 20 mL of phosphate buffer (PBS, pH 7.4), incubated at 4°C for 7 days, and the particle size change was measured by dynamic light scattering every day (see Figure 3 B).

[0077] 2) 1 mL of NVs and V-NVs / T+A of the same protein amount prepared in step 1) and step 8) of Example 1 were taken out respectively, added to 20 mL of phosphate buffer (PBS, pH 7.4), incubated at 37°C for 24 h, and the particle size change was measured by dynamic light scattering at predetermined time points (0 h, 2 h, 4 h, 6 h, 8 h, 12 h and 24 h) (see Figure 3 A)

[0078] The results are as follows Figure 3 As shown, NVs and V-NVs / T+A have good colloidal stability, and the particle sizes of the two did not change significantly under the two test conditions, which is conducive to more drugs being enriched in the tumor site through blood circulation and achieving better therapeutic effects.

[0079] Example 4: Experiment on membrane fusion properties of V-NVs / T+A

[0080] To determine the efficiency of membrane fusion through the FRET effect, FRET liposomes were prepared using DiL and DiD as fluorescent donors and acceptors at a molar ratio of 1:7 (for details, see Bioinspired engineering of fusogen and targeting moiety equipped nanovesicles). Briefly, the lipid mixture was initially dried under vacuum and then rehydrated in PBS. After five freeze-thaw cycles, large unilamellar vesicles were prepared by extrusion through a 200 nm polycarbonate filter. These liposomes were labeled with DiD and DiL and then immobilized on the PEG-coated surface by streptavidin-biotin lipid conjugation. Subsequently, LDLR was attached to the liposomes using the Ni-NTA system. V-NVs / T+A prepared as described above in step 8 of Example 1) was introduced and incubated at 37°C at pH = 6.3 ± 0.1. The fluorescence spectrum in the range of 550 nm to 750 nm was measured to evaluate fusion (see Figure 4 ).like Figure 4 The fluorescence changes before and after membrane fusion at pH = 6.3 ± 0.1 show that VSVG not only successfully loaded on V-NVs / T+A, but also showed their membrane fusion ability. When pH = 7, no FRET effect was observed, showing the acid response characteristics of V-NVs / T+A at pH = 6.3 ± 0.1.

[0081] Example 5: Expression of TNF-α-Lamp2b plasmid

[0082] Real-time quantitative PCR was used to evaluate the mRNA level of TNF-α. Reverse transcription polymerase chain reaction (RT-PCR) was used for quantitative detection of mRNA expression. 4T1 cells were treated with NVs and V-NVs / T+A with the same protein amount prepared in step 1) and step 8) of Example 1, respectively, incubated for 48 hours and washed with PBS. RNA was extracted from the cells using an RNA extraction kit, and the RNA concentration was measured. The RNA was then reverse transcribed into cDNA and quantitatively analyzed. RT-PCR was performed using cDNA primers (forward: 5'-caggcggtgcctatgtctc-3', reverse: 5'-cgatcaccccgaagttcagtag-3') under the following conditions: 95°C to activate Taq for 30 seconds, followed by 30 cycles of 95°C for 10 seconds and 60°C for 30 seconds. Gene expression data were normalized for the GAPDH mRNA level of each sample. After performing three repeated experiments, 2 -ΔΔct Methods to determine relative expression levels.

[0083] like Figure 5As shown, TNF-α plasmid delivered by V-NVs / T+A was efficiently transcribed in cells, with mRNA levels increased sevenfold compared with cells treated with blank NVs.

[0084] Example 6: Fluorescence co-localization experiment

[0085] VSVG protein was labeled with green fluorescent protein (GFP), and TNF-α-Lamp2b protein was labeled with red fluorescent protein (RFP). 4T1 cells were treated with V-NVs / T+A prepared in step 8 of Example 1 after fluorescence labeling and incubated for 48 hours. Exosomes secreted by cells were extracted using an exosome extraction kit (Biyuntian). Exosomes treated with V-NVs / T+A were observed using a confocal laser scanning microscope (CLSM, C2, Nikon, Japan) (see Figure 6 ).

[0086] The results are as follows Figure 6 As shown, red fluorescence and green fluorescence co-localized in the extracted exosomes, indicating the presence of VSVG protein and TNF-α-Lamp2b protein in the exosomes.

[0087] Example 7: Cellular Uptake

[0088] 4T1 cells were plated at 5 × 10 4 3T3 cells were seeded at a density of 5 × 10 cells per well in a 24-well plate containing 1640 medium and cultured for 12 hours. 4 The cells were seeded at a density of 10 cells / mL in a 24-well plate containing DMEM / F-12 medium and cultured for 12 hours.

[0089] In order to study the membrane fusion properties of VSVG protein, the above 4T1 cells were treated with the same amount of NVs / T+A and V-NVs / T+A prepared in step 7) and step 8) of Example 1 after fluorescence labeling, and incubated for 24 hours or 48 hours. The culture medium was removed, the cells were washed, collected, stained with Hoechst, and observed under a confocal laser scanning microscope (CLSM, C2, Nikon, Japan) (see Figure 7 A).

[0090] To quantitatively analyze the cellular uptake efficiency, 4T1 and 3T3 cells (5 × 10 5 Cells were plated in 12-well plates. After harvesting, the cells were washed and resuspended as described above and analyzed using flow cytometry (see Figure 7 B).

[0091] The results are as follows Figure 7As shown, V-NVs / T+A was successfully taken up, and the fluorescence intensity of the V-NVs / T+A group was significantly higher than that of the NVs / T+A group, proving the membrane fusion properties and enhanced uptake ability of the VSVG protein. At the same time, the uptake of V-NVs / T+A showed time dependence.

[0092] Example 8: Immunoblotting assay

[0093] 4T1 was added at 1 × 10 6 The density of cells was seeded on a 6-well plate containing 1640 culture medium. The cells were treated with NVs, V-NVs and V-NVs / T+A prepared in steps 1), 4) and 8) of Example 1, respectively, and incubated for 48 hours after treatment. The cells were collected into an ep tube using a cell scraper and added with cell lysis buffer for lysis on ice for 15 minutes. After lysis, the sample was centrifuged at 12000g and the supernatant was taken. The protein concentration was quantified using a BCA kit. An equal amount of protein was added to the loading buffer and boiled in boiling water for 5 minutes. An equal amount of protein (40 μg) was added to each well and separated by SDS-PAGE. The protein was then transferred to a PVDF membrane and blocked with 5% skim milk. Subsequently, the primary antibody was incubated overnight at 4°C, and the antibodies used included VSVG and β-actin. The PVDF membrane was then incubated with HRP-labeled goat anti-rabbit IgG for 2 hours. Finally, chemiluminescence detection was performed using an ECL luminescent reagent to display protein bands. The expression of VSVG protein in cells was confirmed by Western blot experiment.

[0094] The experimental results are as follows Figure 8 As shown, VSVG protein was present in cells treated with V-NVs and V-NVs / T+A.

[0095] Example 9 Cytotoxicity Experiment

[0096] The antiproliferative activity of NVs, NVs / T, V-NVs / A, V-NVs / T, and V-NVs / T+A prepared in steps 1), 2), 5), 6), and 8) of Example 1 was evaluated by MTT assay. First, 4T1 cells were plated at 1×10 3 The density of cells was seeded on a 96-well plate containing 1640 culture medium and cultured in an incubator for 12 hours to ensure cell adhesion. Subsequently, the culture medium was removed, the cells were treated with the above-mentioned different preparations, and incubated for another 48 hours. Next, MTT solution was added to each well and incubated for an additional 4 hours to allow MTT to fully react with the cells to form purple formazan crystals. Then, the MTT solution was carefully removed and the crystals formed were dissolved with dimethyl sulfoxide (DMSO). Finally, the viability of the cells was measured at 490nm using a microplate reader.

[0097] The experimental results are as follows Fig. 9 As shown, the group containing VSVG significantly enhanced the anti-tumor ability of TNF-α. In addition, the addition of A23187 promoted the secretion of extracellular vesicles (EVs) and enhanced the transmission of TNF-α between cells, thereby further improving the anti-tumor activity.

[0098] Example 10: Cellular Immunity

[0099] Bone marrow cells were obtained from the tibia and femur of BALB / c mice. First, the mice were euthanized under sterile conditions. Then the skin of the legs was cut, the tibia and femur were exposed and separated, and the surface muscles and soft tissues were removed. Then the joint parts at both ends of the bones were cut off, and the culture medium was injected to flush out the bone marrow cells and collected in a sterile centrifuge tube. Finally, the bone marrow cell suspension was centrifuged, the culture medium was removed, and the cells were resuspended in fresh culture medium. These cells were cultured in RPMI 1640 medium supplemented with 1% penicillin-streptomycin and 10% bovine serum. In order to promote the differentiation of bone marrow-derived dendritic cells (BMDCs) and bone marrow-derived macrophages (BMDMs), the cultures were treated with 1640 medium containing recombinant mouse granulocyte-macrophage colony-stimulating factor (GM-CSF), recombinant mouse interleukin-4 (IL-4) and granulocyte-macrophage colony-stimulating factor (M-CSF), respectively. The culture medium was renewed every other day, and the cells were co-cultured for 4 days to differentiate into BMDCs and BMDMs. The 4T1 tumor cells treated with NVs, NVs / A, V-NVs, V-NVs / T, and V-NVs / T+A prepared in steps 1), 3), 4), 6), and 8) of Example 1 were co-cultured for 48 hours. Immature BMDCs and BMDMs were then co-cultured with the above-treated tumor cells for 24 hours. Subsequently, flow cytometry analysis was performed using CD45, CD11c, and CD80 antibodies against BMDCs and CD45, CD11b, and F4 / 80 antibodies against BMDMs.

[0100] like Fig.10 As shown in Figure 2, the expression of CD80 and CD86 in V-NVs / T+A was significantly upregulated compared with other control groups, indicating that tumor cells incubated with V-NVs / T+A can stimulate BMDMs to polarize toward the M1 phenotype and stimulate BMDCs maturation. Therefore, engineered NVs can systematically regulate immune cells from multiple aspects, including DC maturation and macrophage polarization, which is crucial for reshaping the tumor microenvironment in immunotherapy.

[0101] Example 11: Cell Apoptosis

[0102] 4T1 cells were plated at 5 × 10 5The density of cells was sown in a 12-well culture plate containing 1640 culture medium and cultured in an incubator for 12 hours to ensure cell adhesion. After incubation, the cells were treated with the same protein amount of NVs / T, V-NVs / A, V-NVs / T, V-NVs / T+A prepared in steps 2), 5), 6) and 8) of Example 1, and the TNF-α inhibitor Z-VAD-FMK (20 μmol / L) was added to V-NVs / T+A, and the cells were incubated for 48 hours. Subsequently, the cell culture medium was collected in a centrifuge tube for use. Next, the cells were treated with trypsin for digestion, and the previously collected culture medium was added during the digestion process to terminate the digestion reaction. Then, the digested cell suspension was centrifuged, the supernatant was removed and the cells were resuspended with PBS. Finally, the treated cells and supernatant were collected and saved for subsequent analysis. The cells were stained using the Annexin V-FITC apoptosis detection kit and then immediately analyzed by flow cytometry.

[0103] like Fig.11 As shown, apoptosis was significantly reduced after the addition of TNF-α inhibitor, which is consistent with the observed cytotoxicity results. These results indicate that V-NVs / T+A exhibits potent antitumor activity, in which TNF-α plays a key role in this effect.

[0104] Example 12: A23187 mechanism verification

[0105] 4T1 cells were plated at 1 × 10 6 The cells were seeded in a 6-well culture plate containing 1640 medium at a density of 10 cells and cultured in an incubator for 12 hours to ensure that the cells were fully attached. After incubation, 4T1 cells were treated with A23187 solution and EVs were extracted using an EVs extraction kit. The collected EVs were quantitatively analyzed using the BCA assay to determine their protein content ( Fig.12 A).

[0106] Subsequently, 4T1 cells were treated with NVs / T, V-NVs / A, V-NVs / T, V-NVs / T+A and V-NVs / T+A with the same amount of protein prepared in step 2), step 6), step 7) and step 8) of Example 1, and the calcium ion chelator BAPTA (molar ratio BAPTA: A23187 = 1:1) was added to each group. EVs were extracted using an EVs extraction kit. To verify the role of A23187 in promoting EVs release ( Fig.12 B).

[0107] like Fig.12As shown in A, at an equivalent dose of 3 μM, A23187 significantly enhanced the release of EVs. The introduction of calcium ion chelator BAPTA further supported the role of A23187 in the release of EVs. Fig.12 As shown in B, V-NVs / T+A can significantly enhance the release of EVs.

[0108] To further investigate the mechanism by which A23187 promotes EVs release, we used Ca 2+ The sensitive probe Fura-2AM labeled Ca 2+ ions, and the Ca ions in 4T1 cells after the above treatment were detected. 2+ ion levels, flow cytometry was used to quantify calcium ion levels, and confocal laser scanning microscopy (CLSM) was used to verify the conclusions (see Fig.13 and 14 ).

[0109] like Fig.13 , 14 As shown, intracellular Ca 2+ The levels of A23187 in V-NVs / T+A were significantly increased by increasing Ca 2+ levels to enhance the release of EVs, thereby promoting deeper intercellular communication.

[0110] Example 13: Verification of intercellular transmission mechanism

[0111] The intercellular transmission ability of NVs was verified by cell migration experiments. First, 4T1 cells were seeded at an appropriate density in the upper and lower chambers of the transwell plate and cultured in an incubator for 12 hours to ensure that the cells were completely attached. The cells were treated with NVs / T, V-NVs / T, V-NVs / T+A prepared with the same protein amount of fluorescently labeled vesicles in step 2), step 5) and step 8) of the above Example 1, and the calcium ion chelator BAPTA (molar ratio BAPTA: A23187 = 1: 1) was added to V-NVs / T+A. The cells in the upper chamber were incubated for 2 hours. Subsequently, the unbound or free NVs in the upper chamber were thoroughly washed away with PBS, and the incubation continued for 48 hours to allow intercellular EVs transmission.

[0112] Next, the cells in the lower chamber were digested, resuspended and seeded into a new upper chamber, and new 4T1 cells were seeded into the lower chamber. Finally, confocal laser scanning microscopy (CLSM) was used to observe the transmission of EVs between cells and evaluate the transmission efficiency and distribution of EVs between cells.

[0113] like Fig.15As shown, the persistence of relevant fluorescence in the third layer of cells demonstrated the effective intercellular transport of TNF-α and VSVG in V-NVs / T+A, while the groups lacking VSVG and A23187 showed no intercellular transfer.

[0114] Next, the mechanism of intercellular transmission was verified. 4T1 cells were seeded in a 12-well culture plate and incubated for 12 hours. Initially, the cells were treated with the same protein amounts of NVs / T, V-NVs / T, V-NVs / T+A prepared in steps 2), 6) and 8) of the above Example 1 with fluorescent labels, and the calcium ion chelator BAPTA (molar ratio BAPTA: A23187 = 1: 1) was added to V-NVs / T+A. EVs and supernatants were extracted using an EVs extraction kit, respectively. The fluorescence of EVs and supernatants was measured using a microplate reader. Next, the extracted EVs and supernatants were incubated with fresh cells, respectively, and further analyzed by flow cytometry and CLSM.

[0115] Fig.16 The results showed that cells treated with V-NVs / T+A had significantly higher TNF-α levels than cells treated with supernatant, indicating that the delivery of TNF-α is mainly mediated by EVs.

[0116] Example 14: Tumor spheroid penetration efficiency

[0117] In order to study the drug permeability and tumor inhibition effect of engineered NVs, a tumor sphere model was established. 4 4T1 cells were seeded in 1640 medium containing 0.24% methylcellulose and the mixture was dispensed onto the lid of a round-bottom 96-well plate. The lid was placed in a cell culture incubator for 24 hours to allow the cells to attach and form spheres. After the incubation period, 200 μl of complete medium was added to each well to provide the required nutrients and support. The cell spheres were then centrifuged at 2800 rpm for 3 minutes to help transfer the cell spheres from the lid to the bottom of the well.

[0118] During the subsequent culture process, the culture medium was replaced every 48 hours to maintain a good cell growth environment. On the fourth day, the old culture medium was aspirated and the same protein amount of NVs / T, V-NVs / T, V-NVs / T+A prepared in steps 2), 6) and 8) of the above Example 1 was fluorescently labeled, and the calcium ion chelator BAPTA (molar ratio BAPTA: A23187 = 1: 1) was added to V-NVs / T+A. The spheroids were incubated for 72 hours to allow NVs to fully interact with the cells. After the incubation was completed, the culture medium was removed and the spheroids were thoroughly rinsed with PBS to remove unbound NVs. Finally, the tumor spheroids were observed using a confocal laser scanning microscope (CLSM) to evaluate the penetration of the engineered NVs inside the tumor spheroids.

[0119] Fig.17 The results showed that there were significant differences in the penetration of engineered NVs in the spheroid cores treated with different formulations. Among them, the engineered cell membrane vesicle group containing VSVG and A23187 showed the most effective membrane fusion and penetration.

[0120] The same procedure as the above preparation of tumor spheres was used. After the fourth day, the old culture medium was removed and the same amount of protein NVs / T, V-NVs / T, V-NVs / T+A prepared in step 2), step 6) and step 8) of Example 1 was added, and the calcium ion chelator BAPTA (molar ratio BAPTA: A23187 = 1: 1) was added. The spheres were incubated for 72 hours to allow NVs to fully interact with the cells. Calcein-AM (4.5 mM) and PI (2 mM) were used to stain the spheres for 30 minutes, and confocal imaging was used to observe the living and dead cells inside the spheres.

[0121] like Fig.18 As shown, V-NVs / T+A has the best penetrating cytotoxicity against 4T1 tumor spheroids.

[0122] The same operation as the above preparation of tumor spheres was performed. After the fourth day, the old culture medium was removed and the same protein amount of NVs / T, V-NVs / T, V-NVs / T+A prepared in step 2), step 6) and step 8) of Example 1 was added, and the calcium ion chelator BAPTA (molar ratio BAPTA: A23187 = 1: 1) was added. The spheres were incubated for 72 hours to allow NVs to fully interact with the cells. Tumor spheres were collected by centrifugation, and single cells were dissociated using five-fold diluted trypsin, followed by another round of centrifugation. 20 μL of MTT solution was added to each well, and the cells were incubated at 37°C for 4 hours. After incubation, the supernatant was removed by centrifugation, and 200 μL of DMSO was added. After mixing, the absorbance at 490 nm was measured using a microplate reader to calculate cell viability.

[0123] Fig.19 The results showed that V-NVs / T+A exhibited strong cytotoxicity, which was consistent with the cytotoxicity results observed in tumor spheroids using confocal microscopy.

[0124] Example 15: In vivo distribution and penetration experiments

[0125] 4T1 cells were injected subcutaneously into female BALB / c mice to establish a mouse model bearing 4T1 tumors. In order to evaluate the biodistribution of engineered cell membrane vesicles in real time, NVs / T+A and V-NVs / T+A prepared in steps 7) and 8) of Example 1 were incubated with DiR for 1 hour to obtain DiR-NVs / T+A and DiR-V-NVs / T+A. When the 4T1 tumor volume grew to about 200 mm 3 The labeled vesicles were injected intravenously into mice at an equivalent dose of 1 mg / kg DiR and 100 μg NVs per mouse.

[0126] At predetermined time points (2 hours, 4 hours, 8 hours, 12 hours, and 24 hours), the mice were anesthetized. Fluorescence imaging of the mice was performed using an IVIS imaging system to monitor the distribution of labeled extracellular vesicles in vivo. This process helps to understand the localization of engineered cell membrane vesicles in tumor tissues and their biodistribution characteristics.

[0127] The results are as follows Fig. 20 As shown, V-NVs / T+A has the advantage of long-term accumulation in tumor sites compared with solution. Mice were sacrificed at 2, 12, and 12 hours after administration, and major organs and tumors were collected and analyzed using the IVIS imaging system. Fig.21 and Fig. 22 The results showed that the peak accumulation of V-NVs / T+A at the tumor site was significantly better than that of DiR solution, indicating excellent tumor accumulation ability.

[0128] In order to verify the tumor penetration ability mediated by NVs, NVs / T, V-NVs / T and V-NVs / T+A prepared in step 2), step 6) and step 8) of Example 1 were incubated with DiR for 1 hour to obtain DiR-NVs / T, DiR-V-NVs / T and DiR-V-NVs / T+A. The equivalent dose of 100 μg NVs was injected intravenously into BALB / c mice carrying 4T1 tumors. 24 hours after injection, the mouse tumor tissue was removed and tissue sections were prepared for subsequent analysis.

[0129] The sections were stained with CD31 and DAPI to mark tumor blood vessels, and the penetration of DiR-labeled vesicles in tumor tissue was observed by confocal laser scanning microscopy (CLSM). Fluorescence images were quantitatively analyzed using ImageJ software to evaluate the distribution and penetration ability of different types of NVs in tumor tissue. This experiment will help determine the actual performance of different types of engineered cell membrane vesicles in the tumor microenvironment. Fig.23 This indicates that V-NVs / T+A observed a large amount of DiR fluorescence in the deep areas of the tumor, which is consistent with our previous spheroid experiment results. In contrast, the tumor penetration depth of the other control groups was significantly less than that of V-NVs / T+A, indicating that VSVG and A23187 enhanced the tumor penetration of EVs.

[0130] Example 16: Anti-tumor effect in mouse lung metastasis model

[0131] To create a mouse tumor model, 4T1 cells (1×10 6 Six days later, 4T1-Luc cells (2×10 5 Two days later, the tumor volume grew to 100 mm 3 At the same time, the mice were randomly divided into six experimental groups, each containing five mice. The groups included: G1: control group (Saline) and the prepared mice in Example 1, G2: NVs / T, G3: V-NVs, G4: V-NVs / A, G5: V-NVs / T and G6: V-NVs / T+A.

[0132] During the treatment period, mice were dosed once every three days, each time with an equivalent dose of 100 μg of NVs. One day after each administration, mice were intraperitoneally injected with d-luciferin solution (15 mg / mL). Ten minutes later, bioluminescence was immediately detected and analyzed using in vivo bioluminescence imaging to assess cancer metastasis. After the last treatment, mice were euthanized and their lungs were immediately collected for ex vivo bioluminescence imaging to assess cancer metastasis. The collected lungs were incubated with d-luciferin solution (15 mg / mL) for 10 minutes before imaging. Subsequently, lung tissues were fixed in Bouin's solution, and lung and liver sections were H&E stained to assess the effect of anti-metastatic treatment. Tumor size was recorded, and H&E staining was performed to further analyze tissue morphology. To evaluate the immune response of anti-tumor model mice, tumors were minced, homogenized in enzyme buffer, formed into single-cell suspensions, and then stained with fluorescent antibodies and analyzed by flow cytometry using FlowJo software. Lymph nodes were treated in the same way, suspended in PBS, filtered, stained, and then subjected to cell analysis.

[0133] Fig.24The results showed that the lung fluorescence intensity was reduced in the V-NVs / A and V-NVs / T groups, indicating reduced metastatic growth, and V-NVs / T+A treatment further enhanced this effect and almost eliminated autoluminescence. Fig.26 These findings were confirmed by ex vivo autoluminescence imaging of excised lung tissue. Fig.25 The results showed that after fixation with Bouin's fluid, the normal lung area appeared yellow-brown, while the metastatic nodules appeared bright yellow, which was consistent with the bioluminescence data. Fig.30 and Fig.31 H&E staining after treatment with V-NVs / T+A showed a significant reduction in liver and lung metastatic nodules and minimal metastatic lesions. Fig. 27 and Fig.28 The results showed that compared with saline, the V-NVs / T+A strategy not only inhibited tumor metastasis but also reduced tumor volume. We further explored the relationship between the anti-metastatic effect and immune regulation, such as Fig.29 The results showed that the CD86 signal increased after treatment, indicating that mature DCs, tumor-infiltrating CD8 + The numbers of T cells and M1-like macrophages increased, confirming the activation of antitumor immunity.

[0134] Example 17: In situ anti-tumor effect in mice

[0135] To establish the tumor model, 4T1 cells were orthotopically injected into female BALB / c mice. 3 At the same time, the mice were randomly divided into six experimental groups, each containing five mice. The groups included: G1: control group (Saline) and the prepared mice in Example 1, G2: NVs / T, G3: V-NVs, G4: V-NVs / A, G5: V-NVs / T and G6: V-NVs / T+A.

[0136] During the treatment period, mice were given 100 μg equivalent dose of NVs every two days. The entire treatment process lasted for five cycles. During the treatment, the tumor volume and body weight of the mice were monitored daily to evaluate the treatment effect and observe possible side effects. By regularly recording and analyzing data, the inhibitory effect of different treatment groups on tumor growth and its impact on the overall health of mice were evaluated.

[0137] After the last treatment, blood was collected and mice were sacrificed to collect organs and tumor tissues. Tissues were fixed in 4% paraformaldehyde for subsequent H&E staining, TUNEL, and Ki67 analysis. Fig.32 and Fig.33As shown, the group without VSVG showed poor anti-tumor effect due to the inability to achieve membrane fusion. It is worth noting that V-NVs / T+A loaded with VSVG, A23187 and TNF-α showed great potential in penetration and immune activation, exhibiting the best anti-tumor effect, with a tumor inhibition rate of more than 70%. Finally, the therapeutic safety of V-NVs / T+A was preliminarily discussed. Fig.34 and Fig.36 As shown in the figure, after the end of the drug treatment, there was no damage to the liver, kidney and other organs of the mice, indicating that the drug showed good safety during the treatment period. The levels of TNF-α, IFN-γ and IL-6 immune factors in tumor tissues were measured. Fig.35 It showed that the levels of TNF-α and IFN-γ in the tumor tissues of mice in the V-NVs / T+A treatment group loaded with VSVG, A23187 and TNF-α were increased, and the level of IL-6 was decreased, which enhanced the immune response of the mice.

[0138] Example 18: Immunoassay

[0139] After collecting tumor tissue, the mouse tumor was cut into small pieces and the pieces were homogenized in a staining buffer containing enzymes to obtain a single cell suspension. Subsequently, the cells were stained with fluorescently labeled antibodies to mark specific cell populations. After staining, the labeled cells were analyzed using a flow cytometer, and the data were processed and analyzed using FlowJo software to evaluate the phenotype and distribution of the cells.

[0140] In addition, after the lymph nodes were extracted from the mice, they were crushed and the obtained cells were suspended in PBS. In order to remove cell clumps and debris, the cell suspension was filtered through a 70μm mesh to prepare a single cell suspension. Then, the cells were stained with a fluorescein-labeled antibody. Finally, the stained cells were analyzed using a flow cytometer, and the data were processed using FlowJo software to obtain the distribution and characteristic information of various types of cells in the lymph nodes. Fig.37 The results showed that the increase of CD86 signal after V-NVs / T+A treatment indicated a significant increase in the number of mature dendritic cells (DCs) compared with the other groups. + T cells (CD3 + CD8 + ) increased by 2.04-fold, while immunosuppressive regulatory T cells (Tregs, CD4 + Foxp3 +) decreased by 0.54-fold compared with the control group, indicating that V-NVs / T+A triggered a strong T cell-mediated immune response. Similar synergistic effects were observed in macrophages, further confirming the activation of antitumor immunity.

[0141] All the above results show that the engineered cell membrane vesicles of the present invention are used for cascade tumor deep penetration and TNF-α cytokine therapy to enhance tumor immunotherapy. The prepared engineered cell membrane vesicles can mediate membrane fusion at acidic pH, improve the efficiency of extracellular vesicles hitchhiking to penetrate tumors, and enhance the immune response of cancer.

[0142] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent application. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. An engineered cell membrane vesicle that triggers extracellular vesicle cascade permeation, characterized in that: The engineered cell membrane vesicles are cell membrane vesicles (NVs) whose surfaces are modified with membrane fusion promoters and compounds that promote extracellular vesicle secretion, and the interior of the vesicles is loaded with drugs.

2. The engineered cell membrane vesicle according to claim 1, characterized in that The membrane fusion promoter is the surface glycoprotein (VSVG) of vesicular stomatitis virus, the compound promoting extracellular vesicle secretion is a calcium ion carrier (A23187), and the drug is a TNF-α-Lamp2b plasmid; wherein the mass ratio of the protein mass in the cell membrane vesicles to the TNF-α-Lamp2b is 2:1, and the mass ratio of the protein mass in the cell membrane vesicles to the A23187 is 2:

1.

3. A method for constructing an engineered cell membrane vesicle according to claim 1, characterized in that: The surface of cell membrane vesicles (NVs) is modified with membrane fusion promoters and extracellular vesicle-promoting compounds, and the interior of the vesicles is loaded with drugs to prepare engineered cell membrane vesicles.

4. The method for constructing engineered cell membrane vesicles according to claim 3, characterized in that: The VSVG plasmid was transfected into the cells, and then the cell membrane vesicles carrying the membrane fusion promoter were extracted. The TNF-α-Lamp2b plasmid was then loaded into the cell membrane vesicles by electroporation, and then they were incubated with A23187 to obtain engineered cell membrane vesicles.

5. The method for constructing engineered cell membrane vesicles according to claim 4, characterized in that: The cells were mixed with the transfection reagent and the VSVG plasmid and cultured. After culture, the cells were ultrasonically disrupted and centrifuged to obtain cell membrane vesicles (V-NVs) carrying a membrane fusion promoter. V-NVs and TNF-α-Lamp2b plasmid were mixed in proportion and electroporated, followed by incubation. After incubation, A23187 was added for further incubation to obtain engineered cell membrane vesicles.

6. The method for constructing engineered cell membrane vesicles according to claim 4 or 5, characterized in that: The cell membrane vesicles (V-NVs) carrying the membrane fusion promoter are prepared by adding a transfection reagent (PEI) and a VSVG plasmid to the cells after culturing for 12 hours and mixing them thoroughly; the cells are then cultured in an Opti-MEM medium for 48 hours, and after culturing, the cells are resuspended in PBS, and after resuspension, the cell membrane vesicles carrying VSVG are collected by crushing, centrifuging, and filtering.

7. The method for constructing engineered cell membrane vesicles according to claim 6, characterized in that: The collected cells were resuspended, broken, and centrifuged to collect the final precipitate, which was filtered through a 0.22 μm filter to collect the cell membrane vesicles carrying VSVG; the centrifugation conditions were 2000 r.pm for 10 minutes, 5000 r.pm for 10 minutes, and 15000 r.pm for 60 minutes; after the first two centrifugations, the supernatant was taken and the precipitate was discarded, and the precipitate was taken from the last centrifugation and resuspended in PBS.

8. The method for constructing engineered cell membrane vesicles according to claim 5, characterized in that: V-NVs and TNF-α-Lamp2b plasmids were mixed in proportion in an electrophoresis tank at 4°C, and electroporated using an electroporator at 400V, 25μF capacitance and 50Ω resistance with a pulse duration of 10-15 milliseconds, followed by incubation at 37°C for 30 minutes. After incubation, A23187 was added in proportion, and the mixture was incubated in a 37°C incubator for 30 minutes to obtain engineered cell membrane vesicles.

9. Use of the engineered cell membrane vesicles according to claim 1 in the preparation of anti-tumor drugs.

10. The use according to claim 9, characterized in that: The drug is used by injection or local administration.

Images