Application of brown planthopper NlCP6 protein and coding gene thereof in regulation and control of brown planthopper resistance of plants

Abstract

The invention discloses application of brown planthopper NlCP6 protein and a coding gene thereof in regulation and control of brown planthopper resistance of plants, and relates to the technical field of genetic engineering prevention and control of rice brown planthopper. By inhibiting the expression of the coding gene of the NlCP6 protein in the brown planthopper, the growth and development of the brown planthopper can be obviously inhibited; aiming at overexpression of the nilaparvata lugens NlCP6 gene, an overexpression vector of the gene is constructed and transferred into a rice plant, so that the nilaparvata lugens resistance of the plant is greatly improved, and the weight gain and survival rate of the nilaparvata lugens eating the transgenic plant are remarkably reduced. The application method provided by the invention shows that the nilaparvata lugens NlCP6 gene plays a very important role in improving the resistance of rice nilaparvata lugens and inhibiting the growth and development of nilaparvata lugens, and has a wide application prospect; the method has great application value for reducing pesticide use, maintaining ecological balance and realizing sustainable development.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering control of rice brown planthopper, and in particular to application of brown planthopper NlCP6 protein and coding gene thereof in regulating plant resistance to brown planthopper. Background Art

[0002] Brown planthopper, belonging to the family of Homoptera, is one of the main pests on rice. Brown planthopper is a monophagous pest. Its piercing-sucking mouthparts can penetrate into the plant body and suck the phloem sap, causing a reduction in the number of rice panicles and grains. When rice is seriously damaged by brown planthoppers, it will cause large-scale death of rice, resulting in the phenomenon of "planthopper fire", and thus no grains will be harvested. Brown planthoppers cause a reduction in rice production of about 1 to 1.5 billion kilograms each year, equivalent to tens of billions of yuan in economic losses. At present, pesticides are generally used to control brown planthoppers, but with the large-scale use of pesticides, brown planthoppers have developed resistance to pesticides (Nagata, 1982; Lakshmi et al., 2010). In addition, spraying pesticides is not only harmful to humans and animals, but also causes serious environmental pollution. Therefore, it is of great significance to actively carry out research and application of biological control technology for brown planthoppers, implement scientific and effective control of the harm of brown planthoppers, and ensure food security and environmental safety.

[0003] RNA interference (RNAi) refers to the phenomenon of double-stranded RNA-mediated induction of efficient and specific degradation of homologous mRNA. Since its discovery, it has developed rapidly and become an effective tool for gene function research. It is also widely used in insect gene research. The method of using a microinjector to inject in vitro synthesized dsRNA into specific parts of insects is called microinjection. The injection volume of this method can be precisely controlled, and the effect of reduced expression of specific genes on single brown planthoppers can be specifically observed. It is one of the most commonly used introduction methods (Ober and Jockusch, 2006). The use of genetic engineering technology to enhance rice resistance to brown planthoppers is of great significance for the breeding and cultivation of new rice varieties resistant to brown planthoppers. Summary of the invention

[0004] The present invention first discovered the important role of NlCP6 protein of brown planthopper in regulating plant resistance to brown planthopper and inhibiting the growth of brown planthopper, and provided the application of NlCP6 protein of brown planthopper and its encoding gene in regulating plant resistance to brown planthopper. The survival ability of brown planthopper can be effectively reduced by inhibiting the expression of NlCP6 gene in brown planthopper, and the resistance of plant to brown planthopper can be effectively improved by overexpressing NlCP6 gene in plant. It is specifically achieved by the following technology.

[0005] In a first aspect of the present invention, a use of a brown planthopper NlCP6 protein or a gene encoding the same for improving rice resistance to brown planthoppers is provided. The amino acid sequence of the brown planthopper NlCP6 protein is as shown in SEQ ID NO.1, or is an amino acid sequence shown in SEQ ID NO.1 in which one or more amino acids are replaced, deleted and / or added, and has the same function as the protein composed of the amino acid sequence shown in SEQ ID NO.1.

[0006] Furthermore, the method for improving the brown planthopper resistance of rice is: overexpressing the coding gene of the brown planthopper NlCP6 protein in the rice.

[0007] The second aspect of the present invention provides an application of an inhibitory factor in inhibiting the growth of brown planthoppers. The inhibitory factor is a dsRNA that inhibits the expression of the gene encoding the NlCP6 protein of the brown planthopper. The nucleotide sequence of the dsRNA is shown in SEQ ID NO.2.

[0008] Furthermore, the method for inhibiting the growth of brown planthoppers is: inhibiting the expression of the gene encoding the brown planthopper NlCP6 protein; the amino acid sequence of the brown planthopper NlCP6 protein is as shown in SEQ ID NO.1, or the amino acid sequence shown in SEQ ID NO.1 is replaced, deleted and / or added with one or several amino acids, and has an amino acid sequence with the same function as the protein composed of the amino acid sequence shown in SEQ ID NO.1.

[0009] The third aspect of the present invention provides a method for improving rice resistance to brown planthoppers, by overexpressing a gene encoding the brown planthopper NlCP6 protein in the rice.

[0010] The fourth aspect of the present invention provides a method for inhibiting the growth of brown planthoppers, inhibiting the expression of the gene encoding the brown planthopper NlCP6 protein, the amino acid sequence of the brown planthopper NlCP6 protein is as shown in SEQ ID NO.1, or the amino acid sequence shown in SEQ ID NO.1 is replaced, deleted and / or added with one or several amino acids, and has an amino acid sequence with the same function as the protein composed of the amino acid sequence shown in SEQ ID NO.1.

[0011] Furthermore, the nucleotide sequence of the gene encoding the brown planthopper NlCP6 protein is as shown in SEQ ID NO.3, or the nucleotide sequence shown in SEQ ID NO.3 is replaced, deleted and / or one or several amino acids are added, and the nucleotide sequence encodes a nucleotide sequence with the same function as the nucleotide sequence shown in SEQ ID NO.3.

[0012] In a fifth aspect, the present invention provides an inhibitory factor for inhibiting the expression of a gene encoding the NlCP6 protein of brown planthopper, wherein the inhibitory factor is dsRNA, and the nucleotide sequence of the dsRNA is shown in SEQ ID NO.2.

[0013] Adding dsNlCP6 (dsRNA) as a biological pesticide to the solvent can reduce the use of pesticides; transferring dsNlCP6 into host rice can effectively inhibit the feeding of brown planthoppers.

[0014] The sixth aspect of the present invention provides a biological material, which is an expression cassette, a vector or a transgenic cell; the biological material includes a gene encoding the NlCP6 protein of the brown planthopper, or includes dsRNA.

[0015] In a seventh aspect, the present invention provides a method for preparing transgenic rice with resistance to brown planthoppers, wherein the method for improving the brown planthopper resistance of rice is used to cultivate transgenic rice with resistance to brown planthoppers.

[0016] Compared with the prior art, the present invention is beneficial in that: the present invention first discovered that the coding gene of the NlCP6 protein of the brown planthopper has a significant correlation with the growth and development of the brown planthopper. By inhibiting the expression of the coding gene of the NlCP6 protein in the brown planthopper, the growth and development of the brown planthopper can be significantly inhibited. Specifically, according to the cDNA sequence of the coding gene of the NlCP6 protein of the brown planthopper, the RNAi technology of microinjection of dsRNA is used to silence the NlCP6 gene of the brown planthopper, resulting in a lethal effect on the brown planthopper, and the survival rate becomes lower and lower as time goes by.

[0017] The present invention also aims at the overexpression of the NlCP6 gene of brown planthopper, constructs an overexpression vector of the gene and transfers it into rice plants, so that the resistance of the plants to brown planthoppers is greatly improved. The weight gain and survival rate of the brown planthoppers after feeding on the transgenic plants are significantly reduced.

[0018] The above discoveries and their applications in related technical fields indicate that the NlCP6 gene of brown planthopper plays a very important role in improving the resistance of rice to brown planthoppers and inhibiting their growth and development, and has broad application prospects. It also has great application value in reducing the use of pesticides, maintaining ecological balance and sustainable development. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The cloning result of the NlCP6 gene provided in Example 1 of the present invention; wherein the first lane is the Marker, the second lane is the NlCP6 ORF; and the third lane represents the NlCP6 ORF sequence after the signal peptide is removed.

[0020] Figure 2This is the agarose gel electrophoresis diagram of dsNlCP6 and dsGFP provided in Example 2 of the present invention.

[0021] Figure 3 The relative expression analysis results of the NlCP6 gene after microinjection provided in Example 3 of the present invention; wherein, CK is the uninjected brown planthopper, dsGFP is the brown planthopper injected with dsGFP, and 1-5 are the brown planthoppers injected with NlCP6 for different days; different lowercase letters indicate P<0.05, reaching significant difference.

[0022] Figure 4 The results of analysis of the survival rate and weight gain of brown planthoppers after microinjection provided in Example 4 of the present invention are provided; wherein, A is the result of placing brown planthoppers on rice after microinjection and counting the survival rate of brown planthoppers every day, and B is the result of weighing the weight gain of female insects within two days after the injection of brown planthoppers, waiting for them to emerge as adults.

[0023] Figure 5 The brown planthopper feeding control Nipponbare and Nipponbare provided in Example 6 of the present invention NlCP6 Plant phenotypic analysis results; A represents the wild type Nipponbare and Nipponbare NlCP6 The results of NlCP6 expression analysis in plants. B is the identification result of the positive strain of NlCP6 overexpressing transgenic T2 generation against brown planthoppers at the seedling stage. C is the results of brown planthoppers feeding on the transgenic plant parents Nipponbare and Nipponbare. NlCP6 The results of insect weight gain analysis of transgenic plants two days later. D shows brown planthoppers feeding on transgenic plants, parent Nipponbare and Nipponbare. NlCP6 Analysis results of the survival rate of brown planthoppers within ten days after transgenic plants. DETAILED DESCRIPTION

[0024] The technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0025] Example 1: Cloning of the NlCP6 gene of the brown planthopper

[0026] Twenty heads of biotype 1 brown planthoppers were taken, total RNA was extracted, and then converted into cDNA.

[0027] Primers were designed based on the cDNA sequence, and the 5' and 3' RACE kits of TaKaRa were used to obtain the 5' and 3' end sequences of the candidate gene, determine the transcription start and end sites of the candidate gene, and splice the full-length cDNA sequence of the gene.

[0028] Primers NlCP6-F and NlCP6-R were resynthesized based on the full-length cDNA sequence, and the full-length cDNA of NlCP6 was amplified. Figure 1 shown. Figure 1 In the figure, the first lane is the marker, the second lane is the NlCP6 ORF, and the third lane represents the NlCP6 ORF sequence after the signal peptide is removed. ORF was sequenced, and the nucleotide sequence is shown in SEQ ID NO.1.

[0029] The gene sequence encoding NlCP6 protein is shown in SEQ ID NO.3.

[0030] Primer NlCP6-F: 5'-atgagaggaattcaactagt-3', as shown in SEQ ID NO.4.

[0031] Primer NlCP6-R: 5'-tagttctggttgttcctcag-3', as shown in SEQ ID NO.5.

[0032] Example 2: Preparation of dsRNA (dsNlCP6) for silencing the NlCP6 gene of brown planthopper and the green fluorescent protein GFP gene dsGFP for control

[0033] 1. Using the cDNA obtained in Example 1 as a template, PCR amplification was performed using the following primers dsNlCP6-F and dsNlCP6-R to obtain a PCR amplification product.

[0034] Forward primer dsNlCP6-F: 5′-taatacgactcactatagggagaagcccagcaccctcggcagga-3′, as shown in SEQ ID NO.6.

[0035] Reverse primer dsNlCP6-R: 5′-taatacgactcactatagggagagttgttcctcagtttctccac-3′, as shown in SEQ ID NO.7.

[0036] Among them, the region of the sequence "taatacgactcactatagggaga" is the T7 RNA polymerase promoter sequence.

[0037] 2. Using the plasmid containing GFP as a template, perform PCR amplification with the following primers dsGFP-F and dsGFP-R to obtain the PCR amplification product.

[0038] Forward primer dsGFP-F: 5′-taatacgactcactatagggcggact-3′, as shown in SEQ ID NO.8.

[0039] Reverse primer dsGFP-R: 5′-taatacgactcactatagggcgatgc-3′, as shown in SEQ ID NO.9.

[0040] Among them, the region of the sequence "taatacgactcactataggg" is the T7 RNA polymerase promoter sequence.

[0041] 3. The above two amplification products were recovered, A was added, and connected to the pMD18-T (TAKARA) vector. The positive clones were sent for sequencing and the correct clone plasmid was screened. The clone plasmid was used as a template and amplified with the above primers respectively; the amplification product was purified and concentrated to a concentration of 1 μg / μL. The product was used as a template for dsRNA synthesis.

[0042] 4. Add the reagent system in Table 1 below to a 200 μL centrifuge tube according to the proportion; flick to mix, and centrifuge for a moment. Place in a PCR instrument for amplification. The amplification program is 37℃, 4 h; 75℃, 5 min; store at 16℃. Aspirate 1 μL, and detect by gel electrophoresis. After the target band is detected, proceed to the next step.

[0043] Table 1

[0044]

[0045] 5. Add the reagents shown in Table 2 below to the above centrifuge tubes to remove DNA and ssRNA.

[0046] Table 2

[0047]

[0048] Mix thoroughly, centrifuge briefly, and place in a PCR instrument at 37°C for 30 min. Then take out and add 1 μL of EDTA (Fementas), and continue to place back in the PCR instrument at 65°C for 5 min to terminate the reaction. Aspirate 1 μL, dilute 10 times, take 2 μL for gel electrophoresis, and take 2 μL to detect the concentration using a NANOdrop UV spectrophotometer.

[0049] If the detected band is a single bright band, such as Figure 2If the OD260 / 280 is between 1.8 and 2.0, it indicates that the dsRNA is of good quality and can be used for the next step. The nucleotide sequence of the dsRNA (dsNlCP6) used to silence the NlCP6 gene of brown planthopper is shown in SEQ ID NO.2.

[0050] 6. Perform routine phenol-chloroform extraction to remove proteins, adjust the dsRNA concentration to 5 μg / μL, dispense 10 μL into each tube, and store at -80°C.

[0051] Example 3: Microinjection of dsNlCP6 and dsGFP and effect detection

[0052] 1. Preparation of brown planthoppers: 30 females and 10 males were placed in a cup with TN1 seedlings. After 24 hours, the adults were taken out. After hatching, the fourth-instar nymphs were obtained after 20 days and were used for injection.

[0053] 2. Plate preparation: Weigh 1.5 g of agar powder and add it to 100 ml of water. Bring to a boil and pour into a glass plate. Wait for it to solidify and set aside.

[0054] 3. Injection: Take 5-8 insects of similar growth and place them in a test tube. Anesthetize them with CO2 for 20 seconds. Then pour the insects onto a 1.5% agar plate with the abdomen facing upward. Use Nanoliter 2010 microinjector to perform injection according to the instructions. The injection position is between the anterior and mid-thorax. The injection volume is 46 nl (5 μg / μL).

[0055] 4. After the brown planthoppers were injected with dsRNA, sampling was started from the first day after injection, with three samples taken every day for ten days; at the same time, the brown planthoppers without injection and injected with dsGFP were taken as controls.

[0056] qRT-PCR was used to verify the changes in gene expression. The specific operation was as follows: RNA was extracted after sampling, and the inversion was performed according to the instructions of TAKARA's PrimeScript RT reagent Kit with gDNA Eraser (Cat. No. RR047A) to obtain the inversion product. 5 μL of the cDNA obtained by inversion was diluted 10 times with TE, and real-time quantitative PCR was performed according to the following operation. The PCR reaction was performed on the CFX96 TouchTM Real-Time PCR Detection System (Bio-Rad) instrument, following the reaction system shown in Table 3 below.

[0057] Table 3

[0058]

[0059] Reaction conditions: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 5-10 s, TM (55-65℃) annealing and extension for 30 s, repeat the latter two steps for 40 cycles; finally 65℃-95℃, increase 0.5℃ each step, 5s to make a melting curve to determine the specificity of the amplified product. Each sample was repeated 3 times, and the amplification efficiency was calculated for each plate of PCR.

[0060] The results were analyzed using Bio-Rad CFX Manager. First, the melting curve, QC (quality control), etc. were analyzed to remove unqualified data. The Gene Study function of the software for gene expression analysis was (1+E) -ΔΔCt Algorithm analysis.

[0061] Primers for internal reference gene actin:

[0062] Actin-F: 5′-gacaggatgcagaaggaaatca-3′, as shown in SEQ ID NO.10.

[0063] Actin-R: 5′-gactcgtcgtactcctgctttg-3′, as shown in SEQ ID NO.11.

[0064] NlCP6 quantitative primers:

[0065] NlCP6-1F: 5′-atcaacgaagtcccgccttt-3′, as shown in SEQ ID NO.12.

[0066] NlCP6-1R: 5′-ggctggagtattgctcggtt-3′, as shown in SEQ ID NO.13.

[0067] 5. The results are as attached Figure 3 As shown in the figure, it can be seen that the relative expression of the NlCP6 gene in the brown planthoppers was significantly reduced from the first day of injection in the experimental group injected with ds NlCP6, compared with the uninjected brown planthoppers and the control group injected with dsGFP, and there was a significant difference compared with the control (P<0.05). This indicates that microinjection of dsNlCP6 can cause the RNAi effect of the salivary gland secretion gene NlCP6 in the brown planthoppers, resulting in a significant decrease in gene expression.

[0068] Example 4: Phenotypic detection of brown planthopper after microinjection

[0069] 1. Survival rate test of brown planthopper in this embodiment

[0070] The brown planthoppers were divided into three groups: uninjected, injected with dsGFP, and injected with dsNlCP6. After the injection, they were allowed to recover and then placed back on the rice. Ten insects were selected each time and repeated five times.

[0071] The test results are as follows Figure 4 As shown in A, it can be seen that after injection of dsNlCP6, the survival rate of brown planthoppers has been significantly lower than that of brown planthoppers injected with dsGFP and without injection since the third day of injection.

[0072] 2. Survival rate test of brown planthopper in this embodiment

[0073] After the injection, the three groups of brown planthoppers were placed back on the rice and waited for them to emerge. The brown planthoppers that emerged on the first day were weighed individually and then placed in a wax bag tied to the rice seedlings. Two days later, the surviving brown planthoppers were removed and weighed again. The difference between the two weights was recorded as the insect weight gain. Ten insects were used each time and repeated 5 times.

[0074] The test results are as follows Figure 4 As shown in Figure B, the weight gain of newly emerged brown planthoppers within 48 hours was analyzed, and it can be seen that the weight gain of the insects decreased after the injection of dsNlCP6. This indicates that after the injection of dsNlCP6, the expression level of this gene was reduced, which affected the feeding of brown planthoppers and thus affected the survival rate of brown planthoppers.

[0075] Example 5: Construction of genetic transformation vector for overexpression of NlCP6 gene in brown planthopper

[0076] 1. ORF sequence amplification (remove the signal peptide segment): use high-fidelity enzyme KOD Plus Neo (TOYOBO) and primer NlCP6 -SP -F and NlCP6 -SP -R, the template is a plasmid containing the NlCP6 gene, and the ORF sequence of the NlCP6 gene is amplified.

[0077] Primer NlCP6 -SP -F: 5'-atgagcccagcaccctcggc-3', as shown in SEQ ID NO.14.

[0078] Primer NlCP6 -SP -R: 5'-gttctggttgttcctcagtt-3', as shown in SEQ ID NO.15.

[0079] 2. After PCR is completed, take 2 μL for agarose gel electrophoresis. If the band is single, directly recover it; if there are mixed bands, cut the gel to recover the target size fragment, which is about 0.7kb. Since there is no A tail at the end of the KOD PLUS NEU amplified fragment, it is necessary to add A before connecting to the vector.

[0080] 3. The pCXUN vector was digested with Xcm I to form a T terminus, which was then connected to the A-added product at 16°C overnight. Transformation was performed, and a single clone was selected. The vector primers were UBIS and UBIA. The size of the inserted fragment was verified by PCR. The fragment of about 1 kb was sent to the company for sequencing.

[0081] Primer UBIS: 5′-tgtttcttttgtcgatgctcaccc-3′, as shown in SEQ ID NO.16.

[0082] Primer UBIA: 5′-ttctatcgcggcttaacgtaattca-3′, as shown in SEQ ID NO.17.

[0083] 4. The correctly sequenced vector plasmid was transferred into Agrobacterium strain EHA105 by conventional electroporation.

[0084] Example 6: Verification of transgenic function after NlCP6 overexpression

[0085] 1. Obtaining transgenic plants overexpressing NlCP6 mediated by Agrobacterium

[0086] The NlCP6 overexpression genetic transformation vector was introduced into Nipponbare using the Agrobacterium EHA105-mediated genetic transformation method (Hiei et al., 1994, Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant Journal 6:271-282).

[0087] 2. Brown planthoppers feed on Nipponbare NlCP6 Phenotypic verification of transgenic plants

[0088] After harvesting the seeds, the T2 generation homozygous transgenic plants Nipponbare NlCP6 , Nipponbare NlCP6 The expression of NlCP6 gene in the culture medium was detected by quantitative PCR, the primers were NlCP6-1F and NlCP6-1R, the internal reference was Osactin, and the internal reference primers were Osactin-F and Osactin-R. Figure 5 As shown in A, it can be seen that the NlCP6 gene accumulates in large quantities in the transgenic plants.

[0089] Primer NlCP6-1F: 5'-gtgtgggaatgtcatctg-3', as shown in SEQ ID NO.18.

[0090] Primer NlCP6-1R: 5′-gctgctgtaatcactatca-3′, as shown in SEQ ID NO.19.

[0091] Primer Osactin-F: 5'-gatcactgccttggctccta-3', as shown in SEQ ID NO.20.

[0092] Primer Osactin-R: 5′-gtactcagccttggcaatcc-3′, as shown in SEQ ID NO.21.

[0093] The positive transgenic lines were identified for resistance to brown planthoppers using the seedling group method. Figure 5 As shown in B, 10 days after the inoculation of brown planthoppers, the whole plant of the control variety Nipponbare died, while the transgenic positive strain of the NlCP6 overexpression vector still survived, indicating that the NlCP6 gene has the function of enhancing rice resistance to brown planthoppers. Therefore, the brown planthopper gene NlCP6 can be used in rice to cultivate rice varieties with brown planthopper resistance.

[0094] Twenty second-instar brown planthoppers of biotype I fed on Nipponbare and Nipponbare NlCP6 , the survival rate of insects according to the number of days, repeated five times. The results are as follows Figure 5 As shown in C, due to the transgenic plant Nipponbare NlCP6 The increased resistance affected the feeding of brown planthoppers, causing a significant decrease in their survival rate on the 9th day.

[0095] The newly emerged female adults of biotype I were reared in Nipponbare NlCP6 and Nippon Haru NlCP6 Two days later, weigh the worms, 10 each time. Repeat three times. Figure 5 As shown in D, the insect weight of brown planthopper was also significantly reduced. All these indicate that PIB14 can improve the resistance of rice to brown planthopper.

[0096] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, the technical solution of the present invention can be modified and changed in many simple ways, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. Application of brown planthopper NlCP6 protein or its encoding gene in improving rice resistance to brown planthopper, characterized in that: The amino acid sequence of the brown planthopper NlCP6 protein is as shown in SEQ ID NO.1, or is an amino acid sequence shown in SEQ ID NO.1 with one or more amino acids substituted, deleted and / or added, and has the same function as the protein composed of the amino acid sequence shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The method for improving the brown planthopper resistance of rice is: overexpressing the coding gene of the brown planthopper NlCP6 protein in the rice.

3. An application of an inhibitory factor in inhibiting the growth of brown planthopper, characterized in that: The inhibitory factor is a dsRNA that inhibits the expression of the gene encoding the NlCP6 protein of the brown planthopper, and the nucleotide sequence of the dsRNA is shown in SEQ ID NO.

2.

4. The use according to claim 3, characterized in that: The method for inhibiting the growth of brown planthoppers is: inhibiting the expression of the gene encoding the brown planthopper NlCP6 protein; the amino acid sequence of the brown planthopper NlCP6 protein is as shown in SEQ ID NO.1, or the amino acid sequence shown in SEQ ID NO.1 is replaced, deleted and / or added with one or several amino acids, and has an amino acid sequence with the same function as the protein composed of the amino acid sequence shown in SEQ ID NO.

1.

5. A method for improving rice resistance to brown planthoppers, characterized in that: The gene encoding the brown planthopper NlCP6 protein is overexpressed in the rice.

6. A method for inhibiting the growth of brown planthopper, characterized in that: The expression of the gene encoding the brown planthopper NlCP6 protein is inhibited, and the amino acid sequence of the brown planthopper NlCP6 protein is as shown in SEQ ID NO.1, or the amino acid sequence shown in SEQ ID NO.1 is replaced, deleted and / or one or more amino acids are added, and the protein composed of the amino acid sequence shown in SEQ ID NO.1 has the same function as the amino acid sequence shown in SEQ ID NO.

1.

7. The method for inhibiting the growth of brown planthopper according to claim 6, characterized in that: The nucleotide sequence of the gene encoding the brown planthopper NlCP6 protein is shown in SEQ ID NO.3, or the nucleotide sequence shown in SEQ ID NO.3 is substituted, deleted and / or added with one or several amino acids, and encodes a nucleotide sequence with the same function as the nucleotide sequence shown in SEQ ID NO.

3.

8. An inhibitory factor for inhibiting the expression of a gene encoding NlCP6 protein of brown planthopper, characterized in that: The inhibitory factor is dsRNA, and the nucleotide sequence of the dsRNA is shown in SEQ ID NO.

2.

9. A biomaterial, characterized in that: The biological material is an expression box, a vector or a transgenic cell; the biological material includes a gene encoding the NlCP6 protein of the brown planthopper, or includes dsRNA.

10. A method for preparing transgenic rice with brown planthopper resistance, characterized in that: The method for improving the brown planthopper resistance of rice as claimed in claim 5 is used to cultivate transgenic rice with brown planthopper resistance.

Images