Edwardsiella ictaluri ghost preparation mutant strain based on chromosome induced cleavage system as well as construction method and application thereof

Abstract

The invention discloses a mutant strain prepared from Edwardsiella ictaluri ghost based on a chromosome induced cleavage system and a construction method and application of the mutant strain, and belongs to the field of bioengineering. According to the invention, a 106-565bp sequence of an Edwardsiella ictaluri acyl homoserine lactone synthetase gene LuxI is deleted, and a lysis gene E and an arabinose induced control unit thereof are inserted in the interval, so that a mutant strain prepared from Edwardsiella ictaluri ghost based on a chromosome induced lysis system is constructed; according to the successfully constructed Edwardsiella ictaluri mutant strain YCH-BG, not only is the use of a temperature control cracking system avoided, but also the bacteriolysis effect is more stable, and the bacteriolysis rate reaches 99.995%. Compared with a wild strain, the mutant strain has the same form and physiological and biochemical characteristics, has no obvious difference in growth curve, but has obviously reduced toxicity, and can be used for preparing an efficient and safe bacterial ghost vaccine.

Description

Technical Field

[0001] The invention belongs to the field of bioengineering, and particularly relates to a mutant strain prepared by using Edwardsiella ictaluri exuviae based on a chromosome-induced lysis system, and a construction method and application thereof. Background Art

[0002] Edwardsiella ictaluri is one of the main pathogens of some economic fish of the order Siluriformes. Its infection can cause acute enteric septicemia, septicemia and red head disease in channel catfish, six-barbed catfish and yellow catfish. Under natural conditions, Edwardsiella ictaluri can also infect non-Siluriformes fish. Recent studies have shown that its epidemic area and infected objects are still expanding, which seriously restricts the healthy development of related aquaculture industries.

[0003] At present, the prevention and control of bacterial diseases in fish still mainly rely on the use of antibiotics, but sick fish usually have a decreased appetite, which will seriously reduce the utilization rate of drugs. In addition, the large-scale use of antibiotics will also cause potential problems such as drug residues, water pollution, increased resistance of pathogens, and physiological disorders of fish. Studies have shown (Wang Qiyao. Research Progress on Research and Application of Fish Vaccine Technology in China [J]. Journal of Dalian Ocean University, 2022, 37(01): 1-9) that vaccines are one of the most economical and effective measures to prevent and control infectious diseases. Traditional inactivated vaccines and subunit vaccines have good safety, but their immunogenicity is generally weak; although live attenuated vaccines can induce a strong immune response in the body, potential safety issues such as reverse mutation and spread risks are difficult to eliminate. Therefore, the development of a stable, efficient and safe vaccine is of great significance for the prevention and control of Edwardsiella ictaluri and the diseases it causes.

[0004] Bacterial exuviae are complete bacterial shells without cytoplasmic contents formed after Gram-negative bacteria are lysed by the phage PhiX174 lytic gene E. Because the original surface structure and characteristics of the bacteria are retained, bacterial exuviae have excellent immunogenicity and adjuvant properties, which can induce the body to produce strong cellular immunity and humoral immunity, and thus have better immune protection than conventional vaccines. In addition, bacterial exuviae can be mass-produced by fermentation, and freeze-dried bacterial exuviae can be stored for a long time at room temperature without reducing their immune efficacy. The periplasmic space and cavity of bacterial exuviae can also carry or deliver antigens, nucleic acids and various drugs. Therefore, bacterial exuviae have huge application and development prospects.

[0005] At present, the preparation of Edwardsiella ictaluri exuviae is mainly carried out through a temperature-controlled system lysis system. In this system, the lysis gene E is placed under the control of the temperature-controlled expression system λpL / pR-cI857, and the expression of gene E can be induced by simply raising the temperature (28°C→42°C). However, this strategy ignores the biological characteristics of Edwardsiella ictaluri itself-the suitable growth temperature is 26°C-30°C, and it cannot grow above 30°C. Therefore, in subsequent studies, the preparation of Edwardsiella ictaluri exuviae was improved to be carried out through arabinose-induced lysis plasmids. However, since it is still achieved through the induced expression of an exogenous plasmid carrying the lysis gene E, there is a risk of resistance gene spread. In addition, during the lysis process, the plasmid is easily lost as the transmembrane channel is formed, so that the host bacteria cannot be completely inactivated, and there is a potential biosafety risk. Summary of the invention

[0006] Purpose of the invention: In order to solve the above technical problems, the present invention aims to provide a recombinant plasmid pDS133-ΔLuxI-E for constructing a mutant strain for preparing Edwardsiella ictaluri. Through the recombinant plasmid pDS133-ΔLuxI-E, the present invention utilizes homologous recombination technology to delete the 106-565bp sequence of the Edwardsiella ictaluri acylhomoserine lactone synthase gene LuxI, inserts the lysis gene E and its arabinose induction control unit in this interval, constructs a mutant strain for preparing Edwardsiella ictaluri based on the chromosome-induced lysis system, and realizes stable, efficient and safe preparation of Edwardsiella ictaluri.

[0007] The invention also provides a method for constructing the recombinant plasmid pDS133-ΔLuxI-E.

[0008] The invention also provides an Edwardsiella ictaluri mutant strain YCH-BG for preparing Edwardsiella ictaluri exuviae and a construction method thereof.

[0009] Technical solution: In order to achieve the above-mentioned purpose, the recombinant plasmid pDS133-ΔLuxI-E for preparing Edwardsiella ictaluri exuviae of the present invention has a nucleotide sequence as shown in SEQ ID NO.1.

[0010] The method for constructing the recombinant plasmid pDS133-ΔLuxI-E of the present invention comprises the following steps:

[0011] (1) Construction of recombinant plasmid pDS133-ΔLuxI;

[0012] (2) Using plasmid pFGH106-BAD-E as a template, the cleavage E and its arabinose-inducible control unit were amplified and then cloned into the Spe I and Xho I restriction sites of plasmid pDS133-ΔluxI, respectively, to construct the recombinant plasmid pDS133-ΔluxI-E.

[0013] Furthermore, the method for constructing the recombinant plasmid pDS133-ΔLuxI in step (1) is as follows: primers are designed according to the LuxI gene of Edwardsiella ictaluri and its upstream and downstream sequences, the LuxI gene sequence is partially deleted by overlapping PCR, and then cloned between the Xba I and Sac I restriction sites of the plasmid pDS133 to construct the recombinant plasmid pDS133-ΔLuxI.

[0014] Wherein, the primers in step (1) include P1, P2, P3, and P4, and their sequences are:

[0015] P1:CGCTCTAGAAAAGGTGCTAACACATCA

[0016] P2: TAGCGTGCACTAGTTACGCCCAGTTAAGCCGATCCT

[0017] P3: TAGTGCACGCTAGCATTCTCGAGCGGATTAATCAGGA

[0018] P4:AAGGAGCTCCCGTTGACACGTAAGAT.

[0019] Furthermore, the method for constructing the recombinant plasmid pDS133-ΔluxI-E in step (2) is: using the plasmid pFGH106-BAD-E as a template, designing different primers to amplify the cleavage E and its arabinose-induced control unit with different terminators, and then cloning them between the Spe I and Xho I restriction sites of the plasmid pDS133-ΔluxI, respectively, to construct the recombinant plasmid pDS133-ΔluxI-E containing terminators at both ends.

[0020] Wherein, the primers in step (2) include: P7 / P8, P7 / P9, P10 / P11, and their sequences are:

[0021] P7:CGCACTAGTGAGTTTGTAGAAACGCAAAA

[0022] P8:CCTCTCGAGGATTCTCACCAATAAAAAAAC

[0023] P9:CTTCTCGAGTCATTATGACAACTTGACGCTA

[0024] P10:CGCACTAGTGATTCTCACCAATAAAAAACGCC

[0025] P11:CCTCTCGAGTCACTCCTTCCGCACGTAA.

[0026] The invention discloses an Edwardsiella ictaluri mutant strain YCH-BG obtained based on the recombinant plasmid pDS133-ΔLuxI-E.

[0027] The mutant strain used for preparing Edwardsiella ictaluri exuviae of the present invention is formed by combining Edwardsiella ictaluri as a starting strain with Escherichia coli SM10λpir containing the plasmid pDS133-ΔLux-E through transduction and gene recombination.

[0028] The method for constructing a mutant strain for preparing Edwardsiella ictaluri exuviae of the present invention comprises the following steps: transforming a plasmid pDS133-ΔLuxI-E into Escherichia coli SM10λpir, combining and transducing with Edwardsiella ictaluri YCH, verifying the successful integration of the conjugate by resistance plate and PCR, and continuously culturing the conjugate in an LB liquid culture medium containing 10% sucrose and no NaCl to promote secondary recombination, and then performing screening and verification, and finally obtaining the Edwardsiella ictaluri mutant strain YCH-BG.

[0029] Furthermore, the concentration of Escherichia coli SM10λpir and Edwardsiella ictaluri YCH containing the recombinant plasmid pDS133-ΔLuxI-E was adjusted to 1×10 8 CFU / mL, and then mix the two evenly at a bacterial count ratio of 5:1.

[0030] The mutant strain for preparing Edwardsiella ictaluri exuviae of the present invention is used in preparing Edwardsiella ictaluri exuviae.

[0031] The mutant strain for preparing Edwardsiella ictaluri exuviae of the present invention is used in preparing an exuviae vaccine for preventing and controlling Edwardsiella ictaluri.

[0032] Among them, the present invention relates to a mutant strain prepared by using the exuviae of Edwardsiella ictaluri based on a chromosome-induced lysis system, which is Edwardsiella ictaluri YCH-BG.

[0033] The construction of the mutant strain YCH-BG was carried out according to the following steps:

[0034] 1) Primers were designed based on the LuxI gene of Edwardsiella ictaluri and its upstream and downstream sequences, and the LuxI gene sequence was partially deleted by overlapping PCR. Then, the primers were cloned between the Xba I and Sac I restriction sites of the suicide plasmid pDS133 to construct the suicide recombinant plasmid pDS133-ΔLuxI.

[0035] 2) Using plasmid pFGH106-BAD-E as a template, different primers were designed to amplify cleavage E and its arabinose-induced control unit with different terminators, and then cloned into the Spe I and Xho I restriction sites of plasmid pDS133-ΔluxI, respectively, to construct a recombinant suicide plasmid pDS133-ΔluxI-E with terminators at both ends and a recombinant suicide plasmid pDS133-ΔluxI-E with terminators at only one end (nt 0 ) and pDS133-ΔluxI-E(nr).

[0036] 3) The above recombinant plasmids were transformed into Escherichia coli SM10λpir and the lysis kinetics were compared.

[0037] 4) According to the comparison results of lysis kinetics, the plasmid with the best lysis effect was selected to construct mutant strains of Edwardsiella ictaluri based on the chromosome-induced lysis system, and the construction of mutant strains was carried out by conjugative transfer.

[0038] 5) Screening and identification of mutant strains.

[0039] 6) The successfully constructed mutant strains were tested in terms of biological characteristics, virulence and bacteriolytic effect, and observed under electron microscopy.

[0040] The present invention constructs Edwardsiella ictaluri exuviae to prepare mutant strains based on the chromosome-induced lysis system, utilizes homologous recombination technology to delete the 106-565bp sequence of the acylhomoserine lactone synthase gene LuxI of Edwardsiella ictaluri, and inserts the lysis gene E and its arabinose control unit in this interval. Compared with the wild strain, the mutant strain has the same morphological and physiological and biochemical characteristics, and there is no obvious difference in the growth curve, but the virulence is significantly reduced. The present invention introduces a new vaccine technology platform-exuviae into the development of Edwardsiella ictaluri vaccine, overcomes the shortcomings of traditional vaccines, and at the same time improves and perfects the problems existing in the application of current exuviae vaccines, which can be used for the prevention and control of Edwardsiella ictaluri and the diseases caused by it, and is expected to have broad social and economic benefits.

[0041] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0042] The present invention first constructs a recombinant plasmid pDS133-ΔLuxI-E for preparing Edwardsiella ictaluri exuviae, and finally successfully constructs a mutant strain for preparing Edwardsiella ictaluri exuviae, wherein the 106-565bp sequence of the acylhomoserine lactone synthase gene LuxI is replaced by the lysis gene E and its arabinose control unit, thereby avoiding the use of a temperature-controlled lysis system. At the same time, since the lysis system exists on the chromosome, the lysis effect is more stable, and arabinose is added for induction during the exponential growth phase, the mutant strain can be successfully lysed, and the OD 600The value reached the lowest level and remained stable after 4 hours of induction, and the lysis rate reached 99.995%. Scanning electron microscopy showed the presence of transmembrane channels, and the surface structure was similar to that of the parent but slightly wrinkled. Transmission electron microscopy showed that the cytoplasmic contents of the exuviae had been fully released. Compared with the wild-type strain, the mutant strain had the same morphological and physiological and biochemical characteristics, and no significant differences were found in the growth curve, but the virulence was significantly reduced.

[0043] The mutant strain constructed by the present invention has the characteristics of live attenuated vaccine and can be applied to the efficient and safe preparation of Edwardsiella ictaluri exuviae vaccine. At the same time, the mutant strain construction method involved in the present invention can also be used for the construction and preparation of other Gram-negative bacteria efficient and safe exuviae vaccine, which is conducive to the expansion of exuviae technology in the future. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 The physical map of the plasmid pDS133-ΔLuxI-E of the present invention, R6K ori: R6K plasmid replication origin; mob RP4: RP4 plasmid transfer-related gene; Cat: chloramphenicol acetyltransferase; SacB: fructan sucrose transferase; LuxI-USS: LuxI gene upstream sequence; rrnBT1T2: ribosomal RNA operon T1T2 terminator; E: lytic gene E; pBAD: arabinose promoter; araC: arabinose operon regulatory protein araC gene; LuxI-DSS: LuxI gene downstream sequence; t0: t0 terminator of bacteriophage lambda;

[0045] Figure 2 Amplification of the upstream and downstream sequences of LuxI gene (A) and overlapping PCR (B), M: DNA Marker; Lane 1 (A): PCR product of the upstream sequence of LuxI gene; Lane 2 (A): PCR product of the downstream sequence of LuxI gene; Lane 1 (B): Overlapping PCR product of the upstream and downstream sequences of LuxI gene;

[0046] Figure 3 PCR screening and identification of plasmid pDS133-ΔLuxI, M: DL-2000 DNA Marker; Lanes 1-10: target clones;

[0047] Figure 4 For PCR identification of lytic plasmids, M: DL-5000 DNA Marker; Lanes 1-2: plasmid pDS133-ΔLuxI-E; Lanes 3-4: plasmid pDS133-ΔLuxI-E (nt0); Lanes 5-6: plasmid pDS133-ΔLuxI-E (nt0);

[0048] Figure 5 is the lysis curve of recombinant E. coli SM10λpir;

[0049] Figure 6 For PCR identification of the binder LuxI gene, M: DL-2000DNAMarker; Lanes 1-2: binder; Lanes 3-4: YCH;

[0050] Figure 7 For PCR identification of the binder Cat and SacB genes, M: DL-2000 DNA Marker; Lane 1-2: PCR product of the binder Cat gene; Lane 3-4: PCR product of the binder SacB gene;

[0051] Figure 8 For the species-specific identification of the conjugate, M: DL-2000 DNA Marker; Lane 1-2: conjugate; Lane 3-4: YCH;

[0052] Fig. 9 For secondary mutation screening of binders, M: DL-5000 DNA Marker; Lanes 1, 2, 5: binders; Lanes 3, 8, 9: target mutants; Lanes 4, 6, 7, 10: revertant mutants;

[0053] Fig.10 The colony morphology of Edwardsiella ictaluri mutant strain YCH-BG (A) and wild strain YCH;

[0054] Fig.11 is the growth curve of Edwardsiella ictaluri mutant strain YCH-BG;

[0055] Fig.12 is the lysis curve of Edwardsiella ictaluri YCH-BG;

[0056] Fig.13 Scanning electron microscopy (A, B) and transmission electron microscopy (C, D) observations of Edwardsiella ictaluri. A, C: Edwardsiella ictaluri YCH-BG (×10000); B, D: Edwardsiella ictaluri YCH (×10000). DETAILED DESCRIPTION

[0057] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0058] The experimental materials used in the following examples are:

[0059] 1. Strains and Plasmids

[0060] Edwardsiella ictaluri YCH was isolated from yellow catfish with "red head disease" (Ma Shijie, Guo Jinzhi, Wei Jiao, Fu Lixia. Isolation and identification of the pathogen of red head disease in all-male yellow catfish [J]. Aquaculture, 2023, 44(03): 1-7) and preserved by Yangzhou University.

[0061] Escherichia coli SM10λpir (Wang Haiyan, Yan Meiying, Zhao Yingwei, Kan Biao. mtlR is a transcriptional repressor gene in the mannitol PTS operon of Vibrio cholerae [J]. Acta Microbiologica Sinica, 2007, 47(3): 522-525) was kindly provided by Kan Biao, Chinese Center for Disease Control and Prevention.

[0062] Plasmids pDS133 (Fu Lixia. Development and evaluation of non-plasmid-dependent bacterial exuviae vaccine for Aeromonas hydrophila, doctoral thesis, 2012.) and pFGH106-BAD-E (Ma Shijie. Isolation and identification of Edwardsiella ictaluri and development of bacterial exuviae vaccine, master's thesis, 2023) were both constructed and preserved by Yangzhou University.

[0063] 2. Main Reagents

[0064] Restriction endonucleases Sac I (Code No. 1627), Xba I (Code No. 1634), Spe I (Code No. 1631), Xho I (Code No. 1635), T4 DNA ligase (Code No. 2011A), PrimeSTAR HS (Premix) (Code No. R040A), Premix Taq (Code No. RR901A), TaKaRa MiniBESTAgarose Gel DNA Extraction Kit Ver. 4.0 (Code No. 9762), DL2000 DNA Marker (Code No. 3427A) and DL5000 DNA Marker (Code No. 3428A) are all products of Bio-Rad Biotechnology (Beijing) Co., Ltd. Plasmid extraction kit TIANprep Mini Plasmid Kit (Cat.#DP106-02) and bacterial genomic DNA extraction kit TIANamp DNA Kit (Cat.#DP302-02) were products of Tiangen Biochemical Technology (Beijing) Co., Ltd. Brain heart infusion broth (CM917B), brain heart infusion agar (CM918), LB broth (CM158) and LB agar (CM159) were purchased from Beijing Luqiao Technology Co., Ltd.; polymyxin E sulfate (YY10857) was a product of Shanghai Yuanye Biotechnology Co., Ltd. L-arabinose (V900920) was a product of Sigma-Aldrich. All primers (Table 1) were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0065] Table 1 Primers used in the present invention

[0066]

[0067]

[0068] Example 1

[0069] Construction of plasmid pDS133-ΔLuxI

[0070] 1. Preparation of Escherichia coli SM10λpir competent cells The preparation of Escherichia coli SM10λpir competent cells was carried out according to the method described by Fu Lixia et al. (Fu Lixia, Xu Jingxiao, Han Xiangan, Yang Hui, Lai Yingtiao, Huang Zhibin. Construction and evaluation of a prokaryotic promoter reporter system based on lacZ gene and pUC replicon [J]. Journal of Biotechnology, 2021, 37(1): 321-330.) with slight modifications. The specific operation is as follows: streak the frozen Escherichia coli SM10λpir bacterial solution on the LB plate with an inoculation loop and culture at 37℃ for 8-16h, then use a sterilized small pipette tip (10μL) to pick up a single colony and inoculate it in 5mL LB culture medium, shake and culture at 37℃ overnight, and take 300-400μL of bacterial culture medium and inoculate it in 25mL the next day. In LB liquid medium, shake and culture at 150r / min for 3-4h. When the OD600 value reaches 0.3-0.4, take out the culture bottle and divide it into 1.5mL centrifuge tubes. Ice bath for 3min, then centrifuge at 8000r / min for 1min, discard the supernatant, and add 500μL pre-cooled 0.1m / L CaCl 2 -MgCl 2 Solution (80mmol / L CaCl 2 , 20mmol / LMgCl 2 ) and resuspend the cells, place on ice for 30 min, centrifuge at 10,000 rpm for 15 s, carefully remove the supernatant with a pipette tip, and add 100 μL of pre-cooled 0.1 mol / L CaCl containing 15% glycerol to the precipitate. 2 Resuspend the bacteria in the solution and store in a -80℃ refrigerator for later use.

[0071] 2. Construction of plasmid pDS133-ΔLuxI

[0072] According to the published genome information of Edwardsiella ictaluri YCH (CP040933.1), primers P1, P2, P3, and P4 (Table 1) were designed for the luxI gene and its upstream and downstream sequences. The sequence of 106-565 bp in the luxI gene was deleted by overlapping PCR, while the sequences of 764 bp and 793 bp in the upstream and downstream regions were retained respectively for subsequent homologous recombination.

[0073] The specific steps are as follows: first, the YCH genome of Edwardsiella ictaluri was used as a template, and the upstream and downstream sequence fragments of the luxI gene were amplified using primer pairs P1 / P2 and P3 / P4, respectively. The reaction system was 50 μL, of which the forward and reverse primers and templates were 1 μL each, PrimerStar HS Premix 25 μL, and sterilized double distilled water 22 μL. The PCR amplification conditions were: 98°C for 10 s, 55°C for 15 s, 72°C for 1 min, and 30 cycles. After the PCR reaction was completed, agarose gel electrophoresis was performed and the target fragment was recovered by gel cutting. Then, the amplified upstream and downstream sequence fragments of the luxI gene were used as templates, and the second round of PCR was performed using primer pair P1 / P4.

[0074] The target fragment of the second round of amplification products was recovered by double digestion with SacⅠ and XbaⅠ, and then connected to the plasmid pDS133 which was also digested with SacⅠ / XbaⅠ. The next day, the ligation product was transformed into E. coli SM10λpir competent cells, and then evenly spread on LB chloramphenicol resistance plates and placed in an incubator for overnight culture at 37℃. After the colonies grew on the plate, some clones were randomly picked with a sterilized small gun tip for PCR identification. The clones identified as positive by PCR were expanded and cultured, and the plasmids were extracted and sent to Shanghai Biotech Co., Ltd. for sequencing verification. The successfully constructed plasmid was named pDS133-ΔLuxI.

[0075] Experimental results: Using the YCH genome of Edwardsiella ictaluri as a template, the expected upstream and downstream target fragments of the LuxI gene amplified by primer pairs P1 / P2 and P3 / P4 were 869 bp and 894 bp respectively (including protective bases, the same below) ( Figure 2 A). Using the recovered product as a template, overlapping PCR was performed using primer pair P1 / P4, and the obtained fragment length was 1796 bp ( Figure 2 B). Using primer pair P5 / P6, PCR screening and identification of transformed growth clones was performed, and the expected target band of 1927 bp was observed ( Figure 3 ), and the final plasmid sequencing results were consistent with expectations, indicating that the plasmid pDS133-ΔLuxI was successfully constructed.

[0076] Example 2

[0077] Construction of mutant strain YCH-BG prepared from Edwardsiella ictaluri exuviae

[0078] 1. Construction of lytic plasmid

[0079] Using plasmid pFGH106-BAD-E as a template, primers were designed, and primer pairs P7 / P8, P7 / P9, and P10 / P11 were used to amplify the lytic E gene and its arabinose regulatory unit, respectively. The two ends of the fragment amplified by primer P7 / P8 contained terminators rrnbT1T2 and t0, respectively, the fragment amplified by primer P7 / P9 contained the terminator rrnbT1T2 only at one end of the lytic gene E, and the fragment amplified by P10 / P11 contained the t0 terminator only at one end. After the PCR reaction was completed, the product was electrophoresed in a 1% agarose gel and cut and recovered. The recovered product was double-digested with Spe I / Xho I, and then connected to the pDS133-ΔLuxI plasmid prepared in Example 1 of the present invention and also double-digested with Spe I / Xho I, and transformed into Escherichia coli SM10λpir. After the plasmid was extracted, the finally constructed plasmids were named pDS133-ΔLuxI-E (P7 / P8), pDS133-ΔLuxI-E (nt0) (P7 / P9) and pDS133-ΔLuxI-E (nr) (P10 / P11), wherein the sequence of the plasmid pDS133-ΔLuxI-E is shown in SEQ ID NO.1, as shown in Figure 1 , as shown in Table 2.

[0080] Experimental results: Using plasmid pFGH106-BAD-E as a template, primer pairs P7 / P8, P7 / P9, and P10 / P11 were used to amplify the lytic E gene and its arabinose regulatory unit, and cloned into plasmid pDS133-ΔLuxI. Then, primer pair P12 / P13 was used to construct plasmids pDS133-ΔLuxI-E, pDS133-ΔLuxI-E (nt0), and pDS133-ΔLu xI-E (nr) for PCR identification. Target bands with expected sizes of approximately 2006 bp, 1752 bp, and 1625 bp were observed, respectively ( Figure 4 ), and the final sequencing results were consistent with expectations.

[0081] Table 2 Plasmid pDS133-ΔLuxI-E sequence

[0082] Carrier volume (bp) 8819 R6K plasmid replication origin 1-392 RP4 plasmid transfer-related genes 418-2477 Chloramphenicol acetyltransferase 2489-3148 Levansucrase 3246-4667 LuxI gene upstream sequence 5140-6008 Ribosomal RNA operon T1T2 terminator 6017-6239 Lysis gene E 6246-6521 Arabinose promoter 6572-6599 Arabinose operon regulatory protein araC gene 6875-7753 T0 terminator of bacteriophage lambda 7760-7855 LuxI gene upstream sequence 7857-8750

[0083] 2. Comparison of lysis kinetics of recombinant E. coli

[0084] Escherichia coli SM10λpir containing plasmids pDS133-ΔLuxI, pDS133-ΔLuxI-E, pDS133-ΔLuxI-E(nt0), and pDS133-ΔLuxI-E(nr) prepared in Examples 1 and 2 were inoculated into 100 mL LB liquid culture medium containing 34 μg / mL chloramphenicol, and cultured at 37°C with shaking until the logarithmic growth phase (OD 600About 0.4), L-arabinose was added to a final concentration of 0.02 g / mL to induce E gene expression. After induction, samples were taken at regular intervals to measure the OD 600 At the same time, after the bacterial solution is appropriately diluted, the live bacteria on the plate are counted (to ensure that the number of colonies on the final plate is between 30-300), and the lysis efficiency mediated by the lysis gene E is calculated. The calculation formula is:

[0085] Lysis rate = (1-CFU after induction / CFU before induction) × 100%.

[0086] Experimental results: After induction with L-arabinose in the logarithmic growth phase, the OD of the recombinant bacteria containing plasmids pDS133-ΔLuxI-E, pDS133-ΔLuxI-E(nt0), and pDS133-ΔLuxI-E(nr) 600 The value began to decrease rapidly and reached the lowest value at 2 h. The OD value of pDS133-ΔLuxI-E / E.coli SM10λpir 600 The lowest value is only 0.198. 600 The value began to rise gradually again, but the rebound amplitude of pDS133-ΔLuxI-E / E.coli SM10λpir was always lower than that of pDS133-ΔLuxI-E(nt0) / E.coli SM10λpir and pDS133-ΔLuxI-E(nr) / E.coli SM10λpir. In contrast, the OD of E. coli SM10λpir (pDS133-ΔLuxI) used as the control was 0.1777 μg / mL in the whole experiment. 600 The value continued to increase until it stabilized around 4 hours ( Figure 5 ).

[0087] The live bacterial count results after induction were basically consistent with the trend of the lysis curve. The calculated lysis rates of the recombinant bacteria pDS133-ΔLuxI-E / E.coli SM10λpir, pDS133-ΔLuxI-E(nt0) / E.coli SM10λpir, and pDS133-ΔLuxI-E(nr) / E.coli SM10λpir were 94.417%, 91.478%, and 76.446%, respectively.

[0088] 3. Construction of mutant strain YCH-BG prepared from Edwardsiella ictaluri

[0089] The plasmid pDS133-ΔLuxI-E with the best lytic effect was selected for the construction of mutant strains. Escherichia coli SM10λpir and Edwardsiella ictaluri YCH containing the suicide plasmid pDS133-ΔLux-E were shaken and cultured in LB liquid medium until the logarithmic growth phase, centrifuged at 8000r / min for 2min, the supernatant was discarded, and the culture was washed twice with sterile PBS. The concentration of the bacterial solution of the two was adjusted to 1×10 8 CFU / mL, mix the two at a bacterial count ratio of 5:1, drop them on a 0.45μm sterile filter attached to an ordinary LB plate, place them in a biochemical incubator at 28℃ for more than 48h, remove the bacterial filter with sterile tweezers, put them in an LB test tube and vortex rinse, and after moderate concentration, take a certain amount of bacterial liquid and apply it on an LB plate containing 25μg / mL chloramphenicol and 10μg / mL polymyxin, and culture at 28℃. Pick out the grown single colonies and culture them in 12.5μg / mL LB medium containing polymyxin resistance, and perform PCR verification with primer pairs P14 / P15, P16 / P17 and P18 / P19 with target genes LuxI, Cat and SacB, and specific identification primers P20 / P21 for Edwardsiella ictaluri. After the PCR-verified and successfully integrated conjugated strains were streaked and purified, a single colony was picked and inoculated into LB medium without NaCl. After overnight culture, it was transferred to LB liquid medium without NaCl containing 10% sucrose for further culture. After appropriate concentration, it was spread on an LB plate containing 20% ​​sucrose. The grown colonies were screened and verified by PCR again with primers P14 / P15, and streaked on a chloramphenicol resistance plate for reverse identification. The grown mutant strain can amplify a long fragment of 2040bp, and it cannot grow on a chloramphenicol plate, indicating that the other homologous arm has also been exchanged, and the lytic gene E and its control unit have been successfully integrated into the luxI gene of Edwardsiella ictaluri. The mutant strain was named YCH-BG.

[0090] Experimental results: After the suicide plasmid pDS133-ΔLux-E and the YCH gene LuxI of E. ictaluri were exchanged, it was integrated into the genome of E. ictaluri. The primer pair P14 / P15 of the mutant strain targeting the LuxI gene could amplify two target fragments of 652 bp and 2040 bp respectively, while the wild strain YCH could only amplify a single target band of 652 bp ( Figure 6 ), while the primer pairs P16 / P17 and P18 / P17 with Cat and SacB as target genes can amplify the expected target fragments of approximately 635 bp and 679 bp, respectively ( Figure 7 ), the specific identification primers P20 / P21 of Edwardsiella ictaluri can amplify the expected target fragment of about 407 bp ( Figure 8 ).

[0091] Under selection pressure, the conjugate will undergo secondary homologous recombination, and the vector fragment will be cut out from the bacterial chromosome genome. When the deletion mutant strain (target mutant strain) integrated with the exogenous gene E and its control unit is screened and identified by PCR using primers P14 / P15, only the target fragment of about 2040 bp can be amplified ( Fig. 9 ). At the same time, the target mutant strain after the secondary mutation loses its resistance to chloramphenicol. The target mutant strain finally screened is Edwardsiella ictaluri YCH-BG.

[0092] Example 3

[0093] Application test of mutant strain YCH-BG of Edwardsiella ictaluri

[0094] 1. Morphological, physiological and biochemical characteristics and growth curve of Edwardsiella ictaluri mutant strain YCH-BG

[0095] The mutant strain YCH-BG and wild strain YCH prepared in Example 2 were streaked onto LB plates, cultured at 28°C for 2 days, and their growth and colony morphology were observed. Single colonies of appropriate size were selected and inoculated into various microbiochemical identification tubes for the determination of common physiological and biochemical indicators. At the same time, single colonies were selected and inoculated into 5 ml LB liquid culture medium, shaken and cultured overnight, and the OD values ​​of both were adjusted. 600 to the same value (about 0.5), and then inoculated into 100 ml of liquid LB, cultured at 28°C with shaking, and sampled every 2 hours to measure the OD 600 Draw a growth curve.

[0096] Test results: Under 28℃ culture conditions, the mutant strain YCH-BG and wild strain YCH of Edwardsiella ictaluri can grow normally on LB plates. The colony morphology is similar, with small, slightly raised, off-white or colorless colonies, round in shape, and neat edges ( Fig.10 The physiological and biochemical characteristics of the two strains were also the same, with positive reactions with reagents such as maltose, glucose and ornithine, and negative reactions with reagents such as arabinose, inositol, phenylalanine, citrate, esculin and salicin (Table 3). 600 Monitoring showed that the growth curves of the two strains overlapped in the first 4 hours, and then the mutant strain YCH-BG grew slightly slower than the wild-type strain YCH, but the difference between the two was not significant ( Fig.11 ).

[0097] Table 3 Physiological and biochemical characteristics of Edwardsiella ictaluri mutant strain YCH-BG

[0098]

[0099]

[0100] 2. Determination of the median lethal concentration (LD50) of Edwardsiella ictaluri mutant strain YCH-BG against yellow catfish

[0101] Healthy yellow catfish were purchased from a farm in Huzhou, Zhejiang Province, with an average body length of 10±2 cm. The yellow catfish were randomly divided into groups, with 20 in each group, and placed in aquariums of the same specifications for one week. Edwardsiella ictaluri YCH-BG and YCH were inoculated into LB liquid culture medium, respectively, and cultured overnight at 28°C and 150r / min. The next day, the bacterial precipitate was collected by centrifugation, washed three times with sterile phosphate buffer (PBS), and the bacterial solution concentration was adjusted to about 1×10 9 CFU / mL, and then diluted 10-fold gradient into 5 different concentrations of bacterial suspension, and plate counting was performed at the same time to obtain a more accurate bacterial concentration.

[0102] Before injection, the yellow catfish that had been temporarily raised were anesthetized with MS-222 at a concentration of 100 mg / L. 100 μL of different concentrations of gradient bacterial solution were injected into the abdominal cavity of each fish according to the group, and the control group was injected with an equal volume of PBS. After the injection, the fish bodies were briefly immersed in potassium permanganate solution for disinfection. During the experiment, the artificially infected yellow catfish were managed normally, and the incidence and mortality were recorded. The infected fish were isolated from bacteria using the Edwardsiella ictaluri selective culture medium EIM, and PCR identification was performed using specific primers. The observation was continued for 7 days, and finally the median lethal concentration (LD50) of the mutant strain and the wild strain to yellow catfish was calculated according to the Reed-Muench formula. 50 ).

[0103] Test results: According to the plate count results, the highest attack concentrations of Edwardsiella ictaluri YCH-BG and YCH were 5×10 9 CFU / mL and 4×10 9 CFU / mL, and the concentrations of subsequent groups decreased by 10 times. After artificial infection of healthy yellow catfish, deaths began to occur in the highest concentration group 1 day after injection, and the mortality rate of YCH-BG in the low concentration group was significantly lower than that of the wild strain YCH. During the one-week trial, the mortality rates of YCH-BG in the infection concentration groups from high to low were 90%, 55%, 10%, 5% and 0%, and those of YCH were 90%, 95%, 60%, 35% and 0%, and no deaths occurred in the control group. Bacteria can be isolated again from the diseased fish, and their morphological characteristics and physical and chemical properties are completely consistent with the infected strains. The LD of Edwardsiella ictaluri YCH-BG and YCH to yellow catfish was calculated according to Reed-Muench. 50 5×10 6.9 (3.7×10 7 )CFU / mL and 4×10 5.6 (1.6×10 6)CFU / mL, indicating that the virulence of Edwardsiella ictaluri YCH-BG was significantly reduced.

[0104] 3. Lytic Kinetics of Edwardsiella ictaluri YCH-BG

[0105] Edwardsiella ictaluri YCH-BG was inoculated into LB liquid medium and cultured overnight at 28°C with shaking. The next day, 1 mL was first drawn from the preheated 100 ml sterile LB liquid medium under aseptic operation as a subsequent OD 600 The blank background of the assay was measured, and 1 mL of bacterial solution was inoculated into the conical flask containing the remaining 99 mL of LB liquid medium, and cultured at 150 r / min until the mid-logarithmic growth period (OD 600 About 0.5), L-arabinose was added to a final concentration of 0.02 g / mL to induce the expression of the lytic gene E. During the induction process, samples were taken at regular intervals to measure the OD 600 The samples were taken every half an hour for the first 4 hours, and then every 1 hour. 600 After the value tends to be stable, the sample is diluted in multiple proportions and coated on LB plates for calculation of lysis rate in the same way as before.

[0106] Test results: After adding arabinose to induce the logarithmic growth phase of Edwardsiella ictaluri YCH-BG, its OD 600 The value experienced a brief rise in the first 0.5 h, then began to decline rapidly and stabilized 4 h after induction. The lysis rate was calculated by plate live bacteria count to be 99.995%. 600 The value continued to increase during the entire experiment and entered a stable period around 10 h ( Fig.12 ).

[0107] 4. Electron microscopy observation

[0108] The exuviae samples (E. ictaluri YCH-BG) were collected by centrifugation, washed 3 times with PBS, resuspended in 2.5% glutaraldehyde fixative for electron microscopy, and left overnight at 4°C. The next day, the fixed samples were washed 3 more times and fixed with 30%, 50%, 70%, 80%, 95%, 100% and 100% (with anhydrous Na 2 SO 4 ) ethanol for step-by-step dehydration, 15 min per step. After dehydration, the sample was replaced with isoamyl acetate, first immersed in a 1:1 isoamyl acetate / ethanol mixture for 30 min, and then moved into pure isoamyl acetate for 30 min. Finally, the sample was moved to the sample stage and CO 2 After critical point drying, bonding and gold spraying, the samples were observed under a scanning electron microscope.

[0109] The bacterial exuviae after the above-mentioned ethanol dehydration were transferred into 100% acetone twice, each time for 15 minutes, and then soaked in 1:1 to 1:2 acetone / resin at 37°C for 2-4 hours and permeated overnight, then embedded in pure resin, polymerized at 60°C for 48 hours, made into ultrathin sections, stained with uranyl acetate and lead citrate, and observed under a transmission electron microscope.

[0110] Test results: Scanning electron microscopy results showed that under the same culture and measurement conditions, the overall outline of the mutant bacterial cells was similar to that of the wild-type bacteria that had not been lysed, but the surface showed obvious wrinkles. Transmembrane lysis channels ( Fig.13 A. Fig.13 B). When using transmission electron microscopy for a closer look, it was found that the cytoplasmic contents of the bacterial exuviae were fully released, leaving only an empty bacterial shell. In contrast, the cells that did not undergo lysis were full and full, with obvious cytoplasmic contents ( Fig.13 C. Fig.13 D).

[0111] The present invention has proved for the first time that the arabinose-induced lysis system can be integrated into the genome of Edwardsiella ictaluri, and the preparation of bacterial exuviae can be achieved by induction. The bacterial exuviae usually have excellent immunogenicity, and at the same time have adjuvant properties, which can induce the body to produce strong humoral immunity and cellular immunity, and have better immune effects than conventional vaccines. In addition, bacterial exuviae can be mass-produced by fermentation, and freeze-dried bacterial exuviae can be stored for a long time at room temperature without reducing its immune efficacy. The mutant strain for preparing Edwardsiella ictaluri exuviae constructed by the present invention overcomes the technical obstacle that the temperature-controlled lysis system is not suitable for the preparation of Edwardsiella ictaluri exuviae. At the same time, because the lysis system is integrated into the genome, the risk of resistance gene diffusion that may be caused by the conventional use of lysis plasmids for exuviae preparation is avoided, and the exuviae preparation is also more stable and has a higher lysis rate. Finally, the growth rate of the mutant strain is not significantly different from that of the wild strain, and it has both attenuated characteristics, and the virulence is significantly reduced compared with the wild strain, eliminating the potential pathogenic risk of residual surviving bacteria in the traditional exuviae preparation, so that the exuviae have the realistic possibility of moving from indoor experiments to practical applications.

Claims

1. A recombinant plasmid pDS133-ΔLuxI-E for preparing mutant strains from Edwardsiella ictaluri, characterized in that: The nucleotide sequence of the plasmid pDS133-ΔLuxI-E is shown in SEQ ID NO.

1.

2. A method for constructing a recombinant plasmid pDS133-ΔLuxI-E for preparing mutant strains from Edwardsiella ictaluri according to claim 1, characterized in that: The steps include: (1) Construction of suicide recombinant plasmid pDS133-ΔLuxI; (2) Using plasmid pFGH106-BAD-E as a template, primers were designed to amplify the cleavage E and its arabinose-inducible control unit, and then cloned into the Spe I and Xho I restriction sites of plasmid pDS133-ΔluxI to construct the recombinant plasmid pDS133-ΔluxI-E.

3. The construction method according to claim 2, characterized in that: The method for constructing the suicide recombinant plasmid pDS133-ΔLuxI in step (1) is as follows: primers are designed according to the LuxI gene and its upstream and downstream sequences in the genome information of Edwardsiella ictaluri, and the sequence deletion in the interval of 106-565bp in the LuxI gene sequence is deleted by overlapping PCR, while retaining the sequences of 764bp and 793bp in the upstream and downstream regions respectively for subsequent homologous recombination, and then cloned between the Xba I and Sac I restriction sites of the plasmid pDS133 to construct the recombinant plasmid pDS133-ΔLuxI.

4. The construction method according to claim 3, characterized in that: The primers in step (1) include P1, P2, P3, and P4, and their sequences are: P1:CGCTCTAGAAAAGGTGCTAACACATCA P2: TAGCGTGCACTAGTTACGCCCAGTTAAGCCGATCCT P3: TAGTGCACGCTAGCATTCTCGAGCGGATTAATCAGGA P4:AAGGAGCTCCCGTTGACACGTAAGAT.

5. The construction method according to claim 2, characterized in that: The method for constructing the recombinant plasmid pDS133-ΔluxI-E in step (2) is as follows: using the plasmid pFGH106-BAD-E as a template, designing different primers to amplify the cleavage E and its arabinose-induced control unit with different terminators, and then cloning them between the Spe I and Xho I restriction sites of the plasmid pDS133-ΔluxI, respectively, to construct the recombinant plasmid pDS133-ΔluxI-E containing terminators at both ends.

6. The construction method according to claim 2, characterized in that: The primers in step (2) include: P7 / P8, P7 / P9, P10 / P11, and their sequences are: P7:CGCACTAGTGAGTTTGTAGAAACGCAAAA P8:CCTCTCGAGGATTCTCACCAATAAAAAAAC P9:CTTCTCGAGTCATTATGACAACTTGACGCTA P10:CGCACTAGTGATTCTCACCAATAAAAAACGCC P11:CCTCTCGAGTCACTCCTTCCGCACGTAA.

7. A mutant strain for preparing Edwardsiella ictaluri exuviae, characterized in that: The mutant strain is formed by combining Edwardsiella ictaluri as a starting strain with Escherichia coli SM10λpir containing the plasmid pDS133-ΔLux-E of claim 1 through transduction and gene recombination.

8. A method for constructing a mutant strain for preparing Edwardsiella ictaluri exuviae according to claim 7, characterized in that: The method comprises the following steps: transforming the plasmid pDS133-ΔLuxI-E into Escherichia coli SM10λpir, combining and transducing with Edwardsiella ictaluri YCH, verifying the successfully integrated conjugate by resistance plate and PCR, continuously culturing the conjugate to promote secondary recombination, and then performing screening and verification, and finally obtaining the Edwardsiella ictaluri mutant strain YCH-BG.

9. Use of the mutant strain for preparing Edwardsiella ictaluri exuviae according to claim 7 in preparing Edwardsiella ictaluri exuviae.

10. Use of the mutant strain for preparing Edwardsiella ictaluri exuviae according to claim 7 in preparing an exuviae vaccine for preventing and controlling Edwardsiella ictaluri.

Images