Separation method for mixing different oligonucleotide sequences

Abstract

The invention relates to the field of analysis, in particular to a separation method for mixing different oligonucleotide sequences. The method for separating oligonucleotides mixed with different sequences comprises the step of separating and detecting samples mixed with different oligonucleotides by adopting a high performance liquid chromatography, and the chromatographic conditions are as follows: octadecylsilane chemically bonded silica is used as a filler, and an HPLC A liquid is used as a mobile phase A; a mixed solution of an HPLC (High Performance Liquid Chromatography) A solution and acetonitrile is used as a mobile phase B, and the volume ratio of the HPLC A solution to the acetonitrile is (60-80): (20-40); the HPLC A liquid is 0.1 M TEAA (Tetraethyl Acrylic Acid) Performing gradient elution; according to the method, oligonucleotides with different sequences are separated and mixed through the selected chromatographic conditions, N-X impurities and N + X impurities can be effectively removed, especially N-X impurities and N + X impurities with X smaller than or equal to 2, the finally obtained oligonucleotide medicine is high in purity, and meanwhile the high yield is kept.

Description

Technical Field

[0001] The invention relates to the field of analysis, and in particular to a method for separating mixed different oligonucleotide sequences. Background Art

[0002] Oligonucleotide drugs refer to RNA or DNA molecules and their analogs containing 10 to 30 bases. Oligonucleotide drugs include antisense oligonucleotides, small interfering RNA (siRNA) and aptamers. Oligonucleotide drugs have a large molecular weight, usually 6000 to 8000, and exist almost in the form of anions in water, forming a negatively charged molecular body.

[0003] In the process of synthesizing oligonucleotide drugs, for example, chemical synthesis of deoxyribonucleotides refers to the formation of 5'-3' phosphodiester bonds between nucleotide monomers, thereby connecting multiple nucleotide units into deoxyribonucleotide chains, which are usually accompanied by side reactions, resulting in the production of non-target deoxyribonucleotide chains, which have increased or decreased at least one nucleotide relative to the target deoxyribonucleotide chain, producing impurities of NX (N is the target base sequence length, X≥1 integer) base sequence and N+X (N is the target sequence length, X≥1 integer) base sequence, resulting in impurities in the final oligonucleotide drugs. Therefore, it is necessary to effectively separate the mixed oligonucleotides of different sequences to remove the impurities caused by side reactions. The commonly used analytical methods for the separation and detection of mixed oligonucleotides of different sequences include reversed-phase ion pair chromatography, hydrophilic chromatography, anion exchange chromatography, and capillary electrophoresis. Therefore, at present, C18 and specific eluents (TEAA solution and TEAA+acetonitrile mixed solution system) are often used to remove impurities by adjusting the acetonitrile concentration gradient method. However, the above method still cannot meet the requirements. For NX impurities with X≤2 and N+X impurities, since they are very close to the target sequence, they are very difficult to effectively remove during separation, and their content in the final oligonucleotide drug is still high. Summary of the invention

[0004] Therefore, the technical problem to be solved by the present invention is to provide a method for separating mixed different oligonucleotide sequences.

[0005] To this end, the present invention provides the following technical solutions:

[0006] The embodiments disclosed in the present invention relate to a method for separating mixed oligonucleotide sequences, comprising separating and detecting mixed oligonucleotide samples by high performance liquid chromatography, wherein the chromatographic conditions are:

[0007] Octadecylsilane bonded silica gel is used as filler, HPLC A liquid is used as mobile phase A; a mixture of HPLC A liquid and acetonitrile is used as mobile phase B, and the volume ratio of HPLC A liquid to acetonitrile is (60-80): (40-20); HPLC A liquid is 0.1 MTEAA; the gradient elution program includes:

[0008] 0-30min, the volume ratio of mobile phase A and mobile phase B is 90%-98%:10%-2%→76%-50%:24%-50%;

[0009] 30-30.1min, the volume ratio of mobile phase A to mobile phase B is 76%~50%:24%~50%→10%:90%;

[0010] 30.1-35min, the volume ratio of mobile phase A to mobile phase B is 10%:90%→10%:90%;

[0011] 35min~35.1min, the volume ratio of mobile phase A and mobile phase B is 10%:90%→92%~98%:8%~2%;

[0012] 35.1min~40min, the volume ratio of mobile phase A and mobile phase B is 92%~98%:8%~2%→92%~98%:8%~2%.

[0013] In some embodiments, the chromatographic conditions include at least one of the following conditions:

[0014] 1) The detection wavelength is 240-270 nm, preferably 260 nm;

[0015] 2) The flow rate is 0.4-1.5 ml / min, preferably 1 ml / min;

[0016] 3) The column temperature is 55-65°C, preferably 60°C;

[0017] 4) The specification of the chromatographic column is 4.6 mm × 250 mm, and the particle size is 3.5-5 um; preferably, the particle size is 3.5 um, and the chromatographic column is selected from Waters;

[0018] 5) The injection volume is 10-30ul, preferably 20μL;

[0019] 6) The volume ratio of HPLC A solution and acetonitrile is 70:30.

[0020] In some embodiments, the mixed different oligonucleotide samples are any of the following:

[0021] a), aminolysis solution containing mixed oligonucleotides of different sequences;

[0022] b) The ammonolysis solution in a) is concentrated under reduced pressure to remove ammonia, and then diluted with purified water to 8 to 12 times the volume after concentration, preferably 10 times;

[0023] c) The ammonolysis solution in a) is concentrated under reduced pressure to remove aqueous ammonia, and then diluted with a buffer solution to 8 to 12 times, preferably 10 times, the volume after concentration.

[0024] In some embodiments, the pH value of the mixed different oligonucleotide samples is 8.5±0.5, preferably the pH value is 8.2-8.6.

[0025] In some embodiments, the base for adjusting the pH is an organic base or an inorganic base.

[0026] In some embodiments, the pH is adjusted with triethylamine, aqueous ammonia, sodium bicarbonate, sodium hydroxide or ammonium bicarbonate.

[0027] In some embodiments, the mixing of different oligonucleotide samples further comprises a pretreatment step: taking the mixed different oligonucleotide samples, centrifuging, and retaining the supernatant.

[0028] In some embodiments, the concentration of the mixed different oligonucleotide samples is 99-231 μg / ml, preferably 165 μg / ml.

[0029] And / or, the centrifugation conditions are a centrifugal speed of 4000 rpm to 6000 rpm, a temperature of 10°C to 20°C, and a centrifugation time of 3 minutes to 8 minutes; preferably, the centrifugal conditions are a centrifugal speed of 5500 rpm, a temperature of 15°C, and a centrifugation time of 5 minutes.

[0030] In some embodiments, the method further comprises centrifuging the collected eluate, retaining the supernatant, and then concentrating the supernatant.

[0031] In some embodiments, the centrifugation conditions are a centrifugal speed of 4000 rpm-6000 rpm, a temperature of 10°C-20°C, and a centrifugation time of 3 minutes-8 minutes; preferably, the centrifugal conditions are a centrifugal speed of 5500 rpm, a temperature of 15°C, and a centrifugation time of 5 minutes;

[0032] And / or, the concentration step is to concentrate to dry powder under reduced pressure at a temperature of 45°C to 60°C and -0.1Mpa to 0.1Mpa; preferably, the temperature is 50°C and -0.07Mpa to concentrate to dry powder under reduced pressure.

[0033] The technical solution of the present invention has the following advantages:

[0034] 1. The present invention provides a method for separating mixed oligonucleotide sequences, characterized in that it comprises separating and detecting mixed oligonucleotide samples by high performance liquid chromatography, wherein the chromatographic conditions are as follows: octadecylsilane bonded silica gel is used as a filler, HPLC A liquid is used as a mobile phase A; a mixed liquid of HPLC A liquid and acetonitrile is used as a mobile phase B, and the volume ratio of HPLC A liquid to acetonitrile is (60-80): (40-20); HPLC A liquid is 0.1M TEAA; Gradient elution program includes: 0-30min, the volume ratio of mobile phase A and mobile phase B is 90%-98%: 10%-2% → 76%-50%: 24%-50%; 30-30.1min, the volume ratio of mobile phase A and mobile phase B is 76%-50%: 24%-50% → 10%: 90%; 30.1-35min, the volume ratio of mobile phase A and mobile phase B is 10%: 90% → 10%: 90%; 35min-35.1min, the volume ratio of mobile phase A and mobile phase B is 10%: 90% → 10%: 90% The volume ratio of mobile phase B is 10%:90%→92%-98%:8%-2%; 35.1min-40min, the volume ratio of mobile phase A and mobile phase B is 92%-98%:8%-2%→92%-98%:8%-2%; In the above method, oligonucleotides of different sequences are separated and mixed by selected chromatographic conditions, which can effectively remove NX impurities and N+X impurities, especially NX impurities and N+X impurities with X≤2, so that the final oligonucleotide drug has high purity and maintains a high yield at the same time. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0036] Figure 1 is the chromatogram in step (2) of Example 1 of the present invention;

[0037] Figure 2 is the chromatogram in step (4) of Example 1 of the present invention;

[0038] Figure 3 is the chromatogram in step (2) of Example 2 of the present invention;

[0039] Figure 4 is the chromatogram in step (4) of Example 2 of the present invention;

[0040] Figure 5 is the chromatogram in step (2) of Example 3 of the present invention;

[0041] Figure 6 is the chromatogram in step (4) of Example 3 of the present invention;

[0042] Figure 7 is the chromatogram in step (2) of Example 4 of the present invention;

[0043] Figure 8 It is the chromatogram in step (4) of Example 4 of the present invention. DETAILED DESCRIPTION

[0044] The following examples are provided for a better understanding of the present invention, but are not intended to limit the best mode of implementation, nor to limit the content and protection scope of the present invention. Any product identical or similar to the present invention obtained by anyone under the inspiration of the present invention or by combining the features of the present invention with other prior arts shall fall within the protection scope of the present invention.

[0045] If no specific experimental steps or conditions are specified in the examples, the conventional experimental steps or conditions described in the literature in the field can be used. If no manufacturer is specified for the reagents or instruments used, they are all conventional reagent products that can be obtained commercially.

[0046] The Chinese name of TEAA is triethylammonium acetate buffer.

[0047] The manufacturer of the chromatograph involved in the following embodiments is waters; model C18, 3.5um, 4.6mm×150mmColumn.

[0048] The sample containing mixed different oligonucleotide sequences in the following example contains 4 sequences as shown in the following table:

[0049] Table 1

[0050] Sequence number 5’-3’ Sequence Listing 1 CGACACTCTAAGTCGACACT SEQ ID NO.1 2 CGAACACGACTGTCGAACAC SEQ ID NO.2 3 CACGGATGACTGTTTCCGAG SEQ ID NO.3 4 GCATAGCGTAAGTGCATAGC SEQ ID NO.4

[0051] Example 1

[0052] This embodiment provides a method for separating mixed oligonucleotides with different sequences, comprising the following steps:

[0053] (1) Pretreatment by mixing different oligonucleotide sample solutions:

[0054] The ammonolysis solution containing mixed oligonucleotide sequences (the target sequence is a mixture of DNA oligonucleotide sequences SEQ ID NO.1-4 with a length of 20 nt, which contains sequence impurities with a sequence length of NX and sequence impurities with a sequence length of N+X, N=20, and X is an integer ≥1) is concentrated under reduced pressure to remove ammonia water, and then diluted with purified water to 10 times the volume after concentration, and then adjusted to pH 8.2-8.6 with alkali (ammonia water). The obtained mixed oligonucleotide solution (mixed oligonucleotide concentration of 165 μg / ml, or OD 260nm =5) 2 ml, centrifuge in a high-speed low-temperature centrifuge (the centrifugal speed and temperature are 5500 rpm and 15°C respectively) for 5 minutes to obtain the supernatant.

[0055] (2) Mixed oligonucleotide sequence separation

[0056] Reverse phase high performance liquid chromatography (HPLC) was used to separate the mixed oligonucleotide sequences. The chromatographic conditions were as follows: chromatographic column: C18 4.6 mm × 250 mm, particle size 3.5 μm, chromatographic column selected from Waters chromatographic column; detector: UV detection wavelength 260 nm; mobile phase A: HPLC A liquid; mobile phase B: a mixture of HPLC A liquid and acetonitrile with a volume ratio of 70:30; HPLC A liquid was 0.1 MTEAA; flow rate: 1 ml / min; column temperature: 60 °C; injection volume: 20 μL. The gradient program is as shown in the following table.

[0057] Table 2. Gradient program

[0058] time Flow rate ml / min Mobile phase A (% v / v) Mobile phase B (% v / v) 0.01 1.00 90.0 10.0 30.00 1.00 76.0 24.0 30.10 1.00 10.0 90.0 35.00 1.00 10.0 90.0 35.10 1.00 92.0 8.0 40.00 1.00 92.0 8.0

[0059] Before the retention time of each target sequence, the desorbate containing a single target sequence was collected from the C18 column. The results are as follows: Figure 1 As shown, the peak corresponding to the retention time 17.565 min corresponds to the desorption liquid containing the single target sequence of SEQ ID NO.4, the peak corresponding to the retention time 18.465 min corresponds to the desorption liquid containing the single target sequence of SEQ ID NO.2, the peak corresponding to the retention time 19.002 min corresponds to the desorption liquid containing the single target sequence of SEQ ID NO.3, and the peak corresponding to the retention time 20.175 min corresponds to the desorption liquid containing the single target sequence of SEQ ID NO.1.

[0060] (3) Purity test of desorption liquid

[0061] The 4 desorbed solutions obtained in step (2) were tested by HPLC. The purity of the single target sequence in each of the collected desorbed solutions was above 80.5%, and the recovery rate of the single target sequence was above 23%. The chromatographic conditions of the HPLC detection method differ from those in step (2) only in the gradient program. The gradient elution program is as follows:

[0062] Table 3. Gradient program

[0063]

[0064] (4) Purify to obtain a single target sequence

[0065] The four desorption solutions containing a single target sequence obtained in step (2) were centrifuged in a low-temperature high-speed centrifuge at a speed of 5500 rpm and a temperature of 15°C to obtain a clear sample aqueous solution, which was centrifuged and filtered to obtain a sample containing about 66 μg / ml (OD at 260 nm). 260nm =2) oligonucleotide sequence solution, respectively, at about 50°C, under reduced pressure (-0.07MPa) to concentrate to dry powder. The dry powder was placed in a refrigerator at 4°C. HPLC detection (the method is the same as step (3) of this embodiment, the difference is that the test solution is the dry powder obtained by diluting it with purified water to a concentration of OD at 260nm 260nm =0.05~0.1), the purity of the single target sequence was more than 70.5%, the percentage of single impurity content of sequence length N+X (N=20, X=1 or 2) and NX (N=20, X=1 or 2) was less than 8%, and the recovery rate of the single target sequence was more than 20%. The exemplary results are shown in Figure 2 As shown, Figure 2 The purity test result of the target sequence SEQ ID NO.1 is shown in the figure. Recovery rate = OD of the target in the purified collected sample 260 ÷ Total OD 260 ×100%.

[0066] Example 2

[0067] This embodiment provides a method for separating mixed oligonucleotides with different sequences, comprising the following steps:

[0068] (1) Pretreatment by mixing different oligonucleotide sample solutions:

[0069] The ammonolysis solution containing mixed oligonucleotides of different sequences (the target sequence is a mixture of DNA oligonucleotide sequences SEQ ID NO.1-4 with a length of 20 nt, which contains NX impurities and N+X impurities, N=20, X≥1 integer) is concentrated under reduced pressure to remove ammonia water, and then diluted with purified water to 10 times the volume after concentration, and then adjusted to pH 8.2-8.6 with alkali (ammonia water). 2 ml of the obtained mixed oligonucleotide solution (mixed oligonucleotide concentration is 165 μg / ml) is centrifuged in a high-speed low-temperature centrifuge (the centrifugal speed and temperature are 5500 rpm and 15°C respectively) for 5 minutes to obtain a supernatant.

[0070] (2) Chromatographic conditions

[0071] Reverse phase high performance liquid chromatography (HPLC) was used to separate and detect the mixed oligonucleotides. The HPLC detection conditions mentioned are: chromatographic column: C18 4.6×250mm, particle size 3.5μm, chromatographic column specifically waters; detector: UV detection wavelength 260nm; mobile phase A: HPLC A liquid; mobile phase B: HPLC A liquid / acetonitrile volume ratio 70:30; flow rate: 1.0ml / min; column temperature: 65℃; injection volume: 20μL. The gradient program is as shown in the following table.

[0072] Table 4. Gradient program

[0073]

[0074] The desorption solution containing the single oligonucleotide was desorbed from the C18 column before the retention time of each target sequence. Figure 3 As shown, the peak corresponding to the retention time 13.844 min corresponds to the desorption liquid containing the single target sequence of SEQ ID NO.4, the peak corresponding to the retention time 14.189 min corresponds to the desorption liquid containing the single target sequence of SEQ ID NO.2, the peak corresponding to the retention time 14.398 min corresponds to the desorption liquid containing the single target sequence of SEQ ID NO.3, and the peak corresponding to the retention time 14.862 min corresponds to the desorption liquid containing the single target sequence of SEQ ID NO.1.

[0075] (3) Purity test of desorption liquid

[0076] According to HPLC detection (operated according to step (3) in Example 1), the purity of the single target sequence in each desorption liquid collected was above 80%, and the recovery rate of the single target sequence was above 10%.

[0077] (4) Purify to obtain a single target sequence

[0078] The four desorption solutions containing a single target sequence obtained in step (2) were centrifuged in a low-temperature high-speed centrifuge at a speed of 5500 rpm and a temperature of 15°C to obtain a clear sample aqueous solution containing about 66 μg / ml (OD at 260 nm). 260 =2) oligonucleotide sequence solution, at about 50°C, under reduced pressure (-0.07MPa) to concentrate to dry powder. The dry powder is placed in a refrigerator at 4°C. HPLC detection (the method is the same as step (3) of this embodiment, the difference is that the test solution is the dry powder obtained by diluting it with purified water to a concentration of OD at 260nm 260nm=0.05-0.1), the recovery rate of a single target sequence is more than 25%, the purity of a single target sequence is more than 82.0%, and the percentage of a single impurity content of sequence lengths N+X (N=20, X=1 or 2) and NX (N=20, X=1 or 2) is less than 9%. The exemplary results are shown in Figure 4 As shown, Figure 4 The purity test result of the target sequence SEQ ID NO.2 is shown in FIG.

[0079] Example 3

[0080] This embodiment provides a method for separating mixed oligonucleotides with different sequences, comprising the following steps:

[0081] (1) Pretreatment by mixing different oligonucleotide sample solutions:

[0082] The ammonolysis solution containing mixed oligonucleotides of different sequences (the target sequence is a mixture of DNA oligonucleotide sequences SEQ ID NO.1-4 with a length of 20 nt, which contains sequence impurities of sequence length NX and sequence impurities of N+X, N=20, X is an integer ≥1) is concentrated under reduced pressure to remove ammonia water, and then diluted with purified water to 10 times the volume after concentration, and then adjusted to pH 8.5±0.5 with alkali (ammonia water). 2 ml of the obtained mixed oligonucleotide solution (mixed oligonucleotide concentration is 165 μg / ml) is centrifuged in a high-speed low-temperature centrifuge (the centrifugal speed and temperature are 5500 rpm and 15°C, respectively) for 5 minutes to obtain a supernatant.

[0083] (2) Chromatographic conditions

[0084] Reverse phase high performance liquid chromatography (HPLC) was used to separate and detect the mixed oligonucleotides. The HPLC detection conditions mentioned are: chromatographic column: C18 4.6*250mm, particle size 3.5um, chromatographic column is specifically Waters; detector: UV detection wavelength 260nm; mobile phase A: HPLC A liquid; mobile phase B: HPLC A liquid / acetonitrile (70:30); flow rate: 1ml / min; column temperature: 60℃; injection volume: 20μL. The gradient program is as shown in the following table.

[0085] Table 5. Gradient program

[0086]

[0087] Before the retention time of each target sequence, the desorbate containing a single target sequence was collected from the C18 column. The results are as follows: Figure 5As shown, the peak corresponding to the retention time 11.530 min corresponds to the desorption liquid containing the single target sequence of SEQ ID NO.4, the peak corresponding to the retention time 11.794 min corresponds to the desorption liquid containing the single target sequence of SEQ ID NO.2, the peak corresponding to the retention time 11.949 min corresponds to the desorption liquid containing the single target sequence of SEQ ID NO.3, and the peak corresponding to the retention time 12.313 min corresponds to the desorption liquid containing the single target sequence of SEQ ID NO.1.

[0088] (3) Purity test of desorption liquid

[0089] According to HPLC detection (operated according to step (3) in Example 1), the purity of the single target sequence in each desorption liquid collected was above 80%, and the recovery rate of the single target sequence was above 16%.

[0090] (4) Purify to obtain a single target sequence

[0091] The 4 portions of desorption liquid containing a single target sequence obtained in step (2) were centrifuged in a low-temperature high-speed centrifuge at a speed of 5500 rpm and a temperature of 15°C to obtain a clarified sample aqueous solution, which was then centrifuged and filtered to obtain a solution containing about 2 OD of oligonucleotide, which was then concentrated to a dry powder under reduced pressure (-0.07 MPa) at about 50°C. The dry powder was refrigerated at 4°C. The test was performed by HPLC (the method is the same as step (3) of this embodiment, except that the test solution is the dry powder obtained by diluting it with purified water to a concentration of OD at 260 nm). 260nm =0.05-0.1), the recovery rate of a single target sequence is more than 16%, the percentage of individual impurities of sequence lengths N+X (N=20, X=1 or 2) and NX (N=20, X=1 or 2) are both less than 9.5%, and the purity of a single target sequence is more than 70%. The exemplary results are shown in Figure 6 As shown, Figure 6 The purity test result of the target sequence SEQ ID NO.3 is shown in FIG.

[0092] Example 4

[0093] This embodiment provides a method for separating mixed oligonucleotides with different sequences, comprising the following steps:

[0094] (1) Pretreatment by mixing different oligonucleotide sample solutions:

[0095] The ammonolysis solution containing mixed oligonucleotides of different sequences (the target sequence is a mixture of DNA oligonucleotide sequences SEQ ID NO.1-4 with a length of 20 nt, which contains sequence impurities of sequence length NX and sequence impurities of N+X, N=20, X is an integer ≥1) is concentrated under reduced pressure to remove ammonia water, and then diluted with purified water to 9 times the volume after concentration, and then adjusted to pH 8.2-8.6 with alkali (ammonia water). 2 ml of the obtained mixed oligonucleotide solution (mixed oligonucleotide concentration is 165 μg / ml) is centrifuged in a high-speed low-temperature centrifuge (the centrifugal speed and temperature are 5500 rpm and 15°C respectively) for 5 minutes to obtain a supernatant.

[0096] (2) Chromatographic conditions

[0097] Reverse phase high performance liquid chromatography (HPLC) was used to separate and detect the mixed oligonucleotides. The HPLC detection conditions mentioned are: chromatographic column: C18 4.6*250mm, particle size 3.5μm, chromatographic column is specifically Waters; detector: UV 260nm; mobile phase A: HPLC A liquid; mobile phase B: HPLC A liquid / acetonitrile (70:30); flow rate: 0.5ml / min; column temperature: 65℃; injection volume: 20μL. The gradient program is as shown in the following table.

[0098] Table 6. Gradient program

[0099]

[0100] Before the retention time of each target sequence, the desorbate containing a single target sequence was collected from the C18 column. The results are as follows: Figure 7 As shown, the peak corresponding to the retention time 13.303 min corresponds to the desorption liquid containing the single target sequence of SEQ ID NO.4, the peak corresponding to the retention time 13.546 min corresponds to the desorption liquid containing the single target sequence of SEQ ID NO.2, the peak corresponding to the retention time 13.682 min corresponds to the desorption liquid containing the single target sequence of SEQ ID NO.3, and the peak corresponding to the retention time 14.019 min corresponds to the desorption liquid containing the single target sequence of SEQ ID NO.1.

[0101] (3) Purity test of desorption liquid

[0102] According to HPLC detection (implemented according to step (3) in Example 1), the purity of the single target sequence in each desorption liquid collected was above 80%, and the recovery rate of the single target sequence was above 11%.

[0103] (4) Purify to obtain a single target sequence

[0104] The 4 portions of desorption solution containing a single target sequence obtained in step (2) were centrifuged in a low-temperature high-speed centrifuge at a speed of 5500 rpm and a temperature of 15°C to obtain a clear sample aqueous solution, and the oligonucleotide solution containing about 66 μg / ml (OD260=2 at 260 nm) was centrifugally filtered and concentrated to a dry powder under reduced pressure (-0.07 MPa) at about 50°C. The dry powder was refrigerated in a refrigerator at 4°C. The test was performed by HPLC (the method is the same as step (3) of this embodiment, except that the test solution is the dry powder obtained by diluting it with purified water to a concentration of OD260 at 260 nm). 260nm =0.05~0.1), the recovery rate of single target sequence is more than 12.2%, the percentage of single impurity content of sequence length N+X (N=20, X=1 or 2) and NX (N=20, X=1 or 2) is less than 8.1%, and the purity of single target sequence is more than 80%. The exemplary results are shown in Figure 8 As shown, Figure 8 The purity test result of the target sequence SEQ ID NO.4 is shown in FIG.

[0105] Example 5

[0106] This embodiment provides a method for separating mixed oligonucleotides with different sequences, comprising the following steps:

[0107] (1) Pretreatment by mixing different oligonucleotide sample solutions:

[0108] The ammonolysis solution containing mixed oligonucleotides of different sequences (the target sequence is a mixture of DNA oligonucleotide sequences SEQ ID NO.1-4 with a length of 20 nt, which contains sequence impurities of sequence length NX and sequence impurities of N+X, N=20, X is an integer ≥1) is concentrated under reduced pressure to remove ammonia water, and then diluted with purified water to 8 times the volume after concentration, and then adjusted to pH 8.5±0.5 with alkali (sodium hydroxide). 2 ml of the obtained mixed oligonucleotide solution (mixed oligonucleotide concentration is 99 μg / ml) is centrifuged in a high-speed low-temperature centrifuge (the centrifugal speed and temperature are 4000 rpm and 10°C, respectively) for 8 minutes to obtain a supernatant.

[0109] (2) Chromatographic conditions

[0110] Reverse phase high performance liquid chromatography (HPLC) was used to separate and detect the mixed oligonucleotides. The HPLC detection conditions mentioned are: chromatographic column: C18 4.6*250mm, particle size 3.5μm, chromatographic column specifically waters; detector: UV detection wavelength 270nm; mobile phase A: HPLC A liquid; mobile phase B: HPLC A liquid / acetonitrile volume ratio 60:40; flow rate: 1.0ml / min; column temperature: 65℃; injection volume: 10μL. The gradient program is as shown in the following table.

[0111] Table 7. Gradient program

[0112]

[0113] Before the retention time of each target sequence, the desorbate containing a single target sequence was collected from the C18 column.

[0114] (3) Purity test of desorption liquid

[0115] According to HPLC detection (operated according to step (3) of the embodiment), the purity of the single target sequence in each desorption liquid collected was above 71%, and the recovery rate of the single target sequence was above 13%.

[0116] (4) Purify to obtain a single target sequence

[0117] The 4 portions of desorption solution containing a single target sequence obtained in step (2) were centrifuged in a low-temperature high-speed centrifuge at a speed of 5500 rpm and a temperature of 15°C to obtain a clarified sample aqueous solution, which was centrifuged and filtered to obtain an oligonucleotide solution containing about 66 μg / ml (OD260=2 at 260 nm), and concentrated to a dry powder under reduced pressure (-0.07 MPa) at about 50°C. The dry powder was refrigerated in a refrigerator at 4°C. Detected by HPLC (the method is the same as step (3) of this embodiment, except that the test solution is the dry powder obtained by diluting it with purified water to a concentration of OD260 at 260 nm). 260nm =0.05~0.1), the recovery rate of single target sequence was more than 13.2%, the purity of single target sequence was more than 72%, and the percentage of single impurity content of sequence length N+X (N=20, X=1 or 2) and NX (N=20, X=1 or 2) was less than 9.3%.

[0118] Example 6

[0119] This embodiment provides a method for separating mixed oligonucleotides with different sequences, comprising the following steps:

[0120] (1) Pretreatment by mixing different oligonucleotide sample solutions:

[0121] The ammonolysis solution containing mixed oligonucleotides of different sequences (the target sequence is a mixture of DNA oligonucleotide sequences SEQ ID NO.1-4 with a length of 20 nt, which contains sequence impurities of sequence length NX and sequence impurities of N+X, N=20, X is an integer ≥1) is concentrated under reduced pressure to remove ammonia water, and then diluted with purified water to 12 times the volume after concentration, and then adjusted to pH 8.2-8.6 with alkali (sodium bicarbonate). 2 ml of the obtained mixed oligonucleotide solution (mixed oligonucleotide concentration is 231 μg / ml) is centrifuged in a high-speed low-temperature centrifuge (the centrifugal speed and temperature are 6000 rpm and 20°C, respectively) for 3 minutes to obtain a supernatant.

[0122] (2) Chromatographic conditions

[0123] Reverse phase high performance liquid chromatography (HPLC) was used to separate and detect the mixed oligonucleotides. The HPLC detection conditions mentioned are: chromatographic column: C18 4.6*250mm, particle size 5μm, chromatographic column is specifically waters; detector: UV detection wavelength 240nm; mobile phase A: HPLC A liquid; mobile phase B: HPLC A liquid / acetonitrile volume ratio 80:20; flow rate: 1.0ml / min; column temperature: 55℃; injection volume: 30μL. The gradient program is as shown in the following table.

[0124] Table 8. Gradient program

[0125]

[0126] Desorption of the desorbate containing the single oligonucleotides from the C18 column began before the retention time of each target sequence.

[0127] (3) Purity test of desorption liquid

[0128] According to HPLC detection (operated according to step (3) in Example 1), the purity of the oligo single target sequence in each desorption liquid collected was above 72%, and the recovery rate of the single target sequence was above 13%.

[0129] (4) Purify to obtain a single target sequence

[0130] The 4 portions of desorption solution containing a single target sequence obtained in step (2) were centrifuged in a low-temperature high-speed centrifuge at a speed of 5500 rpm and a temperature of 15°C to obtain a clarified sample aqueous solution, which was centrifuged and filtered to obtain an oligonucleotide solution containing about 66 μg / ml (OD260=2 at 260 nm), and concentrated to a dry powder under reduced pressure (-0.07 MPa) at about 50°C. The dry powder was refrigerated in a refrigerator at 4°C. Detected by HPLC (the method is the same as step (3) of this embodiment, except that the test solution is the dry powder obtained by diluting it with purified water to a concentration of OD260 at 260 nm). 260nm=0.05~0.1), the recovery rate of a single target sequence was over 13.8%, the purity of a single target sequence was over 73.2%, and the percentage of a single impurity of sequence lengths N+X (N=20, X=1 or 2) and NX (N=20, X=1 or 2) were both less than 9.6%.

[0131] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

Claims

1. A method for separating mixed oligonucleotide sequences, characterized in that: The method comprises separating and detecting mixed oligonucleotide samples by high performance liquid chromatography, and the chromatographic conditions are: Octadecylsilane bonded silica gel is used as filler, HPLC A liquid is used as mobile phase A; a mixture of HPLC A liquid and acetonitrile is used as mobile phase B, and the volume ratio of HPLC A liquid to acetonitrile is (60-80): (40-20); HPLC A liquid is 0.1M TEAA; the gradient elution program includes: 0-30min, the volume ratio of mobile phase A and mobile phase B is 90%-98%:10%-2%→76%-50%:24%-50%; 30-30.1min, the volume ratio of mobile phase A to mobile phase B is 76%~50%:24%~50%→10%:90%; 30.1-35min, the volume ratio of mobile phase A to mobile phase B is 10%:90%→10%:90%; 35min~35.1min, the volume ratio of mobile phase A and mobile phase B is 10%:90%→92%~98%:8%~2%; 35.1min~40min, the volume ratio of mobile phase A and mobile phase B is 92%~98%:8%~2%→92%~98%:8%~2%.

2. The method for separation and detection of mixed different oligonucleotide sequences according to claim 1, characterized in that: The chromatographic conditions include at least one of the following conditions: (1) The detection wavelength is 240-270 nm, preferably 260 nm; (2) The flow rate is 0.4-1.5 ml / min, preferably 1 ml / min; (3) The column temperature is 55-65°C, preferably 60°C; (4) The specification of the chromatographic column is 4.6 mm × 250 mm, and the particle size is 3.5-5 μm; preferably, the particle size is 3.5 μm, and the chromatographic column is selected from Waters; (5) The injection volume is 10-30ul, preferably 20μL; (6) The volume ratio of HPLC A solution and acetonitrile is 70:

30.

3. The method for separation and detection of mixed different oligonucleotide sequences according to claim 1 or 2, characterized in that: The mixed different oligonucleotide samples are any of the following: (a), aminolysis solution containing mixed oligonucleotides of different sequences; (b) The ammonolysis solution in (a) is concentrated under reduced pressure to remove aqueous ammonia, and then diluted with purified water to 8 to 12 times, preferably 10 times, the volume after concentration; The ammonolysis solution in (c) and (a) is concentrated under reduced pressure to remove aqueous ammonia, and then diluted with a buffer solution to 8 to 12 times, preferably 10 times, the volume after concentration.

4. The method for separation and detection of mixed different oligonucleotide sequences according to any one of claims 1 to 3, characterized in that: The pH value of the mixed samples of different oligonucleotides is 8.5±0.5, preferably 8.2-8.

6.

5. The method for separation and detection of mixed different oligonucleotide sequences according to claim 4, characterized in that: The base for adjusting the pH value is an organic base or an inorganic base.

6. The method for separation and detection of mixed different oligonucleotide sequences according to claim 5, characterized in that: The pH value can be adjusted by triethylamine, ammonia, sodium bicarbonate, sodium hydroxide or ammonium bicarbonate.

7. The method for separation and detection of mixed different oligonucleotide sequences according to any one of claims 1 to 6, characterized in that: The mixing of different oligonucleotide samples also includes a pretreatment step: taking the mixed different oligonucleotide samples, centrifuging, and retaining the supernatant.

8. The method for separation and detection of mixed different oligonucleotide sequences according to claim 7, characterized in that: The concentration of the mixed different oligonucleotide samples is 99-231 μg / ml, preferably 165 μg / ml; And / or, the centrifugation conditions are a centrifugal speed of 4000 rpm to 6000 rpm, a temperature of 10°C to 20°C, and a centrifugation time of 3 minutes to 8 minutes; preferably, the centrifugal conditions are a centrifugal speed of 5500 rpm, a temperature of 15°C, and a centrifugation time of 5 minutes.

9. The method for separation and detection of mixed different oligonucleotide sequences according to any one of claims 1 to 8, characterized in that: The method further comprises centrifuging the collected eluate, retaining the supernatant, and then concentrating the supernatant.

10. The method for separation and detection of mixed different oligonucleotide sequences according to claim 9, characterized in that: The centrifugal conditions are a centrifugal speed of 4000 rpm-6000 rpm, a temperature of 10°C-20°C, and a centrifugal time of 3 minutes-8 minutes; preferably, the centrifugal conditions are a centrifugal speed of 5500 rpm, a temperature of 15°C, and a centrifugal time of 5 minutes; And / or, the concentration step is to concentrate to dry powder under reduced pressure at a temperature of 45°C to 60°C and -0.1Mpa to 0.1Mpa; preferably, the temperature is 50°C and -0.07Mpa to concentrate to dry powder under reduced pressure.

Images